cory-ko/KBWS
Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
-------------------------------------------------------------------------
KBWS - KEIO Bioinformatics Web Service - EMBASSY package ver. 1.0.9
Web home: http://www.g-language.org/kbws/
All rights reserved. Copyright (C) 2010 by OSHITA Kazuki.
This EMBASSY package is free software for non-commercial and
education use only (limited due to wsdl2h); you can redistribute it
and/or modify it under the terms of the GNU General Public License as
published by the Free Software Foundation, version 2 of the License
expect commercial use.
See also GNU General Public License Version 2, included in this
package as COPYING.
-------------------------------------------------------------------------
[ About ]----------------------------------------------------------------
This is an EMBASSY package for the utilization of bioinformatics web
servcie.
All of the tools included in this package are wrapper programs to
utilize KBWS SOAP services, which are web APIs to access numerous
bioinformatics web services under unified interface with SOAP 1.1.
Detailed documentation about KBWS SOAP services are available at
http://www.g-language.org/kbws/.
-------------------------------------------------------------------------
[ Installation ]---------------------------------------------------------
REQUIREMENT
EMBOSS (> 6.6.0) - This EMBASSY package requires EMBOSS version 6.6.0 or
above.
INSTALLATION
In the following examples, we assume downloaded EMBOSS filename is
EMBOSS-latest.tar.gz (EMBOSS-6.6.0)
1. Download and compile EMBOSS source code
% wget ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz
(or "curl -O ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz")
% tar xzf EMBOSS-latest.tar.gz
% cd EMBOSS-6.6.0
% ./configure
% make
% sudo make install
2. Make new directory "embassy" (in EMBOSS-6.6.0/ directory) if it does
not exist already
% mkdir embassy
3. Go into that directory
% cd embassy
4. Place KBWS file in current directory
% wget http://www.g-language.org/kbws/source/KBWS-1.0.9.tar.gz
(or "curl -O http://www.g-language.org/kbws/source/KBWS-1.0.0.tar.gz")
5. Uncompress the KBWS tarball package, and go into the new KBWS directory
% tar xzf KBWS-1.0.9.tar.gz
% cd KBWS-1.0.9
( EMBOSS-6.6.0/embassy/KBWS-1.0.9 )
6. Configure and compile
% ./configure (use same options as you used to compile emboss)
% make
% sudo make install
NOTE
libtool problem
On some systems there may be compatibility problems with different
automake, autoconf or libtool versions. If a libtool problem
arises you can try deleting the following files:
config.cache
ltmain.sh
ltconfig
libtool
and then type
% aclocal -I m4
% autoconf
% automake -a
and then retry make.
Update of EMBOSS
When users are upgrading EMBOSS, please be sure to uninstall old version
of EMBOSS and KBWS. If you override them, some older version of files
may cause errors.
EMBOSS is already installed
When EMBOSS is already installed in your system, please install KBWS at
the same PATH as existed EMBOSS by '--prefix' option.
Non-root users (using '--prefix' option)
If you use './configure' command with '--prefix' option, please rewrite
'emboss_acdroot' and 'emboss_data' value in ~/.embossrc file. Please check
'~/.embossrc' file for further informations.
-------------------------------------------------------------------------
[QuickStart]-------------------------------------------------------------
DATABASE DEFINITION
The database definitions for following commands are available at
"KBWS-1.0.9/data/embossrc-template".
The latest version is available at following URL:
http://soap.g-language.org/kbws/embossrc
INFORMATION OF KBWS TOOLS
List of all tools
If you want to get list of all tools included in KBWS, you can try
the below command.
% wossname -showembassy KBWS
Documentation
You can view available documentations with "tfm" utility included in
EMBOSS.
% tfm kblast # example for "kblast"
USAGE EXAMPLE
Sample files used in this section are available from EMBOSS package.
( EMBOSS-6.6.0/test/data/* )
1. kblast (BLAST)
% kblast swissprot:FOXP2_HUMAN -database swissprot -format 8 -eval 1e-100
Search similar sequences in public repositories using BLAST
Output file [foxp2_human.kblast]:
% cat foxp2_human.kblast
query sp|Q8MJ98.3|FOXP2_PONPY 99 457 1 0 240 697 238 695 0.0 2005
query sp|Q5QL03.1|FOXP2_HYLLA 99 457 1 0 240 697 238 695 0.0 2005
query sp|Q8MJ99.1|FOXP2_GORGO 99 457 1 0 240 697 238 695 0.0 2005
query sp|Q8MJA0.1|FOXP2_PANTR 99 457 1 0 240 697 241 698 0.0 2005
query sp|P58463.2|FOXP2_MOUSE 99 457 1 0 240 697 239 696 0.0 2005
query sp|Q8MJ97.1|FOXP2_MACMU 99 457 1 0 240 697 239 696 0.0 2005
query sp|O15409.2|FOXP2_HUMAN 100 458 0 0 240 697 240 697 0.0 2005
query sp|P0CF24.1|FOXP2_RAT 99 456 2 0 240 697 235 692 0.0 2000
query sp|Q4VYS1.1|FOXP2_XENLA 95 450 8 0 240 697 231 688 0.0 1948
query sp|Q5W1J5.1|FOXP1_XENLA 68 373 87 6 240 697 105 560 8e-148 1350
query sp|A4IFD2.1|FOXP1_BOVIN 66 371 89 6 240 697 201 656 4e-146 1335
query sp|Q9H334.1|FOXP1_HUMAN 66 372 89 7 240 697 203 659 2e-144 1321
query sp|Q498D1.1|FOXP1_RAT 65 371 90 7 240 697 237 693 9e-144 1315
query sp|P58462.1|FOXP1_MOUSE 65 372 89 7 240 697 231 687 1e-143 1314
query sp|Q58NQ4.1|FOXP1_CHICK 65 369 92 7 240 697 212 668 1e-143 1313
query sp|Q8IVH2.1|FOXP4_HUMAN 60 332 119 5 240 686 201 650 6e-131 1204
query sp|Q9DBY0.1|FOXP4_MOUSE 60 332 118 17 240 686 207 642 2e-126 1166
query sp|Q4VYR7.1|FOXP4_XENLA 58 336 120 20 241 696 187 622 6e-126 1161
2. kcentroidfold (Centroid Fold)
% kcentroidfold
RNA 2D structure prediction from an RNA sequence using CentroidFold
Input (gapped) sequence(s): dna.fasta
Output image file name [kcentroidfold.png]:
Output file [fasta.centroidfold]:
% cat fasta.centroidfold
>FASTA
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
((((((((((((((((((((((((((((((((((((((((((((((((....))))))))))))))))))))))))))))))))))))))))))))))))
% ls kcentroidfold.png
kcentroidfold.png
3. kweblogo (WebLogo)
% kweblogo dna.m-fasta -filename kweblogo.png
make the generation of sequence logos using WebLogo
Output file name [kweblogo.png]:
% ls kweblogo.png
kweblogo.png
SAMPLE DATA
You can use sample data included in EMBOSS.
Please check test/ directory in EMBOSS package.
-------------------------------------------------------------------------
[ Content ]--------------------------------------------------------------
gSOAP Toolkit
This EMBASSY package is depended on gSOAP Toolkit to use SOAP
transfer, which is included in gsoap/ directory and automatically used
during compilation.
-------------------------------------------------------------------------
[Contact]----------------------------------------------------------------
Kazuki Oshita < cory@g-language.org >
Institute for Advanced Biosciences, Keio University.
-------------------------------------------------------------------------