Hello,
I am running the Lindel script on a sequence of interest. I kind of expected that I would get all possible targets in the sequence with an overall InDel score (similar to the output generated by CRISPOR). However, i seem to get all possible InDELs only for one target within the sequence of interest. Can you please explain how/if I can get information about all possible guides in a given sequence and how the LINDEL score which is shown in CRISPOR is calculated/if the script can do this?
Thanks for your help.
PS: This is the command I was running:
python3 Lindel_prediction.py GGCTGTGACGCCAGAGCCACCCACCTCCACTGCTGGCCACAGAGATGGGCGATCACCTGGTGAAACACGGCGACGGAGTGAAGGACATTGCGTTCGAGGTGGAAGACTGTGACTACATAGTGCAGGTAAGACCACACCTGGGCTGGTGCAGAGACAAAGCAATAAGGCTC sample.txt
Hello,
I am running the Lindel script on a sequence of interest. I kind of expected that I would get all possible targets in the sequence with an overall InDel score (similar to the output generated by CRISPOR). However, i seem to get all possible InDELs only for one target within the sequence of interest. Can you please explain how/if I can get information about all possible guides in a given sequence and how the LINDEL score which is shown in CRISPOR is calculated/if the script can do this?
Thanks for your help.
PS: This is the command I was running:
python3 Lindel_prediction.py GGCTGTGACGCCAGAGCCACCCACCTCCACTGCTGGCCACAGAGATGGGCGATCACCTGGTGAAACACGGCGACGGAGTGAAGGACATTGCGTTCGAGGTGGAAGACTGTGACTACATAGTGCAGGTAAGACCACACCTGGGCTGGTGCAGAGACAAAGCAATAAGGCTC sample.txt