Skip to content
 
 

Repository files navigation

EternaFold - Improving RNA structure prediction through multitask learning

EternaFold performs multitask learning to improve RNA structure prediction. Its training tasks include 1) predicting single structures, 2) maximizing the likelihood of structure probing data, and 3) predicting experimentally-measured affinities of RNA molecules to proteins and small molecules.

Its training data comes from diverse high-throughput experimental crowdsourced data from the Eterna project.

EternaFold is possible thanks to CONTRAfold-SE (C.-S. Foo, C. Pop).

For scripts and datasets pertaining to benchmarking EternaFold on secondary structure prediction tasks, see the EternaBench repo.

If you use EternaFold in your research, please cite

H.K. Wayment-Steele, W. Kladwang, A.I. Strom, J. Lee, A. Treuille, A. Becka,
Eterna Participants, R. Das. (2022). RNA secondary structure packages ranked
and improved by high-throughput experiments. Nature Methods (In press).

Installation

Clone the repository and run make in src to compile. Multithreaded version: run make multi in src.

Compiled with gcc 4.8.5 and openmpi 2.0.2.

See instructions in README_LinearFold-E_patch.md for using EternaFold parameters with LinearFold and LinearPartition algorithms.

Prediction

Single-structure prediction

Predict the MEA structure of example test sequence (Hammerhead ribozyme), using the EternaFold parameters:

./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1

Output:

Training mode: 
Use constraints: 0
Use evidence: 0
Predicting using MEA estimator.
>test.seq
CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG
>structure
(((((((((((((......))))))..)....((((.....))))...))))))

SHAPE-directed secondary structure prediction

Predict the maximum-likelihood structure of the given sequence, using SHAPE likelihood potentials learned from Cloud Lab SHAPE MAP-seq experiments (Wayment-Steele et. al, 2022).

Predicted structure of example construct without incorporating SHAPE data:

./src/contrafold predict test_SHAPE.seq --params parameters/EternaFoldParams.v1

Output:

Training mode: 
Use constraints: 0
Use evidence: 0
Predicting using MEA estimator.
>test_SHAPE.seq
UGUACCGGAAGGUGCGAAUCUUCCG
>structure
.....((((((((....))))))))

Alternate structure is predicted upon incorporating SHAPE data in test_SHAPE.bpseq:

./src/contrafold predict test_SHAPE.bpseq --evidence --numdatasources 1 --kappa 0.1 --params parameters/EternaFoldParams_PLUS_POTENTIALS.v1 

Output:

Training mode: 
Use constraints: 0
Use evidence: 1
Predicting using MEA estimator.
>test_SHAPE.bpseq
UGUACCGGAAGGUGCGAAUCUUCCG
>structure
((((((....)))))).........

Ensemble free energy prediction

$ ./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --partition

Output (log partition coefficient)

Training mode: 
Use constraints: 0
Use evidence: 0
Log partition coefficient for "test.seq": 13.7489

Base-pairing probability prediction

./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --posteriors 0.00001 bps.txt

Base-pairing probabilities are output to bps.txt:

1 C 9:3.55095e-05 28:0.000274751 31:0.0050855 33:0.000420935 46:0.00100593 52:0.000674974 54:0.815493
2 G 7:0.000290278 10:0.000150796 16:6.48946e-05 22:0.000711706 24:6.9622e-05 26:0.000379153 27:0.000149917 30:0.005751
06 34:0.00134091 35:0.00017805 45:0.000245854 50:0.000512436 53:0.913047
3 C 9:0.000150353 15:6.90445e-05 21:0.000968743 28:0.00245682 31:0.00417261 33:0.00229046 46:0.000703465 52:0.91348 54
:0.000561778
4 U 20:0.00104566 25:0.00225947 28:0.000790812 29:0.000620939 31:0.0282994 32:0.00417285 41:2.64421e-05 46:0.000350788
 47:0.00012951 48:0.000177715 49:0.000466242 51:0.825096 52:8.55103e-05 54:0.000171393
5 G 12:0.000356127 19:0.00100131 24:0.00327509 26:0.00645875 27:0.000742048 30:0.189649 45:0.00133716 50:0.74545 53:0.
000533715
6 U 11:0.00030157 17:0.000271142 23:0.00321799 25:0.0050542 28:0.0026176 29:0.230025 31:0.000505041 32:0.0156585 43:0.
000190485 44:0.00204912 46:0.00040755 47:0.0307307 48:0.0032191 49:0.561613 52:0.00014478
...

Sample structures

Stochastically samples structures from the underlying distribution.

./src/contrafold sample test.seq --params parameters/EternaFoldParams.v1 --nsamples 10

Output

Training mode: 
Use constraints: 0
Use evidence: 0
(((((((..((((......)))).......))((((.....))))....)))))
..(.(((.((....(((....))))).)))).((((.....)))).........
................................((((.....)))).........
........(((((......)))))........((((.....)))).........
.(((((.((((((......)))))).......((((.....))))...))))).
.(((((..((((........))))........((((.....))))...))))).
.((((((.(((((......)))))........((((.....)))))..))))).
.(((((.((((((......)))))).......((((.....))))...))))).
....(((.(((((......)))))...)))..((((.....)))).........
....(((((((((......))))))..)))..((((.....)))).........

sample can be used in conjunction with SHAPE data to sample SHAPE-reweighted distribution:

./src/contrafold sample test_SHAPE.bpseq --params parameters/EternaFoldParams_PLUS_POTENTIALS.v1 --nsamples 10 --evidence --numdatasources 1 --kappa 0.1

Output:

Training mode: 
Use constraints: 0
Use evidence: 1
.(((((....)))))..........
((((((....)))))).........
((((((....)))))).........
((((((....)))))).........
((((((....)))))).........
.(((((....)))))..........
.(.(((....))).)..........
.(((((....)))))..........
...(((....)))............
.(((((....)))))..........

Please see the documentation of CONTRAfold for further information on parameters and usage. See below for documented discrepancies (besides parameters) from CONTRAfold codebases.

Training

Training data is in input_data (unzip first).

Text files containing the lists used for training, test, and holdout models for the EternaFold models reported in Wayment-Steele et al. (2020) are found in the datalists repo.

From CONTRAfold-SE:

"Learn parameters based on a set of sequences, in which sequences with associated probing data have data from 2 sources, and with a relative weight (specified by hyperparam_data) of 0.1.

Assumes that folder "trainset" has a set of sequences of type ".bpseq" in evidence format for the ones with data.

contrafold train --regularize 1 --numdatasources 2 --maxiter 1000 --hyperparam_data 0.1 --initweights contrafold.params.complementary_data2 trainset/*.bpseq

If there are a large number of input files used (> 1000 files; e.g. for training on RMDB data), provide a text file containing the list of example files instead with the --examplefile option.

contrafold train --regularize 1 --numdatasources 1 --maxiter 500 --examplefile examples.txt"

Training options for riboswitch data

contrafold train --examplefile ../production_struct_riboswitches.txt --regularize 32 --kd_hyperparam_data 30 --ligand --ligand_bonus 90 --lig_hyperparam_data 30

kd_hyperparam_data: weight placed on no-ligand kd values. lig_hyperparam_data: weight placed on ligand kd values. ligand_bonus: ligand bonus used.

Input file formats

Chemical mapping

From CONTRAfold-SE:

"To support structure probing data we adapt the BPSEQ format in two ways to support sequences with only probing data (BPP2SEQ), and sequences with both probing data and known structure (base-pairings) (BPP2TSEQ).

The original BPSEQ format consists of a row for each base in the RNA molecule, describing the index (1-based), the actual base present, and the index of the pairing partner (0 if unpaired).

In the BPP2SEQ format, there is an evidence string e<N> following the base, where <N> is an integer denoting how many probing data sources there are, followed by <N> (positive) values of the unpairedness potential (derived from probing data) for that base. For instance, e2 denotes 2 probing sources, and should be followed by a two positive real numbers; all entries should have the same evidence string. An example is shown below:

1 G e2 7.070000e+00 -1.000000e+00
2 A e2 7.570000e+00 3.333333e-02
3 A e2 6.500000e+00 -1.000000e+00
4 A e2 5.310000e+00 4.444444e-02

In the BPP2TSEQ format, the evidence string is t<N> instead, and following the unpairedness potential values is the index of the pairing partner."

Values that are less than 1e-5 are ignored (treated as not present) for numerical stability.

Riboswitch format

To account for three different constrained structures, riboswitch molecules are input using a BPSEQ file that is modified to have three columns correpsonding to three different constrained structures:

k1.0 2.0 99
1 G -1 -1 -1
2 A -1 -1 -1
3 U -1 19 19
4 C -1 18 18

❗️ Discrepancies from CONTRAfold-SE code

This code has been modified in two ways that means its output, even using the CONTRAfold parameters, will differ from the CONTRAfold codebase here and the CONTRAfold-SE codebase here.

  1. A bug was fixed in the multiloop traceback InferenceEngine.ipp which was first identified by He Zhang (Oregon State).

  2. The minimum allowable hairpin size was increased from 0 to 3 to prevent structure predictions with (()) hairpins. To revert back to the original CONTRAfold behavior, set C_MIN_HP_LENGTH=0 in Config.hpp before compiling.

Predictions for Hammerhead Ribozyme sequence, using default CONTRAfold parameters: CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG

contrafold predict hhr.bpseq --partition

Version hhr.bpseq Log Partition Coefficient
CONTRAfold v2.02 6.87394
CONTRAfold-SE 6.87394
EternaFold code, no ML fix and C_MIN_HP_LENGTH=0 6.87394
EternaFold code, C_MIN_HP_LENGTH=0 6.83585
EternaFold code 6.77285

About

Improving RNA structure prediction through multitask learning on diverse crowdsourced data.

Resources

Stars

0 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages