From e1f510ce33953efb0931fb82245b61b8d7977012 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 11:25:45 -0600 Subject: [PATCH 01/47] Added regression tests --- CMakeLists.txt | 12 + regression_test/quick_regression_test.sh | 24 + .../test_regression_dna_good_result | 30000 ++++++++++++++++ .../test_regression_protein_good_result | 30000 ++++++++++++++++ 4 files changed, 60036 insertions(+) create mode 100755 regression_test/quick_regression_test.sh create mode 100644 regression_test/test_regression_dna_good_result create mode 100644 regression_test/test_regression_protein_good_result diff --git a/CMakeLists.txt b/CMakeLists.txt index c5a1345..5654b0d 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -29,3 +29,15 @@ get_property(LANGUAGES GLOBAL PROPERTY ENABLED_LANGUAGES) if(CMAKE_CUDA_COMPILER AND "CUDA" IN_LIST LANGUAGES) target_compile_options(program_gpu PUBLIC $<$:-Xcompiler -fopenmp>) endif() + +add_custom_target( + regression_tests ALL + COMMAND ${CMAKE_COMMAND} -E make_directory ${CMAKE_BINARY_DIR}/regression_test + COMMAND ${CMAKE_COMMAND} -E copy_if_different ${CMAKE_CURRENT_SOURCE_DIR}/regression_test/* ${CMAKE_BINARY_DIR}/regression_test +) + +add_custom_target( + test-data ALL + COMMAND ${CMAKE_COMMAND} -E make_directory ${CMAKE_BINARY_DIR}/test-data + COMMAND ${CMAKE_COMMAND} -E copy_if_different ${CMAKE_CURRENT_SOURCE_DIR}/test-data/* ${CMAKE_BINARY_DIR}/test-data +) diff --git a/regression_test/quick_regression_test.sh b/regression_test/quick_regression_test.sh new file mode 100755 index 0000000..589a261 --- /dev/null +++ b/regression_test/quick_regression_test.sh @@ -0,0 +1,24 @@ +#!/bin/bash + +#Clean up old results +rm -f test_regression_dna_out test_regression_protein_out + +#Generate new results +./program_gpu dna ./test-data/dna-reference.fasta ./test-data/dna-query.fasta test_regression_dna_out >/dev/null 2>&1 +./program_gpu aa ./test-data/protein-reference.fasta ./test-data/protein-query.fasta test_regression_protein_out >/dev/null 2>&1 + +#Compare new results to correct results +diff_dna=$(diff test_regression_dna_out ./regression_test/test_regression_dna_good_result ) +diff_rna=$(diff test_regression_protein_out ./regression_test/test_regression_protein_good_result) + +if [ "$diff_dna" == "" ] && [ "$diff_rna" == "" ] +then + echo "REGRESSION TESTS PASS" + exit 0 +else + echo "#############DNA#############" + echo "$diff_dna" + echo "#############RNA#############" + echo "$diff_rna" + exit 1 +fi \ No newline at end of file diff --git a/regression_test/test_regression_dna_good_result b/regression_test/test_regression_dna_good_result new file mode 100644 index 0000000..cffd276 --- /dev/null +++ b/regression_test/test_regression_dna_good_result @@ -0,0 +1,30000 @@ +90 +90 +142 +142 +146 +43 +58 +59 +57 +58 +142 +146 +98 +150 +150 +146 +150 +146 +21 +132 +146 +150 +74 +35 +32 +146 +33 +32 +32 +31 +32 +32 +32 +29 +27 +41 +150 +41 +146 +39 +58 +150 +28 +146 +144 +22 +146 +147 +150 +149 +146 +150 +65 +31 +146 +146 +82 +28 +93 +85 +41 +65 +58 +78 +31 +27 +32 +37 +29 +32 +24 +29 +33 +33 +33 +150 +146 +44 +150 +62 +150 +142 +62 +150 +64 +86 +76 +150 +146 +150 +150 +150 +147 +146 +146 +146 +23 +150 +150 +146 +107 +104 +146 +45 +146 +23 +150 +146 +150 +150 +150 +150 +142 +146 +150 +147 +146 +150 +69 +50 +56 +40 +29 +52 +41 +47 +54 +41 +31 +24 +31 +36 +90 +150 +98 +142 +146 +116 +146 +142 +150 +150 +144 +142 +146 +142 +150 +150 +142 +150 +146 +146 +150 +150 +98 +150 +45 +58 +150 +146 +150 +54 +150 +146 +150 +38 +150 +103 +93 +107 +111 +81 +117 +130 +146 +139 +54 +108 +90 +84 +81 +76 +67 +59 +51 +45 +43 +34 +31 +21 +147 +92 +76 +69 +66 +63 +54 +52 +46 +38 +30 +146 +150 +49 +27 +30 +146 +142 +63 +46 +38 +146 +146 +142 +150 +32 +146 +146 +37 +146 +150 +52 +142 +55 +150 +75 +148 +45 +150 +150 +150 +150 +150 +146 +150 +146 +106 +150 +146 +150 +150 +150 +111 +25 +66 +32 +150 +80 +134 +84 +60 +146 +150 +150 +24 +34 +106 +148 +150 +146 +142 +150 +146 +150 +146 +138 +51 +150 +67 +150 +150 +127 +150 +88 +142 +142 +37 +142 +150 +146 +146 +104 +130 +36 +29 +116 +116 +106 +150 +69 +150 +150 +41 +115 +133 +146 +21 +34 +93 +113 +86 +51 +52 +150 +148 +138 +136 +113 +146 +146 +150 +147 +150 +150 +150 +70 +150 +142 +79 +61 +146 +150 +139 +146 +22 +144 +66 +148 +138 +100 +63 +150 +44 +150 +150 +142 +150 +150 +150 +146 +23 +146 +127 +127 +21 +21 +150 +146 +130 +21 +150 +146 +150 +146 +27 +146 +146 +47 +146 +150 +150 +146 +150 +55 +46 +150 +35 +48 +31 +27 +29 +27 +46 +45 +50 +24 +35 +38 +31 +44 +29 +25 +146 +88 +100 +121 +37 +146 +22 +28 +150 +142 +146 +43 +150 +39 +144 +53 +150 +146 +148 +24 +146 +146 +150 +33 +150 +41 +26 +138 +35 +47 +150 +135 +150 +150 +150 +150 +150 +146 +119 +146 +149 +142 +146 +148 +48 +119 +92 +150 +22 +21 +37 +148 +142 +150 +150 +40 +142 +150 +148 +150 +150 +114 +150 +146 +28 +150 +21 +144 +56 +150 +150 +80 +45 +105 +146 +146 +142 +27 +27 +146 +38 +39 +61 +150 +148 +146 +28 +150 +146 +150 +37 +150 +150 +150 +104 +96 +142 +150 +72 +74 +21 +21 +150 +150 +40 +37 +48 +48 +48 +48 +37 +35 +25 +30 +150 +74 +44 +36 +35 +39 +32 +27 +37 +36 +26 +142 +96 +89 +150 +86 +89 +150 +55 +60 +33 +72 +74 +77 +79 +62 +134 +150 +147 +150 +146 +23 +50 +148 +150 +91 +121 +22 +138 +22 +150 +150 +150 +61 +31 +148 +23 +21 +139 +50 +146 +146 +138 +150 +150 +150 +144 +29 +68 +146 +97 +89 +146 +150 +150 +50 +125 +106 +24 +146 +70 +146 +38 +29 +146 +64 +45 +150 +149 +150 +146 +150 +146 +150 +150 +150 +146 +35 +150 +146 +150 +55 +142 +148 +150 +150 +21 +128 +81 +150 +142 +144 +150 +134 +146 +150 +63 +146 +150 +148 +63 +136 +63 +92 +95 +47 +150 +27 +61 +138 +30 +84 +71 +150 +150 +146 +150 +38 +40 +66 +27 +45 +150 +150 +146 +52 +24 +148 +147 +146 +58 +150 +150 +150 +37 +150 +21 +21 +75 +68 +70 +146 +61 +60 +86 +142 +142 +50 +35 +148 +150 +142 +150 +150 +33 +146 +146 +150 +143 +41 +146 +146 +77 +65 +146 +78 +69 +150 +150 +26 +77 +122 +150 +146 +33 +146 +150 +21 +150 +146 +55 +146 +150 +142 +142 +150 +150 +150 +48 +146 +146 +146 +150 +146 +146 +150 +146 +91 +71 +94 +105 +128 +150 +138 +150 +150 +148 +150 +150 +146 +150 +146 +149 +146 +150 +72 +112 +88 +38 +27 +102 +117 +108 +22 +84 +150 +150 +97 +95 +91 +87 +148 +146 +146 +134 +146 +65 +46 +35 +33 +56 +29 +27 +47 +47 +47 +47 +47 +47 +46 +81 +146 +81 +144 +30 +146 +146 +107 +94 +150 +113 +124 +146 +125 +146 +146 +150 +150 +43 +146 +61 +146 +144 +150 +150 +131 +21 +142 +150 +150 +97 +40 +49 +26 +25 +26 +25 +26 +25 +25 +42 +143 +91 +38 +63 +42 +150 +150 +138 +150 +28 +94 +146 +146 +146 +47 +46 +39 +86 +33 +26 +64 +36 +39 +37 +32 +46 +30 +36 +150 +64 +27 +43 +64 +33 +38 +46 +83 +36 +36 +30 +31 +39 +35 +26 +148 +70 +21 +150 +32 +150 +150 +146 +42 +150 +29 +150 +81 +39 +150 +85 +146 +150 +44 +146 +146 +150 +150 +150 +148 +150 +150 +67 +148 +150 +146 +150 +146 +150 +42 +138 +146 +142 +106 +90 +89 +52 +46 +150 +150 +30 +29 +150 +90 +39 +46 +33 +37 +150 +68 +150 +45 +22 +142 +50 +141 +150 +90 +93 +48 +49 +65 +65 +56 +38 +32 +76 +75 +41 +106 +106 +76 +22 +74 +73 +126 +56 +94 +53 +59 +62 +63 +60 +63 +63 +63 +63 +63 +133 +31 +89 +126 +88 +76 +76 +49 +47 +47 +38 +33 +146 +146 +150 +150 +146 +149 +150 +150 +146 +146 +122 +150 +126 +142 +150 +150 +150 +146 +22 +21 +23 +150 +40 +150 +85 +146 +150 +148 +146 +77 +63 +51 +91 +42 +150 +150 +150 +27 +143 +142 +150 +142 +146 +142 +146 +150 +57 +146 +100 +87 +146 +149 +114 +133 +150 +32 +146 +108 +94 +96 +144 +150 +21 +150 +150 +150 +146 +150 +150 +143 +33 +150 +45 +76 +130 +131 +146 +150 +93 +39 +37 +37 +37 +37 +37 +150 +109 +112 +51 +110 +149 +119 +64 +142 +21 +21 +146 +146 +29 +150 +24 +146 +146 +150 +150 +22 +26 +143 +108 +150 +47 +150 +148 +142 +101 +144 +150 +142 +142 +150 +31 +146 +142 +44 +146 +146 +150 +146 +150 +146 +150 +150 +64 +42 +110 +150 +150 +142 +27 +39 +150 +75 +75 +146 +150 +28 +119 +150 +28 +76 +142 +150 +119 +34 +30 +119 +150 +148 +148 +150 +150 +141 +146 +146 +150 +146 +150 +54 +146 +146 +146 +150 +150 +150 +150 +146 +150 +150 +150 +34 +146 +150 +138 +150 +65 +46 +35 +33 +54 +29 +27 +45 +45 +45 +45 +45 +45 +44 +142 +51 +50 +50 +50 +50 +46 +34 +28 +150 +142 +150 +146 +81 +69 +83 +85 +73 +142 +71 +68 +130 +150 +76 +114 +45 +63 +145 +117 +61 +42 +142 +68 +29 +143 +148 +93 +142 +150 +146 +146 +150 +146 +150 +150 +148 +150 +150 +142 +150 +21 +146 +146 +146 +146 +26 +150 +146 +96 +55 +122 +127 +28 +144 +98 +83 +129 +142 +68 +55 +142 +30 +146 +150 +134 +38 +149 +146 +32 +39 +31 +135 +35 +143 +150 +146 +146 +150 +24 +26 +22 +142 +56 +63 +37 +36 +147 +146 +150 +150 +150 +37 +147 +110 +105 +100 +146 +146 +142 +150 +88 +88 +65 +150 +150 +97 +81 +30 +150 +150 +150 +146 +146 +148 +150 +60 +62 +150 +34 +134 +142 +146 +138 +109 +150 +146 +150 +150 +109 +74 +146 +150 +39 +119 +127 +21 +74 +146 +146 +21 +21 +142 +146 +150 +133 +150 +146 +150 +31 +150 +54 +150 +146 +112 +118 +69 +106 +108 +54 +50 +51 +21 +46 +41 +28 +33 +33 +48 +30 +30 +30 +30 +30 +150 +150 +150 +25 +146 +150 +37 +150 +59 +33 +76 +70 +21 +146 +64 +25 +25 +24 +24 +25 +24 +24 +146 +86 +136 +68 +21 +24 +150 +147 +138 +54 +146 +109 +146 +150 +142 +146 +148 +47 +149 +28 +150 +56 +148 +34 +150 +150 +146 +43 +148 +142 +31 +150 +146 +150 +24 +81 +150 +150 +146 +150 +28 +70 +92 +148 +150 +150 +140 +146 +144 +146 +150 +146 +146 +146 +150 +141 +146 +44 +142 +61 +150 +29 +150 +150 +146 +150 +31 +30 +145 +69 +67 +150 +40 +150 +37 +46 +146 +138 +150 +142 +150 +146 +65 +45 +46 +148 +135 +150 +146 +146 +64 +150 +150 +150 +21 +45 +146 +119 +119 +146 +150 +150 +150 +76 +150 +37 +148 +150 +62 +78 +27 +82 +53 +88 +94 +147 +150 +150 +23 +52 +146 +27 +148 +126 +146 +146 +146 +150 +30 +32 +150 +150 +62 +144 +146 +146 +150 +21 +73 +78 +32 +142 +46 +26 +22 +30 +25 +25 +25 +25 +29 +25 +27 +28 +25 +146 +24 +27 +30 +81 +85 +70 +61 +22 +146 +146 +150 +150 +150 +150 +118 +146 +146 +150 +58 +150 +146 +45 +150 +150 +67 +150 +21 +150 +89 +65 +150 +150 +21 +146 +146 +146 +150 +148 +148 +150 +92 +149 +95 +146 +146 +150 +145 +146 +46 +142 +150 +116 +90 +35 +74 +49 +150 +26 +142 +150 +150 +150 +150 +150 +21 +146 +150 +150 +146 +150 +146 +142 +150 +146 +150 +146 +70 +93 +95 +150 +103 +93 +150 +150 +139 +36 +150 +150 +150 +146 +146 +150 +146 +150 +146 +144 +23 +23 +73 +148 +47 +146 +150 +150 +142 +146 +108 +115 +150 +146 +146 +146 +150 +30 +150 +146 +142 +146 +148 +78 +150 +73 +141 +150 +150 +150 +72 +150 +138 +74 +38 +39 +37 +34 +32 +34 +31 +32 +37 +31 +30 +31 +30 +31 +37 +30 +30 +150 +40 +35 +33 +37 +40 +45 +40 +35 +32 +31 +32 +40 +32 +38 +34 +32 +31 +31 +146 +146 +136 +73 +124 +142 +140 +146 +146 +150 +21 +150 +139 +144 +36 +41 +31 +23 +150 +146 +40 +150 +150 +146 +146 +30 +35 +31 +25 +43 +28 +23 +23 +22 +24 +31 +56 +150 +150 +147 +41 +33 +150 +66 +44 +46 +55 +76 +69 +94 +146 +146 +150 +150 +150 +134 +150 +150 +142 +146 +150 +72 +40 +62 +146 +48 +54 +150 +150 +150 +146 +150 +150 +21 +142 +150 +146 +150 +150 +146 +150 +70 +68 +77 +150 +52 +150 +41 +150 +146 +146 +21 +21 +150 +122 +148 +132 +144 +130 +94 +42 +102 +85 +103 +35 +150 +53 +58 +60 +60 +59 +58 +55 +54 +59 +59 +68 +48 +55 +51 +36 +60 +51 +56 +28 +64 +37 +35 +45 +68 +68 +69 +65 +81 +65 +146 +22 +40 +32 +21 +21 +21 +103 +135 +142 +146 +150 +150 +146 +142 +150 +142 +150 +48 +98 +95 +104 +41 +119 +47 +41 +94 +148 +49 +148 +146 +24 +84 +123 +119 +150 +146 +59 +150 +82 +36 +75 +83 +83 +65 +37 +150 +143 +121 +150 +150 +99 +21 +146 +148 +95 +103 +101 +111 +109 +116 +81 +81 +87 +87 +86 +86 +57 +86 +25 +64 +126 +145 +89 +97 +146 +60 +142 +56 +150 +146 +150 +146 +84 +123 +89 +74 +88 +80 +150 +132 +31 +146 +146 +146 +62 +146 +150 +150 +24 +146 +150 +150 +150 +146 +94 +71 +94 +23 +150 +150 +150 +59 +150 +150 +148 +150 +150 +150 +150 +150 +22 +144 +62 +150 +144 +142 +51 +78 +150 +80 +75 +150 +142 +150 +146 +37 +90 +90 +146 +146 +150 +50 +35 +150 +150 +146 +150 +150 +112 +92 +150 +150 +150 +60 +150 +43 +150 +150 +146 +145 +146 +116 +21 +45 +150 +52 +150 +150 +146 +146 +142 +150 +102 +54 +104 +69 +28 +143 +31 +23 +146 +150 +150 +41 +146 +150 +33 +150 +21 +142 +146 +146 +150 +149 +143 +150 +31 +23 +150 +39 +44 +146 +150 +140 +150 +114 +146 +150 +150 +87 +70 +42 +42 +61 +54 +73 +143 +56 +58 +30 +74 +100 +71 +63 +146 +44 +150 +150 +55 +150 +146 +150 +146 +146 +97 +36 +23 +45 +64 +42 +40 +33 +54 +32 +32 +26 +35 +35 +35 +30 +41 +125 +31 +39 +37 +37 +40 +29 +33 +23 +28 +31 +27 +33 +30 +23 +26 +150 +57 +150 +150 +146 +150 +30 +148 +146 +45 +44 +146 +40 +150 +142 +146 +150 +150 +36 +25 +33 +62 +130 +142 +150 +63 +75 +44 +61 +59 +142 +150 +150 +49 +108 +142 +138 +116 +38 +110 +83 +58 +146 +145 +146 +21 +21 +146 +138 +21 +148 +145 +146 +146 +142 +51 +148 +104 +21 +21 +42 +150 +150 +146 +150 +150 +51 +146 +150 +24 +90 +127 +150 +115 +111 +47 +24 +47 +46 +26 +26 +112 +105 +135 +131 +90 +50 +135 +109 +106 +97 +81 +83 +72 +93 +79 +46 +73 +71 +51 +86 +83 +68 +64 +56 +28 +32 +37 +64 +58 +51 +42 +54 +40 +53 +37 +31 +40 +48 +49 +94 +50 +23 +60 +26 +146 +64 +150 +148 +120 +150 +134 +150 +59 +92 +142 +147 +150 +146 +148 +150 +150 +150 +146 +150 +49 +109 +138 +98 +40 +33 +146 +92 +150 +60 +31 +150 +150 +146 +150 +44 +44 +142 +138 +70 +27 +150 +25 +81 +94 +69 +69 +41 +41 +40 +40 +39 +39 +140 +105 +29 +150 +150 +146 +150 +31 +150 +150 +111 +148 +146 +146 +142 +125 +104 +29 +58 +32 +51 +81 +31 +72 +113 +91 +70 +70 +54 +32 +116 +21 +143 +150 +150 +150 +75 +56 +91 +45 +85 +45 +22 +22 +37 +143 +89 +41 +38 +39 +62 +29 +58 +22 +150 +46 +150 +30 +150 +150 +89 +84 +48 +64 +35 +147 +47 +101 +50 +33 +101 +94 +34 +42 +150 +146 +51 +146 +150 +150 +22 +150 +30 +100 +58 +150 +146 +150 +146 +150 +150 +150 +146 +143 +150 +115 +150 +46 +150 +150 +25 +146 +146 +150 +143 +75 +50 +148 +142 +150 +146 +150 +142 +22 +21 +150 +143 +150 +150 +21 +50 +41 +47 +146 +146 +150 +146 +142 +45 +146 +146 +150 +146 +142 +150 +21 +146 +150 +148 +22 +35 +150 +77 +73 +146 +146 +150 +21 +146 +146 +59 +40 +142 +150 +29 +150 +146 +146 +24 +24 +23 +146 +26 +146 +29 +27 +146 +150 +146 +68 +150 +150 +28 +150 +148 +150 +28 +150 +146 +134 +146 +102 +112 +108 +44 +43 +31 +34 +31 +22 +150 +146 +88 +123 +142 +43 +34 +150 +81 +38 +142 +143 +146 +146 +142 +72 +146 +35 +150 +146 +142 +150 +146 +22 +150 +150 +150 +84 +126 +96 +60 +58 +60 +54 +24 +33 +146 +89 +122 +54 +57 +102 +111 +55 +33 +150 +150 +32 +150 +150 +146 +145 +56 +21 +150 +146 +146 +150 +150 +150 +39 +149 +148 +146 +150 +142 +150 +150 +64 +150 +150 +150 +142 +149 +59 +150 +142 +150 +150 +101 +150 +150 +150 +139 +21 +46 +41 +56 +63 +69 +150 +56 +146 +146 +24 +59 +49 +22 +22 +22 +22 +69 +130 +83 +112 +98 +83 +82 +54 +58 +58 +58 +58 +66 +54 +58 +65 +61 +49 +57 +45 +56 +37 +59 +54 +63 +59 +55 +47 +32 +78 +55 +51 +33 +35 +54 +23 +86 +86 +138 +146 +23 +134 +99 +40 +67 +71 +71 +102 +74 +74 +64 +67 +64 +52 +52 +76 +53 +42 +50 +45 +68 +59 +65 +53 +49 +63 +62 +62 +62 +79 +61 +56 +59 +49 +68 +70 +43 +60 +23 +59 +150 +150 +150 +146 +147 +39 +145 +86 +35 +150 +27 +76 +150 +150 +150 +142 +37 +150 +87 +125 +148 +142 +106 +40 +27 +150 +84 +26 +142 +144 +72 +150 +150 +146 +146 +143 +29 +150 +143 +26 +28 +146 +146 +146 +150 +134 +150 +146 +150 +23 +146 +146 +150 +150 +149 +146 +148 +76 +150 +52 +150 +146 +146 +146 +142 +147 +144 +150 +150 +87 +146 +142 +150 +150 +21 +116 +107 +76 +150 +28 +150 +47 +41 +33 +150 +21 +146 +146 +150 +150 +93 +82 +149 +146 +146 +146 +150 +77 +118 +95 +145 +150 +150 +146 +149 +90 +65 +66 +107 +66 +146 +134 +106 +110 +105 +130 +91 +91 +91 +108 +75 +72 +63 +62 +72 +66 +70 +53 +55 +51 +57 +42 +28 +24 +146 +133 +125 +91 +126 +34 +114 +45 +44 +40 +40 +89 +25 +29 +21 +34 +38 +52 +28 +33 +45 +44 +43 +55 +96 +80 +78 +100 +78 +86 +61 +75 +57 +150 +150 +146 +146 +92 +93 +96 +146 +142 +137 +30 +146 +146 +146 +146 +23 +146 +150 +150 +146 +142 +51 +70 +150 +150 +146 +150 +150 +146 +150 +150 +150 +146 +150 +150 +150 +48 +31 +23 +150 +150 +29 +146 +73 +36 +146 +146 +150 +146 +25 +150 +128 +87 +50 +55 +24 +31 +96 +80 +58 +94 +136 +100 +91 +74 +55 +46 +32 +25 +150 +146 +146 +39 +150 +100 +73 +97 +122 +94 +78 +74 +68 +27 +46 +39 +41 +59 +27 +42 +34 +35 +43 +150 +71 +146 +73 +146 +142 +32 +150 +146 +150 +142 +71 +150 +58 +30 +34 +108 +26 +31 +26 +38 +149 +70 +142 +140 +24 +146 +87 +150 +146 +114 +146 +146 +142 +72 +59 +85 +150 +150 +146 +146 +49 +68 +150 +29 +94 +150 +142 +142 +138 +146 +48 +59 +149 +59 +92 +47 +27 +131 +37 +112 +87 +150 +150 +142 +148 +146 +146 +150 +142 +70 +142 +142 +22 +146 +150 +146 +146 +146 +150 +146 +146 +142 +146 +79 +63 +81 +150 +150 +150 +150 +150 +150 +150 +21 +146 +150 +98 +53 +146 +38 +146 +63 +95 +150 +76 +86 +94 +98 +119 +23 +146 +150 +146 +150 +146 +146 +150 +146 +150 +29 +146 +150 +148 +115 +63 +43 +142 +33 +150 +146 +146 +142 +148 +150 +150 +80 +54 +34 +82 +95 +45 +62 +100 +75 +52 +128 +98 +67 +58 +97 +72 +62 +146 +71 +57 +146 +79 +148 +146 +31 +146 +150 +146 +25 +150 +150 +146 +146 +127 +150 +146 +142 +86 +150 +84 +146 +150 +150 +150 +62 +150 +148 +100 +114 +103 +150 +146 +144 +51 +150 +150 +146 +146 +150 +142 +34 +150 +41 +148 +150 +149 +150 +150 +146 +32 +150 +150 +146 +150 +25 +46 +23 +24 +41 +48 +45 +23 +28 +150 +150 +146 +21 +62 +150 +27 +40 +61 +63 +144 +21 +150 +142 +146 +95 +69 +35 +37 +150 +86 +146 +150 +24 +150 +146 +144 +150 +83 +62 +31 +148 +75 +150 +76 +146 +150 +148 +150 +150 +38 +142 +50 +37 +148 +50 +142 +146 +37 +150 +146 +150 +150 +146 +138 +147 +49 +42 +44 +146 +35 +30 +80 +37 +150 +146 +150 +150 +29 +56 +87 +150 +44 +150 +150 +150 +150 +150 +150 +146 +146 +44 +43 +86 +40 +86 +83 +138 +38 +36 +55 +146 +100 +150 +21 +150 +150 +102 +150 +60 +139 +86 +31 +55 +38 +129 +44 +51 +139 +146 +32 +146 +150 +150 +39 +30 +26 +150 +150 +25 +26 +28 +22 +29 +28 +28 +27 +28 +28 +28 +24 +24 +24 +26 +74 +150 +150 +22 +150 +150 +150 +31 +150 +146 +150 +142 +146 +21 +150 +142 +150 +146 +150 +122 +86 +138 +150 +23 +150 +150 +146 +150 +88 +129 +42 +67 +142 +60 +68 +134 +150 +150 +150 +144 +146 +147 +150 +95 +150 +146 +47 +150 +150 +146 +142 +150 +150 +27 +142 +142 +146 +144 +101 +73 +148 +147 +63 +98 +100 +30 +146 +29 +145 +89 +66 +150 +111 +150 +100 +22 +104 +98 +89 +87 +87 +80 +44 +146 +126 +114 +71 +112 +93 +116 +48 +21 +51 +64 +44 +42 +25 +67 +42 +55 +45 +44 +43 +33 +47 +28 +40 +40 +44 +34 +38 +25 +29 +21 +45 +56 +146 +49 +84 +120 +146 +150 +73 +71 +53 +37 +25 +146 +150 +146 +142 +146 +146 +150 +146 +72 +146 +42 +150 +146 +150 +150 +150 +142 +52 +146 +69 +150 +51 +40 +134 +150 +150 +150 +23 +146 +142 +23 +24 +24 +23 +111 +111 +150 +150 +130 +22 +22 +22 +62 +97 +42 +150 +33 +146 +58 +38 +56 +53 +64 +150 +150 +76 +62 +142 +146 +150 +65 +146 +146 +146 +150 +150 +146 +126 +71 +123 +117 +48 +39 +68 +101 +78 +50 +54 +71 +65 +93 +72 +39 +72 +43 +70 +62 +28 +37 +39 +39 +74 +81 +72 +75 +28 +51 +62 +26 +37 +54 +64 +33 +150 +90 +89 +38 +41 +86 +51 +51 +43 +35 +36 +35 +51 +56 +35 +43 +48 +56 +47 +48 +26 +45 +56 +51 +51 +54 +48 +43 +55 +32 +43 +34 +35 +94 +34 +53 +42 +87 +75 +58 +146 +150 +59 +31 +57 +73 +48 +146 +150 +113 +39 +39 +43 +142 +150 +80 +67 +68 +59 +24 +23 +22 +21 +21 +21 +21 +21 +21 +36 +142 +49 +24 +62 +91 +150 +34 +39 +58 +146 +150 +70 +47 +64 +35 +150 +146 +150 +146 +138 +148 +150 +52 +56 +32 +148 +98 +81 +98 +72 +45 +26 +23 +46 +53 +27 +47 +29 +25 +23 +29 +25 +57 +150 +110 +105 +38 +144 +36 +100 +84 +146 +146 +142 +150 +150 +150 +69 +65 +82 +146 +57 +61 +53 +21 +25 +22 +22 +146 +142 +150 +150 +148 +150 +29 +150 +33 +146 +150 +134 +128 +79 +89 +80 +22 +150 +150 +146 +146 +146 +87 +150 +146 +146 +142 +142 +146 +150 +41 +33 +21 +35 +146 +146 +139 +150 +39 +96 +150 +51 +48 +133 +29 +87 +102 +89 +146 +91 +88 +47 +150 +26 +150 +142 +21 +150 +142 +150 +85 +150 +150 +144 +64 +142 +146 +150 +150 +150 +150 +146 +22 +55 +150 +146 +150 +150 +150 +142 +94 +147 +63 +150 +150 +53 +25 +33 +150 +93 +60 +146 +93 +148 +45 +88 +66 +146 +150 +150 +148 +126 +148 +150 +21 +22 +62 +150 +148 +150 +150 +140 +117 +45 +31 +111 +33 +29 +29 +88 +86 +146 +99 +93 +125 +113 +71 +65 +55 +51 +53 +146 +81 +131 +130 +130 +80 +91 +74 +86 +146 +146 +150 +21 +146 +150 +150 +146 +150 +66 +146 +83 +150 +110 +150 +146 +150 +30 +150 +83 +92 +50 +24 +150 +44 +94 +138 +150 +59 +55 +148 +48 +142 +146 +146 +37 +146 +150 +150 +58 +150 +150 +150 +73 +142 +150 +146 +90 +31 +31 +142 +138 +81 +134 +52 +52 +101 +60 +27 +138 +122 +76 +76 +75 +146 +49 +26 +150 +150 +66 +38 +142 +54 +58 +83 +68 +147 +150 +144 +146 +150 +150 +150 +150 +146 +57 +23 +150 +146 +61 +138 +150 +150 +26 +37 +21 +28 +146 +150 +26 +148 +49 +58 +150 +146 +146 +146 +46 +43 +150 +41 +150 +147 +50 +50 +118 +82 +61 +72 +146 +30 +51 +33 +103 +42 +65 +150 +147 +150 +146 +150 +149 +28 +146 +150 +31 +29 +48 +47 +47 +47 +47 +47 +47 +46 +150 +146 +47 +150 +85 +150 +146 +40 +75 +78 +42 +42 +146 +91 +99 +70 +146 +150 +43 +142 +146 +150 +27 +143 +70 +39 +150 +150 +150 +150 +150 +110 +21 +150 +79 +24 +119 +150 +55 +150 +130 +55 +30 +41 +41 +24 +142 +139 +118 +77 +70 +69 +25 +40 +135 +47 +150 +103 +147 +146 +119 +150 +150 +142 +150 +35 +150 +150 +150 +147 +146 +150 +142 +146 +150 +146 +84 +142 +86 +30 +87 +86 +85 +54 +150 +150 +150 +150 +21 +21 +21 +21 +21 +150 +150 +150 +150 +25 +99 +78 +111 +78 +81 +33 +105 +22 +98 +98 +98 +85 +85 +87 +85 +86 +86 +84 +82 +81 +104 +78 +58 +59 +126 +95 +40 +54 +57 +29 +29 +37 +84 +57 +115 +150 +150 +121 +29 +146 +39 +150 +150 +39 +68 +110 +116 +87 +150 +37 +40 +38 +56 +47 +35 +142 +124 +75 +61 +56 +83 +24 +63 +41 +52 +148 +147 +21 +21 +150 +132 +77 +148 +142 +83 +146 +22 +150 +42 +146 +96 +114 +135 +97 +86 +91 +88 +85 +83 +94 +78 +88 +28 +97 +150 +122 +126 +55 +50 +86 +111 +83 +64 +69 +67 +50 +150 +28 +92 +41 +23 +93 +72 +150 +150 +150 +150 +28 +150 +26 +150 +150 +150 +78 +142 +146 +150 +150 +146 +142 +146 +150 +146 +21 +21 +150 +146 +26 +150 +150 +150 +148 +150 +146 +146 +146 +150 +150 +49 +150 +150 +48 +150 +150 +146 +146 +147 +150 +142 +146 +57 +63 +97 +150 +143 +150 +138 +150 +70 +150 +150 +146 +150 +146 +142 +38 +41 +40 +32 +42 +31 +34 +36 +30 +33 +30 +32 +34 +43 +31 +93 +38 +40 +33 +32 +31 +31 +30 +31 +30 +128 +36 +32 +32 +32 +33 +32 +32 +150 +25 +80 +150 +150 +146 +150 +150 +146 +39 +146 +150 +150 +150 +146 +26 +146 +146 +28 +150 +150 +142 +86 +130 +150 +146 +148 +74 +96 +150 +150 +146 +146 +150 +150 +62 +46 +150 +142 +146 +144 +148 +148 +150 +146 +150 +150 +40 +49 +150 +37 +32 +41 +45 +110 +150 +148 +150 +148 +146 +150 +150 +24 +148 +150 +150 +35 +101 +97 +138 +150 +28 +28 +60 +60 +134 +82 +77 +110 +131 +144 +122 +77 +76 +61 +60 +43 +107 +66 +142 +147 +135 +87 +87 +87 +87 +87 +87 +87 +87 +95 +76 +70 +84 +62 +59 +56 +75 +78 +79 +54 +65 +49 +150 +29 +143 +57 +21 +106 +29 +150 +114 +95 +150 +146 +150 +21 +150 +150 +44 +146 +146 +150 +65 +148 +150 +109 +128 +51 +37 +46 +48 +32 +69 +148 +142 +146 +134 +137 +150 +21 +146 +50 +46 +39 +87 +26 +36 +39 +37 +46 +64 +33 +36 +30 +31 +149 +40 +39 +101 +35 +68 +32 +39 +46 +33 +38 +50 +30 +32 +22 +26 +122 +150 +72 +27 +150 +56 +87 +146 +85 +50 +66 +100 +43 +43 +150 +65 +150 +150 +146 +150 +62 +146 +149 +42 +24 +142 +67 +67 +148 +146 +146 +150 +143 +148 +75 +146 +88 +150 +146 +150 +146 +150 +86 +150 +55 +48 +150 +146 +146 +41 +43 +150 +120 +108 +49 +146 +34 +68 +57 +143 +138 +143 +115 +21 +150 +113 +146 +146 +150 +150 +53 +50 +150 +137 +147 +150 +150 +149 +146 +150 +60 +150 +52 +150 +25 +150 +133 +150 +150 +51 +150 +150 +150 +146 +142 +146 +150 +150 +150 +150 +48 +149 +146 +148 +68 +146 +43 +150 +33 +150 +150 +142 +150 +150 +146 +146 +146 +146 +48 +135 +103 +68 +76 +63 +73 +76 +107 +76 +71 +78 +85 +91 +98 +92 +91 +89 +116 +99 +96 +112 +87 +91 +82 +40 +91 +32 +119 +93 +107 +146 +90 +134 +112 +75 +48 +56 +44 +43 +146 +150 +39 +150 +68 +146 +146 +148 +146 +146 +94 +138 +150 +142 +62 +146 +142 +148 +45 +35 +55 +146 +150 +150 +150 +150 +54 +40 +150 +150 +73 +96 +59 +52 +146 +144 +150 +142 +150 +150 +119 +142 +52 +146 +146 +150 +150 +40 +42 +150 +30 +150 +150 +23 +150 +39 +150 +142 +150 +150 +147 +150 +29 +72 +34 +142 +150 +142 +41 +64 +64 +146 +150 +43 +45 +142 +67 +71 +38 +21 +34 +37 +34 +150 +120 +76 +54 +27 +24 +38 +146 +146 +142 +150 +146 +23 +146 +146 +150 +142 +142 +138 +131 +146 +150 +146 +150 +150 +150 +150 +146 +150 +146 +150 +150 +150 +24 +150 +144 +146 +150 +27 +50 +150 +43 +43 +146 +108 +122 +80 +94 +81 +54 +68 +146 +150 +141 +97 +92 +90 +82 +75 +65 +60 +57 +50 +48 +44 +37 +33 +149 +97 +93 +80 +54 +52 +48 +45 +37 +34 +26 +23 +150 +23 +29 +150 +24 +30 +87 +150 +21 +150 +146 +22 +150 +150 +146 +66 +146 +68 +150 +150 +138 +146 +150 +146 +138 +146 +84 +138 +146 +100 +146 +150 +142 +150 +150 +150 +146 +146 +150 +35 +134 +41 +132 +126 +108 +78 +115 +81 +97 +44 +150 +97 +113 +92 +150 +21 +150 +146 +150 +146 +146 +148 +51 +150 +142 +150 +142 +45 +52 +52 +40 +146 +66 +92 +34 +34 +46 +138 +42 +59 +150 +30 +150 +150 +56 +142 +150 +90 +90 +150 +100 +89 +150 +150 +142 +142 +108 +150 +77 +89 +85 +67 +38 +38 +93 +36 +34 +40 +79 +27 +32 +40 +150 +138 +150 +39 +78 +142 +59 +30 +149 +99 +55 +62 +86 +84 +63 +83 +90 +101 +54 +79 +67 +67 +28 +146 +150 +150 +146 +150 +23 +23 +67 +63 +29 +142 +49 +34 +146 +46 +40 +150 +146 +146 +150 +96 +146 +150 +150 +150 +31 +146 +146 +146 +150 +150 +146 +146 +142 +150 +142 +146 +148 +145 +21 +114 +150 +150 +138 +150 +150 +146 +142 +150 +142 +150 +86 +150 +122 +148 +126 +68 +146 +68 +150 +42 +150 +104 +38 +150 +36 +110 +150 +150 +143 +138 +142 +150 +146 +150 +22 +150 +150 +146 +85 +142 +95 +81 +150 +120 +93 +89 +78 +76 +36 +33 +28 +150 +50 +47 +31 +49 +61 +148 +23 +66 +22 +150 +40 +142 +150 +48 +146 +142 +146 +150 +150 +148 +22 +22 +75 +29 +21 +148 +146 +150 +36 +33 +57 +52 +150 +30 +60 +22 +146 +146 +150 +150 +150 +150 +146 +150 +150 +42 +144 +150 +142 +138 +48 +145 +116 +114 +53 +123 +81 +71 +150 +23 +150 +143 +150 +146 +33 +150 +146 +150 +124 +119 +150 +37 +26 +146 +63 +71 +78 +58 +24 +22 +22 +22 +22 +150 +58 +113 +126 +150 +146 +150 +39 +68 +89 +95 +150 +21 +21 +21 +21 +21 +22 +23 +21 +21 +23 +23 +23 +26 +21 +148 +148 +29 +142 +49 +131 +150 +124 +145 +146 +142 +29 +60 +146 +110 +100 +146 +97 +142 +132 +87 +146 +150 +21 +21 +25 +109 +23 +24 +21 +24 +119 +88 +146 +76 +146 +64 +72 +76 +146 +150 +146 +146 +146 +150 +146 +142 +150 +69 +146 +95 +148 +148 +78 +54 +150 +150 +46 +89 +68 +56 +26 +97 +146 +139 +41 +87 +83 +48 +143 +23 +142 +146 +150 +146 +25 +150 +30 +81 +150 +143 +30 +142 +150 +150 +102 +84 +55 +21 +74 +150 +150 +150 +150 +122 +116 +40 +89 +73 +146 +150 +146 +21 +146 +146 +146 +146 +146 +64 +46 +146 +104 +61 +150 +150 +150 +142 +45 +53 +34 +34 +146 +150 +146 +150 +150 +150 +27 +150 +74 +115 +118 +110 +82 +82 +50 +81 +134 +135 +150 +146 +150 +146 +142 +146 +146 +150 +35 +150 +49 +150 +146 +146 +42 +39 +150 +150 +91 +85 +150 +23 +24 +86 +76 +25 +150 +146 +150 +146 +150 +149 +150 +43 +94 +150 +86 +96 +72 +21 +144 +150 +148 +150 +150 +98 +70 +150 +146 +150 +147 +150 +148 +68 +71 +150 +29 +138 +21 +35 +116 +30 +150 +148 +97 +46 +33 +144 +142 +150 +84 +21 +148 +63 +150 +29 +66 +150 +150 +21 +96 +129 +50 +46 +61 +146 +31 +65 +51 +73 +29 +102 +150 +126 +134 +117 +94 +42 +146 +60 +29 +53 +150 +150 +21 +21 +40 +114 +45 +141 +150 +146 +146 +146 +150 +150 +21 +147 +35 +150 +47 +30 +150 +25 +24 +150 +150 +146 +51 +42 +48 +39 +32 +59 +53 +37 +35 +142 +142 +48 +139 +34 +146 +146 +142 +106 +49 +27 +33 +34 +150 +122 +110 +55 +55 +76 +142 +28 +49 +60 +28 +139 +131 +83 +55 +53 +54 +59 +61 +64 +150 +76 +57 +57 +61 +148 +146 +138 +150 +150 +150 +31 +35 +27 +146 +150 +150 +146 +146 +150 +144 +150 +59 +146 +41 +150 +150 +147 +147 +142 +142 +150 +149 +33 +150 +33 +36 +146 +150 +74 +132 +64 +150 +87 +34 +133 +134 +146 +87 +146 +40 +150 +97 +124 +62 +142 +130 +106 +83 +83 +90 +52 +41 +150 +127 +67 +130 +130 +46 +56 +29 +43 +47 +57 +72 +50 +40 +40 +45 +45 +67 +91 +103 +45 +43 +39 +36 +33 +47 +40 +41 +52 +41 +35 +52 +48 +49 +49 +49 +49 +96 +62 +71 +37 +150 +150 +150 +150 +150 +31 +150 +150 +150 +26 +26 +26 +146 +150 +146 +146 +150 +150 +146 +86 +97 +116 +86 +77 +92 +150 +29 +44 +44 +128 +66 +141 +66 +146 +143 +63 +42 +146 +22 +138 +146 +22 +146 +150 +106 +132 +63 +67 +97 +36 +139 +56 +146 +95 +23 +25 +25 +26 +38 +22 +41 +32 +38 +27 +38 +38 +38 +23 +24 +24 +27 +135 +115 +112 +146 +57 +66 +150 +36 +146 +48 +150 +52 +73 +67 +147 +150 +146 +67 +148 +23 +150 +24 +24 +74 +150 +150 +146 +150 +21 +65 +60 +47 +142 +142 +150 +146 +150 +37 +150 +146 +146 +150 +104 +118 +24 +150 +28 +83 +21 +21 +38 +95 +150 +148 +150 +142 +25 +139 +126 +150 +97 +88 +85 +68 +65 +61 +36 +41 +142 +104 +63 +146 +150 +142 +150 +150 +146 +150 +34 +100 +42 +27 +31 +150 +150 +135 +74 +146 +146 +143 +27 +31 +33 +37 +33 +37 +30 +146 +146 +64 +146 +147 +150 +146 +150 +146 +146 +100 +96 +148 +37 +38 +147 +143 +148 +80 +52 +44 +41 +24 +24 +24 +25 +22 +22 +22 +45 +22 +22 +138 +30 +22 +30 +32 +146 +112 +146 +87 +150 +34 +144 +150 +150 +77 +66 +90 +145 +146 +146 +146 +150 +150 +92 +150 +150 +35 +35 +150 +150 +146 +138 +114 +73 +84 +94 +66 +66 +40 +150 +127 +119 +104 +66 +46 +87 +148 +140 +25 +150 +147 +150 +150 +146 +146 +150 +150 +39 +36 +22 +22 +28 +146 +150 +146 +27 +138 +138 +146 +150 +150 +150 +41 +147 +56 +103 +105 +150 +118 +146 +146 +150 +48 +36 +150 +34 +88 +138 +39 +146 +149 +95 +72 +97 +93 +87 +73 +72 +150 +137 +129 +69 +76 +150 +23 +148 +150 +150 +146 +150 +146 +146 +134 +148 +29 +38 +150 +28 +21 +28 +142 +150 +96 +127 +51 +53 +41 +104 +124 +42 +39 +46 +111 +101 +109 +90 +85 +40 +43 +150 +47 +46 +41 +54 +126 +53 +59 +46 +29 +47 +42 +42 +43 +54 +48 +60 +71 +70 +121 +55 +49 +114 +55 +129 +119 +62 +51 +63 +71 +34 +69 +71 +81 +29 +58 +28 +25 +29 +29 +54 +54 +45 +39 +146 +142 +150 +28 +61 +85 +150 +146 +150 +95 +54 +148 +146 +21 +142 +70 +92 +148 +86 +150 +146 +150 +150 +146 +150 +70 +136 +148 +36 +120 +146 +150 +150 +150 +142 +150 +146 +119 +23 +24 +24 +24 +23 +23 +23 +23 +23 +23 +23 +23 +23 +24 +29 +29 +146 +36 +108 +83 +38 +23 +23 +24 +23 +23 +23 +23 +23 +23 +23 +23 +24 +24 +24 +142 +146 +138 +142 +142 +142 +146 +150 +146 +150 +144 +33 +146 +150 +23 +150 +23 +22 +96 +21 +107 +146 +49 +44 +118 +44 +48 +65 +68 +145 +119 +51 +31 +146 +146 +77 +146 +30 +109 +57 +146 +39 +146 +150 +150 +142 +142 +150 +148 +145 +48 +109 +110 +92 +150 +80 +146 +114 +119 +150 +48 +150 +112 +150 +130 +150 +30 +146 +150 +56 +111 +63 +94 +150 +145 +150 +142 +150 +146 +146 +143 +150 +110 +25 +22 +150 +43 +39 +27 +39 +23 +40 +46 +40 +150 +39 +46 +43 +103 +146 +146 +150 +46 +86 +150 +146 +146 +150 +150 +24 +21 +143 +150 +146 +146 +146 +150 +146 +150 +28 +21 +150 +150 +146 +147 +150 +142 +146 +150 +146 +146 +72 +146 +150 +149 +150 +150 +37 +51 +32 +42 +45 +84 +85 +82 +47 +40 +92 +91 +91 +89 +68 +95 +89 +89 +150 +94 +89 +53 +91 +72 +86 +86 +74 +60 +44 +44 +35 +117 +105 +142 +97 +90 +139 +104 +65 +48 +39 +38 +150 +146 +150 +146 +52 +150 +150 +146 +146 +21 +146 +150 +142 +148 +150 +39 +143 +96 +141 +35 +150 +142 +150 +150 +42 +150 +150 +146 +30 +52 +99 +144 +50 +146 +150 +150 +150 +150 +144 +150 +150 +150 +146 +149 +101 +146 +146 +39 +96 +70 +94 +23 +21 +23 +22 +26 +21 +21 +21 +23 +21 +21 +23 +21 +21 +41 +146 +33 +33 +150 +24 +146 +86 +51 +150 +150 +144 +150 +56 +37 +35 +146 +146 +146 +142 +146 +31 +148 +39 +105 +52 +144 +150 +150 +146 +38 +30 +150 +123 +150 +114 +150 +150 +146 +150 +150 +26 +142 +83 +142 +27 +146 +150 +146 +150 +146 +150 +150 +150 +150 +42 +54 +150 +21 +146 +131 +80 +150 +150 +139 +150 +146 +150 +150 +126 +148 +27 +23 +33 +75 +150 +146 +150 +150 +34 +138 +73 +34 +87 +48 +146 +22 +73 +39 +63 +142 +40 +93 +150 +23 +42 +150 +62 +150 +131 +86 +150 +36 +146 +150 +150 +146 +150 +150 +150 +58 +146 +79 +86 +82 +146 +150 +150 +144 +49 +31 +150 +146 +76 +106 +144 +146 +148 +150 +146 +39 +146 +146 +94 +150 +78 +146 +130 +150 +97 +142 +44 +114 +146 +36 +150 +148 +65 +146 +150 +134 +97 +142 +150 +150 +62 +150 +99 +104 +99 +44 +49 +29 +84 +56 +150 +146 +142 +146 +150 +150 +117 +58 +58 +108 +118 +122 +107 +27 +27 +104 +68 +143 +139 +97 +46 +46 +43 +150 +150 +150 +72 +63 +47 +150 +86 +21 +138 +150 +146 +146 +56 +142 +146 +146 +113 +112 +146 +93 +91 +91 +85 +92 +72 +68 +66 +62 +60 +21 +21 +57 +55 +49 +45 +150 +150 +136 +36 +61 +39 +106 +48 +62 +45 +150 +75 +56 +138 +44 +22 +38 +46 +66 +150 +85 +27 +52 +103 +150 +96 +99 +150 +142 +142 +150 +146 +150 +150 +150 +150 +92 +45 +101 +70 +83 +73 +62 +83 +149 +28 +81 +92 +74 +58 +147 +150 +108 +22 +115 +34 +91 +28 +75 +39 +97 +37 +146 +68 +84 +86 +93 +56 +80 +64 +66 +150 +146 +80 +81 +94 +41 +146 +24 +120 +77 +82 +107 +36 +104 +36 +43 +73 +75 +60 +47 +44 +25 +146 +142 +146 +140 +150 +150 +150 +150 +145 +107 +25 +142 +148 +147 +146 +150 +26 +31 +148 +150 +47 +31 +67 +150 +73 +150 +36 +146 +39 +36 +150 +150 +146 +88 +90 +150 +110 +145 +32 +150 +45 +150 +28 +44 +144 +142 +56 +127 +21 +48 +146 +134 +86 +150 +150 +146 +28 +56 +52 +53 +26 +26 +26 +39 +23 +27 +21 +150 +26 +26 +26 +28 +23 +24 +21 +150 +142 +150 +73 +146 +123 +150 +47 +146 +63 +150 +150 +146 +121 +112 +104 +116 +69 +117 +65 +149 +68 +142 +150 +150 +150 +146 +22 +142 +150 +24 +149 +142 +72 +150 +69 +62 +55 +53 +39 +35 +38 +33 +24 +43 +22 +29 +45 +21 +27 +102 +26 +124 +119 +98 +128 +97 +85 +77 +103 +71 +68 +21 +21 +150 +29 +150 +144 +112 +28 +150 +43 +25 +150 +150 +95 +77 +51 +34 +146 +26 +150 +150 +150 +150 +146 +150 +148 +150 +44 +44 +96 +107 +133 +42 +40 +133 +148 +146 +36 +150 +142 +150 +150 +150 +150 +150 +150 +62 +62 +70 +57 +150 +114 +150 +148 +150 +67 +74 +58 +58 +40 +85 +146 +54 +53 +23 +69 +75 +146 +146 +146 +82 +146 +26 +34 +34 +132 +134 +60 +146 +87 +100 +75 +75 +47 +47 +46 +46 +45 +45 +23 +150 +29 +29 +36 +36 +35 +32 +34 +27 +34 +26 +34 +146 +150 +146 +21 +22 +146 +150 +150 +86 +123 +76 +149 +150 +132 +150 +150 +150 +29 +59 +22 +146 +36 +35 +54 +53 +21 +150 +148 +150 +146 +146 +146 +142 +150 +150 +150 +150 +25 +92 +81 +66 +146 +146 +150 +146 +51 +150 +148 +146 +21 +43 +144 +142 +21 +146 +150 +107 +146 +79 +146 +82 +150 +111 +148 +148 +150 +59 +150 +150 +62 +23 +34 +146 +150 +150 +148 +150 +22 +150 +150 +150 +146 +23 +142 +33 +31 +146 +146 +29 +150 +48 +67 +54 +65 +81 +27 +30 +27 +22 +30 +35 +31 +21 +21 +21 +23 +23 +45 +146 +142 +52 +150 +23 +64 +38 +52 +35 +27 +25 +23 +146 +75 +150 +70 +21 +146 +146 +25 +150 +150 +146 +142 +150 +150 +138 +150 +150 +150 +150 +150 +72 +150 +67 +104 +21 +134 +44 +38 +54 +150 +146 +30 +150 +35 +39 +30 +30 +150 +146 +21 +146 +150 +26 +142 +150 +146 +150 +142 +150 +150 +150 +150 +26 +102 +61 +27 +146 +80 +68 +150 +29 +23 +34 +150 +23 +21 +150 +107 +98 +146 +46 +142 +25 +150 +150 +146 +24 +23 +29 +24 +32 +148 +91 +142 +150 +150 +146 +146 +146 +24 +24 +24 +150 +150 +142 +141 +150 +138 +50 +22 +150 +23 +65 +150 +150 +148 +59 +150 +146 +42 +146 +96 +150 +22 +150 +146 +150 +146 +72 +150 +28 +82 +150 +50 +150 +150 +142 +94 +150 +82 +150 +150 +150 +127 +74 +65 +62 +45 +42 +38 +150 +107 +69 +75 +51 +47 +43 +33 +24 +21 +150 +145 +21 +146 +68 +74 +146 +78 +101 +146 +45 +146 +70 +147 +113 +39 +21 +146 +142 +148 +30 +146 +146 +33 +32 +150 +150 +58 +148 +146 +141 +150 +31 +23 +147 +148 +48 +144 +150 +142 +150 +146 +146 +146 +150 +146 +25 +24 +66 +146 +150 +150 +150 +146 +39 +146 +146 +150 +146 +150 +146 +47 +150 +150 +146 +82 +150 +150 +74 +21 +147 +56 +148 +140 +142 +150 +146 +150 +146 +51 +138 +58 +146 +42 +150 +49 +150 +150 +38 +142 +38 +150 +150 +150 +147 +146 +22 +150 +146 +32 +134 +32 +126 +130 +41 +126 +75 +81 +21 +28 +27 +72 +138 +24 +33 +74 +26 +142 +22 +77 +78 +28 +33 +142 +82 +71 +68 +41 +63 +34 +44 +78 +130 +73 +44 +121 +84 +89 +57 +97 +70 +70 +65 +62 +70 +76 +43 +68 +65 +62 +47 +43 +51 +86 +58 +48 +26 +76 +41 +34 +150 +150 +146 +94 +94 +90 +73 +60 +150 +46 +43 +37 +150 +146 +35 +150 +142 +150 +46 +138 +150 +86 +93 +44 +45 +69 +65 +57 +39 +33 +93 +111 +92 +24 +70 +24 +32 +54 +76 +79 +122 +49 +51 +123 +93 +35 +91 +90 +134 +60 +80 +77 +80 +80 +80 +80 +80 +124 +31 +76 +120 +92 +63 +63 +39 +34 +34 +25 +74 +148 +142 +91 +97 +22 +146 +148 +150 +146 +77 +70 +93 +34 +150 +142 +146 +146 +59 +81 +150 +41 +100 +150 +53 +23 +23 +23 +150 +150 +142 +150 +150 +150 +37 +33 +31 +34 +31 +31 +34 +33 +30 +30 +30 +34 +36 +36 +30 +31 +30 +150 +37 +34 +38 +33 +30 +37 +35 +31 +33 +35 +30 +33 +32 +33 +31 +31 +33 +147 +25 +28 +150 +146 +94 +150 +146 +146 +21 +146 +95 +95 +93 +90 +80 +76 +150 +150 +148 +146 +146 +150 +29 +23 +23 +22 +22 +22 +148 +148 +150 +150 +140 +103 +52 +48 +146 +42 +149 +79 +86 +86 +108 +98 +98 +145 +55 +102 +98 +96 +76 +147 +104 +150 +146 +146 +150 +146 +137 +144 +21 +49 +21 +62 +146 +146 +146 +150 +150 +146 +64 +148 +150 +146 +150 +146 +59 +149 +150 +146 +150 +146 +150 +150 +25 +150 +44 +146 +64 +150 +146 +25 +97 +102 +32 +33 +23 +150 +57 +28 +150 +52 +38 +146 +146 +150 +150 +60 +24 +142 +146 +22 +146 +32 +146 +23 +146 +57 +150 +25 +146 +142 +150 +21 +92 +146 +21 +56 +150 +150 +57 +150 +150 +44 +116 +34 +51 +148 +64 +150 +74 +150 +50 +45 +25 +43 +48 +146 +43 +33 +150 +49 +47 +36 +150 +70 +146 +150 +144 +22 +22 +142 +150 +142 +40 +121 +150 +150 +142 +25 +47 +103 +146 +22 +150 +148 +142 +101 +142 +150 +146 +150 +35 +32 +38 +40 +42 +33 +38 +45 +42 +37 +25 +41 +37 +45 +35 +30 +30 +30 +21 +29 +29 +29 +29 +142 +133 +150 +150 +57 +150 +21 +142 +138 +146 +21 +21 +146 +22 +22 +146 +21 +150 +150 +22 +150 +146 +150 +21 +146 +21 +21 +41 +150 +150 +150 +146 +150 +150 +146 +56 +132 +150 +146 +146 +150 +146 +21 +146 +150 +148 +150 +146 +150 +146 +150 +150 +150 +150 +146 +45 +88 +150 +146 +146 +150 +150 +146 +146 +142 +21 +146 +142 +142 +150 +21 +34 +140 +150 +146 +150 +142 +150 +147 +150 +92 +24 +103 +91 +89 +87 +83 +50 +146 +98 +35 +150 +142 +150 +148 +150 +150 +146 +36 +116 +150 +21 +146 +23 +150 +149 +150 +150 +100 +99 +77 +66 +130 +24 +146 +21 +146 +150 +28 +50 +30 +150 +146 +150 +22 +142 +41 +75 +73 +73 +146 +150 +150 +146 +150 +150 +150 +21 +21 +146 +146 +59 +135 +146 +150 +24 +24 +146 +23 +150 +27 +150 +33 +34 +82 +143 +146 +21 +150 +150 +150 +150 +21 +146 +146 +146 +146 +96 +21 +150 +142 +147 +146 +150 +150 +150 +21 +21 +21 +150 +150 +150 +150 +150 +150 +142 +22 +142 +146 +148 +148 +21 +138 +40 +146 +29 +23 +21 +24 +24 +33 +150 +150 +48 +146 +47 +21 +150 +150 +150 +150 +67 +54 +23 +146 +148 +139 +150 +22 +150 +146 +146 +38 +21 +145 +150 +150 +126 +143 +150 +150 +150 +150 +146 +142 +150 +27 +27 +62 +143 +150 +22 +150 +150 +150 +146 +146 +142 +142 +21 +146 +23 +146 +22 +146 +150 +31 +45 +150 +52 +43 +150 +146 +142 +150 +144 +146 +150 +146 +25 +21 +93 +150 +150 +51 +148 +146 +22 +149 +146 +150 +146 +150 +150 +143 +150 +97 +150 +150 +150 +43 +150 +31 +26 +67 +87 +141 +25 +23 +80 +139 +150 +142 +69 +40 +94 +150 +52 +76 +150 +146 +30 +93 +150 +150 +21 +21 +23 +148 +150 +150 +150 +146 +22 +21 +146 +107 +150 +23 +150 +142 +148 +148 +23 +23 +109 +137 +32 +23 +142 +21 +150 +142 +21 +146 +146 +150 +142 +150 +146 +101 +146 +146 +144 +150 +150 +22 +22 +150 +142 +142 +150 +56 +146 +49 +39 +148 +22 +21 +150 +21 +21 +150 +146 +146 +146 +150 +25 +146 +21 +146 +147 +75 +150 +142 +138 +101 +150 +31 +150 +150 +150 +142 +150 +146 +150 +150 +150 +150 +21 +150 +150 +23 +148 +33 +150 +150 +142 +22 +148 +27 +96 +146 +150 +141 +150 +139 +34 +150 +150 +150 +101 +76 +61 +110 +150 +150 +35 +28 +32 +31 +27 +37 +32 +150 +28 +27 +26 +25 +26 +26 +21 +150 +23 +150 +148 +140 +63 +80 +85 +60 +21 +43 +68 +39 +50 +42 +63 +68 +45 +46 +41 +146 +150 +150 +146 +148 +150 +150 +146 +73 +25 +81 +40 +75 +69 +45 +87 +72 +70 +32 +142 +146 +150 +150 +150 +23 +30 +40 +40 +35 +146 +38 +35 +33 +33 +33 +33 +33 +33 +34 +31 +25 +28 +142 +146 +60 +142 +150 +146 +21 +140 +24 +21 +22 +22 +150 +76 +144 +148 +23 +24 +22 +25 +22 +21 +21 +28 +150 +146 +150 +150 +55 +24 +144 +24 +150 +23 +23 +21 +150 +150 +21 +146 +109 +89 +146 +146 +150 +146 +150 +21 +46 +142 +150 +136 +150 +28 +28 +27 +27 +27 +70 +143 +23 +150 +150 +150 +22 +146 +150 +21 +21 +150 +150 +150 +142 +146 +34 +148 +146 +142 +142 +146 +108 +38 +150 +146 +150 +150 +21 +150 +150 +146 +150 +150 +24 +142 +150 +148 +142 +142 +28 +146 +150 +146 +150 +43 +46 +21 +25 +142 +21 +150 +150 +148 +146 +148 +143 +150 +146 +150 +49 +140 +31 +150 +146 +150 +148 +21 +150 +146 +21 +22 +150 +116 +148 +150 +21 +150 +21 +146 +146 +150 +150 +126 +150 +22 +150 +150 +150 +134 +150 +146 +42 +32 +47 +21 +130 +55 +150 +22 +150 +31 +100 +142 +142 +146 +22 +128 +21 +148 +146 +31 +146 +92 +31 +144 +146 +31 +25 +31 +38 +23 +31 +32 +23 +31 +25 +150 +21 +24 +25 +22 +24 +23 +150 +150 +146 +54 +43 +49 +42 +50 +53 +46 +41 +39 +51 +43 +41 +39 +40 +54 +46 +47 +39 +42 +38 +51 +140 +21 +40 +34 +38 +21 +30 +38 +34 +33 +64 +93 +89 +102 +81 +71 +95 +21 +82 +99 +75 +68 +55 +95 +89 +38 +36 +24 +150 +150 +150 +142 +146 +150 +149 +148 +150 +150 +150 +35 +150 +150 +150 +150 +103 +135 +76 +61 +86 +82 +70 +38 +28 +142 +95 +71 +56 +40 +150 +21 +146 +150 +150 +150 +150 +146 +150 +146 +21 +146 +37 +146 +146 +150 +21 +146 +146 +150 +40 +29 +146 +52 +64 +150 +138 +146 +146 +146 +27 +150 +26 +148 +148 +146 +150 +22 +146 +148 +80 +41 +146 +36 +146 +146 +150 +48 +65 +61 +84 +114 +150 +110 +48 +61 +79 +146 +68 +65 +102 +142 +150 +22 +150 +23 +150 +21 +21 +21 +24 +23 +117 +90 +140 +150 +21 +142 +146 +21 +49 +146 +25 +32 +148 +48 +21 +47 +82 +21 +65 +150 +80 +43 +27 +29 +31 +43 +61 +42 +26 +80 +43 +105 +50 +47 +100 +64 +68 +49 +71 +78 +37 +70 +34 +83 +59 +66 +24 +58 +30 +34 +53 +27 +31 +150 +147 +144 +142 +146 +146 +150 +150 +148 +23 +43 +42 +52 +53 +54 +90 +148 +62 +90 +88 +59 +79 +66 +84 +46 +34 +83 +63 +35 +37 +65 +65 +63 +55 +109 +64 +23 +57 +65 +59 +57 +111 +86 +73 +44 +37 +35 +29 +48 +150 +23 +22 +150 +146 +146 +150 +22 +72 +21 +22 +115 +95 +38 +46 +142 +138 +21 +146 +150 +150 +144 +146 +31 +150 +146 +150 +25 +26 +33 +23 +23 +23 +25 +23 +23 +150 +150 +150 +150 +133 +146 +150 +150 +150 +46 +145 +150 +21 +142 +28 +25 +21 +23 +23 +21 +150 +90 +23 +22 +149 +150 +30 +150 +63 +149 +146 +46 +44 +97 +50 +50 +50 +41 +150 +38 +27 +27 +27 +146 +146 +146 +22 +42 +52 +36 +47 +150 +22 +21 +142 +29 +35 +38 +35 +31 +35 +22 +35 +35 +37 +36 +35 +146 +47 +53 +47 +26 +40 +30 +46 +42 +33 +54 +44 +37 +46 +150 +150 +146 +22 +149 +23 +150 +146 +146 +146 +150 +150 +146 +146 +150 +23 +21 +142 +21 +146 +150 +22 +140 +146 +115 +34 +150 +21 +150 +146 +143 +142 +150 +21 +97 +148 +21 +23 +146 +21 +150 +21 +146 +150 +21 +146 +33 +33 +33 +146 +27 +73 +146 +150 +146 +150 +131 +146 +146 +21 +142 +138 +76 +146 +64 +80 +146 +21 +150 +150 +142 +67 +80 +146 +150 +146 +150 +146 +150 +150 +146 +146 +21 +146 +150 +22 +22 +26 +23 +22 +25 +25 +22 +22 +22 +22 +146 +146 +86 +88 +23 +150 +150 +21 +21 +22 +23 +146 +150 +51 +146 +146 +150 +150 +150 +21 +150 +150 +24 +23 +21 +150 +146 +24 +146 +150 +146 +146 +72 +141 +150 +142 +142 +106 +150 +150 +21 +44 +44 +146 +146 +120 +106 +146 +70 +54 +30 +63 +61 +71 +74 +45 +67 +67 +63 +71 +50 +67 +47 +75 +84 +64 +80 +71 +84 +84 +62 +86 +84 +70 +74 +84 +75 +80 +34 +29 +86 +82 +150 +146 +47 +58 +46 +51 +64 +52 +49 +36 +51 +49 +51 +51 +49 +33 +52 +41 +34 +44 +38 +43 +38 +46 +50 +63 +36 +150 +150 +150 +23 +150 +28 +142 +150 +146 +142 +24 +146 +36 +150 +147 +122 +52 +146 +146 +150 +24 +142 +150 +150 +21 +150 +146 +150 +142 +150 +21 +22 +146 +148 +22 +150 +150 +83 +138 +146 +146 +146 +150 +21 +140 +23 +150 +146 +22 +146 +150 +146 +146 +21 +21 +138 +150 +21 +150 +142 +146 +85 +70 +146 +142 +28 +146 +45 +142 +23 +23 +21 +150 +26 +42 +31 +39 +22 +150 +150 +35 +146 +66 +121 +38 +55 +150 +146 +146 +149 +150 +146 +150 +150 +150 +146 +146 +21 +150 +146 +150 +81 +23 +142 +150 +150 +150 +33 +148 +30 +146 +149 +146 +23 +146 +150 +150 +21 +150 +146 +23 +142 +25 +146 +146 +24 +150 +23 +21 +150 +22 +26 +142 +68 +53 +64 +73 +72 +72 +57 +76 +71 +73 +42 +61 +69 +22 +54 +60 +21 +47 +59 +47 +50 +53 +55 +48 +146 +51 +37 +51 +36 +52 +39 +52 +58 +59 +150 +146 +150 +148 +150 +23 +150 +146 +21 +150 +146 +21 +142 +150 +150 +21 +146 +150 +150 +150 +146 +146 +150 +150 +150 +150 +150 +21 +21 +21 +21 +146 +21 +105 +72 +140 +146 +93 +150 +28 +28 +27 +27 +27 +150 +142 +67 +150 +150 +21 +21 +21 +24 +81 +150 +148 +142 +150 +143 +21 +147 +150 +74 +59 +63 +87 +60 +62 +55 +24 +93 +150 +55 +53 +53 +146 +144 +52 +150 +150 +146 +150 +24 +150 +142 +111 +59 +27 +150 +21 +21 +149 +41 +150 +146 +150 +148 +150 +142 +45 +148 +21 +150 +150 +150 +148 +21 +22 +148 +142 +146 +122 +103 +97 +89 +87 +79 +74 +68 +65 +58 +56 +54 +146 +146 +149 +150 +146 +142 +143 +146 +142 +150 +35 +150 +150 +150 +146 +21 +21 +150 +146 +90 +103 +92 +80 +48 +92 +83 +71 +32 +32 +32 +32 +148 +147 +32 +22 +30 +31 +32 +150 +146 +146 +146 +150 +146 +150 +150 +146 +146 +150 +146 +146 +150 +146 +81 +146 +81 +85 +55 +56 +58 +50 +147 +146 +150 +146 +150 +82 +150 +142 +146 +146 +146 +150 +150 +21 +22 +150 +143 +150 +146 +150 +150 +21 +21 +150 +150 +150 +21 +91 +51 +142 +146 +150 +150 +96 +64 +146 +146 +150 +150 +21 +146 +49 +150 +21 +150 +150 +21 +23 +149 +38 +38 +37 +41 +37 +41 +33 +30 +29 +30 +30 +30 +150 +146 +150 +99 +67 +91 +87 +109 +98 +96 +78 +71 +73 +71 +85 +71 +81 +67 +68 +70 +72 +69 +68 +150 +146 +150 +25 +114 +54 +22 +146 +150 +21 +23 +146 +21 +150 +142 +146 +150 +150 +146 +150 +146 +146 +150 +150 +22 +22 +146 +150 +146 +150 +146 +21 +84 +106 +96 +74 +88 +150 +150 +150 +146 +150 +146 +21 +29 +142 +138 +150 +29 +24 +150 +137 +22 +150 +94 +66 +150 +150 +23 +23 +148 +146 +21 +138 +150 +21 +150 +21 +22 +146 +146 +150 +150 +150 +142 +142 +146 +21 +146 +146 +146 +150 +142 +149 +142 +60 +148 +150 +150 +49 +150 +148 +144 +150 +21 +150 +146 +35 +39 +150 +146 +146 +150 +142 +150 +70 +22 +49 +31 +40 +47 +21 +146 +30 +27 +22 +22 +27 +25 +22 +31 +22 +25 +21 +29 +30 +148 +123 +148 +67 +150 +49 +23 +149 +24 +24 +24 +24 +24 +26 +24 +24 +24 +24 +26 +26 +36 +79 +72 +28 +146 +21 +146 +21 +24 +146 +146 +150 +22 +142 +146 +21 +37 +30 +23 +50 +95 +93 +104 +87 +89 +98 +94 +91 +78 +71 +64 +150 +150 +150 +146 +150 +21 +21 +150 +150 +150 +110 +146 +150 +30 +41 +41 +40 +38 +37 +43 +41 +39 +37 +41 +38 +38 +24 +42 +150 +150 +21 +22 +142 +146 +150 +146 +33 +150 +21 +21 +21 +146 +144 +26 +25 +21 +143 +99 +149 +146 +26 +150 +22 +150 +150 +146 +22 +150 +34 +32 +150 +23 +21 +150 +150 +150 +146 +21 +146 +150 +142 +79 +150 +142 +150 +150 +150 +150 +27 +90 +21 +105 +64 +108 +52 +59 +45 +50 +57 +142 +43 +39 +57 +51 +64 +41 +50 +27 +38 +36 +35 +70 +64 +85 +68 +56 +100 +66 +44 +100 +56 +24 +71 +74 +84 +150 +140 +100 +142 +146 +146 +150 +150 +142 +37 +111 +94 +109 +146 +146 +150 +146 +150 +21 +21 +146 +142 +146 +146 +150 +150 +150 +109 +64 +146 +140 +23 +102 +21 +148 +134 +150 +146 +140 +142 +150 +146 +142 +22 +146 +142 +150 +150 +150 +146 +59 +47 +44 +145 +52 +44 +146 +50 +22 +142 +25 +29 +25 +29 +29 +25 +29 +25 +29 +29 +28 +29 +29 +29 +25 +25 +146 +21 +146 +142 +31 +38 +34 +31 +31 +35 +29 +30 +30 +27 +24 +28 +27 +28 +150 +110 +59 +34 +146 +83 +146 +94 +119 +93 +88 +82 +38 +33 +66 +146 +138 +83 +55 +89 +128 +90 +97 +55 +29 +29 +24 +36 +150 +52 +103 +44 +65 +111 +66 +52 +52 +54 +51 +28 +21 +21 +142 +21 +149 +42 +142 +142 +138 +150 +23 +144 +150 +21 +142 +21 +142 +31 +27 +40 +32 +23 +150 +23 +21 +150 +146 +146 +56 +94 +30 +94 +89 +60 +73 +44 +46 +74 +70 +150 +49 +94 +92 +82 +71 +70 +93 +49 +73 +89 +21 +94 +150 +146 +55 +33 +42 +67 +146 +146 +150 +150 +22 +148 +71 +37 +21 +57 +150 +25 +148 +50 +135 +150 +144 +142 +25 +146 +147 +146 +117 +72 +47 +147 +146 +150 +76 +52 +64 +47 +66 +71 +56 +53 +60 +55 +34 +33 +50 +51 +71 +54 +63 +70 +44 +21 +22 +68 +72 +43 +60 +57 +22 +30 +150 +146 +150 +150 +136 +150 +150 +150 +30 +142 +150 +150 +21 +142 +146 +22 +146 +150 +21 +150 +150 +150 +31 +56 +71 +32 +61 +150 +146 +146 +129 +74 +31 +109 +100 +54 +22 +150 +146 +29 +146 +21 +22 +150 +146 +150 +150 +150 +150 +150 +150 +83 +64 +146 +150 +146 +150 +150 +146 +150 +146 +21 +150 +22 +25 +134 +21 +146 +150 +21 +150 +148 +94 +90 +88 +84 +80 +73 +150 +140 +146 +150 +150 +21 +150 +150 +150 +150 +21 +150 +150 +150 +150 +146 +115 +21 +108 +150 +150 +142 +85 +146 +91 +101 +95 +97 +83 +149 +146 +22 +150 +146 +150 +93 +62 +23 +21 +150 +27 +91 +91 +21 +23 +68 +84 +21 +21 +103 +38 +25 +145 +54 +48 +87 +150 +150 +143 +22 +142 +77 +143 +21 +146 +150 +146 +145 +150 +146 +146 +48 +44 +23 +23 +150 +150 +150 +21 +150 +21 +150 +146 +142 +150 +142 +21 +150 +147 +150 +146 +148 +112 +102 +95 +109 +28 +29 +98 +104 +102 +116 +86 +94 +44 +107 +97 +32 +29 +34 +91 +45 +99 +58 +96 +94 +88 +44 +75 +38 +89 +85 +69 +85 +69 +24 +24 +59 +67 +62 +56 +61 +106 +48 +42 +46 +46 +46 +38 +101 +146 +146 +146 +28 +26 +146 +112 +40 +32 +29 +28 +150 +38 +21 +25 +34 +32 +34 +38 +32 +38 +35 +34 +38 +22 +34 +32 +34 +28 +33 +33 +25 +28 +27 +27 +26 +26 +26 +26 +25 +83 +43 +87 +91 +95 +93 +132 +148 +21 +146 +150 +150 +150 +142 +21 +142 +150 +146 +146 +146 +143 +134 +60 +48 +98 +99 +91 +103 +101 +71 +87 +82 +82 +112 +56 +135 +98 +113 +89 +82 +87 +102 +60 +150 +21 +21 +25 +102 +146 +146 +46 +150 +30 +23 +22 +21 +25 +22 +21 +21 +150 +24 +23 +24 +24 +24 +24 +21 +148 +22 +22 +150 +38 +146 +22 +150 +150 +55 +145 +32 +148 +75 +142 +150 +150 +142 +150 +34 +27 +50 +146 +150 +142 +124 +150 +150 +56 +60 +45 +43 +146 +46 +35 +50 +36 +31 +146 +150 +150 +21 +150 +22 +150 +21 +149 +146 +146 +146 +23 +150 +150 +150 +23 +150 +23 +27 +25 +142 +23 +23 +26 +150 +146 +150 +150 +21 +150 +150 +150 +149 +150 +21 +150 +144 +21 +150 +150 +126 +142 +148 +149 +47 +21 +104 +76 +142 +130 +150 +21 +21 +31 +82 +150 +146 +21 +150 +47 +150 +150 +150 +142 +22 +150 +47 +126 +150 +147 +150 +26 +21 +146 +22 +146 +21 +142 +142 +150 +146 +150 +150 +146 +150 +142 +150 +150 +146 +32 +118 +21 +146 +21 +150 +150 +24 +22 +26 +22 +22 +22 +21 +22 +24 +28 +24 +28 +138 +150 +23 +50 +146 +32 +75 +50 +40 +25 +80 +150 +150 +150 +150 +21 +150 +150 +146 +146 +150 +23 +150 +150 +150 +23 +150 +150 +142 +150 +146 +146 +150 +150 +22 +22 +147 +150 +146 +150 +146 +146 +146 +149 +23 +21 +22 +21 +27 +22 +21 +21 +150 +146 +142 +150 +21 +49 +90 +146 +146 +150 +21 +54 +37 +54 +150 +53 +59 +42 +61 +40 +43 +61 +57 +49 +51 +58 +44 +41 +58 +56 +36 +53 +57 +65 +61 +59 +44 +26 +62 +28 +23 +57 +150 +22 +22 +138 +150 +142 +25 +94 +45 +150 +29 +34 +146 +36 +150 +150 +23 +27 +24 +24 +24 +24 +150 +23 +150 +136 +74 +150 +148 +150 +21 +23 +150 +150 +22 +150 +150 +28 +150 +60 +57 +53 +51 +46 +44 +39 +32 +30 +27 +22 +150 +93 +90 +88 +83 +79 +74 +71 +68 +66 +58 +21 +47 +45 +40 +150 +21 +150 +21 +150 +150 +146 +150 +21 +142 +150 +21 +21 +146 +150 +21 +21 +21 +21 +21 +150 +142 +22 +150 +146 +142 +146 +150 +146 +142 +150 +77 +148 +146 +146 +150 +150 +150 +138 +150 +146 +150 +148 +110 +29 +21 +21 +150 +55 +46 +146 +150 +142 +150 +149 +146 +146 +22 +142 +21 +146 +150 +21 +150 +150 +150 +21 +150 +150 +22 +146 +150 +150 +150 +150 +22 +150 +146 +71 +138 +70 +21 +150 +22 +21 +22 +150 +21 +22 +146 +150 +146 +150 +150 +27 +94 +94 +150 +150 +150 +150 +37 +44 +101 +73 +146 +150 +146 +146 +22 +146 +150 +146 +150 +150 +150 +37 +21 +22 +150 +150 +146 +150 +150 +22 +100 +97 +26 +150 +146 +150 +150 +31 +27 +150 +150 +150 +150 +150 +150 +23 +142 +150 +148 +87 +148 +72 +93 +146 +44 +71 +21 +150 +24 +21 +21 +21 +147 +51 +118 +146 +150 +150 +150 +21 +150 +150 +142 +125 +99 +70 +48 +150 +150 +21 +148 +146 +150 +21 +21 +146 +150 +21 +21 +150 +150 +150 +150 +21 +150 +34 +146 +44 +45 +35 +148 +146 +21 +150 +146 +22 +140 +150 +90 +150 +150 +149 +146 +146 +142 +142 +24 +146 +150 +146 +21 +150 +24 +142 +146 +23 +150 +23 +28 +150 +150 +21 +150 +21 +150 +23 +150 +21 +21 +22 +146 +150 +145 +142 +150 +21 +148 +101 +146 +150 +21 +146 +150 +21 +146 +23 +42 +150 +146 +22 +22 +22 +22 +150 +142 +150 +105 +21 +43 +147 +23 +146 +138 +150 +146 +84 +53 +38 +150 +24 +150 +149 +148 +150 +62 +62 +146 +150 +150 +83 +148 +21 +21 +28 +22 +21 +21 +25 +33 +150 +150 +142 +146 +150 +21 +150 +142 +142 +150 +146 +146 +150 +146 +31 +25 +21 +150 +22 +148 +24 +93 +150 +150 +142 +150 +23 +113 +150 +56 +48 +68 +41 +44 +26 +51 +48 +49 +49 +61 +43 +41 +57 +61 +59 +64 +49 +50 +42 +41 +44 +40 +53 +46 +42 +46 +62 +35 +36 +36 +33 +41 +65 +29 +53 +43 +47 +49 +23 +23 +144 +146 +146 +146 +146 +23 +150 +25 +25 +28 +22 +21 +140 +145 +150 +146 +131 +21 +146 +52 +150 +148 +146 +142 +150 +141 +21 +119 +142 +21 +146 +22 +146 +145 +146 +150 +77 +148 +22 +150 +23 +150 +146 +146 +21 +150 +21 +21 +150 +23 +26 +150 +22 +22 +21 +150 +55 +132 +26 +28 +25 +35 +22 +146 +150 +150 +21 +146 +142 +146 +147 +138 +146 +21 +21 +21 +144 +27 +149 +24 +150 +34 +27 +146 +147 +146 +150 +146 +142 +138 +142 +146 +52 +142 +146 +150 +146 +150 +23 +31 +150 +146 +32 +148 +69 +146 +142 +146 +150 +52 +150 +21 +146 +62 +150 +43 +150 +148 +150 +150 +24 +25 +35 +148 +59 +146 +146 +150 +48 +39 +36 +31 +33 +146 +150 +21 +132 +21 +146 +150 +21 +142 +21 +150 +146 +22 +150 +21 +22 +22 +22 +150 +21 +98 +65 +142 +35 +35 +35 +35 +33 +37 +22 +22 +150 +146 +21 +150 +90 +131 +21 +148 +110 +92 +148 +23 +41 +22 +146 +52 +35 +37 +150 +150 +146 +70 +150 +21 +150 +146 +21 +142 +21 +150 +150 +146 +21 +21 +146 +21 +21 +150 +21 +150 +144 +65 +22 +146 +150 +150 +150 +126 +146 +150 +150 +150 +146 +150 +150 +146 +150 +45 +45 +48 +146 +76 +76 +76 +149 +76 +76 +75 +61 +54 +51 +49 +45 +40 +29 +23 +23 +147 +142 +146 +146 +146 +150 +150 +150 +24 +24 +150 +21 +150 +129 +138 +150 +142 +27 +31 +35 +31 +34 +30 +27 +34 +35 +29 +33 +146 +70 +138 +150 +146 +146 +21 +121 +142 +146 +146 +22 +150 +146 +90 +82 +55 +94 +150 +78 +86 +150 +142 +73 +64 +95 +61 +89 +54 +47 +150 +37 +36 +146 +150 +150 +150 +142 +144 +53 +150 +48 +150 +142 +146 +150 +150 +142 +150 +150 +150 +150 +150 +146 +142 +21 +150 +23 +150 +138 +150 +150 +150 +27 +34 +142 +150 +146 +150 +21 +150 +21 +21 +21 +21 +22 +150 +150 +146 +146 +150 +21 +150 +21 +142 +150 +80 +22 +21 +24 +21 +23 +34 +25 +22 +25 +25 +24 +24 +33 +30 +30 +21 +30 +24 +24 +32 +42 +62 +150 +150 +23 +146 +21 +146 +150 +22 +150 +22 +150 +150 +150 +150 +32 +53 +39 +35 +30 +26 +51 +40 +40 +31 +39 +54 +39 +42 +39 +49 +34 +35 +25 +25 +24 +24 +30 +25 +33 +150 +150 +150 +150 +39 +147 +80 +150 +150 +75 +148 +150 +146 +42 +22 +22 +22 +22 +22 +22 +22 +22 +22 +22 +27 +27 +28 +27 +27 +28 +27 +27 +27 +28 +29 +150 +150 +150 +150 +37 +150 +150 +150 +150 +25 +21 +23 +21 +150 +146 +22 +84 +59 +150 +45 +142 +32 +146 +150 +150 +130 +22 +88 +150 +150 +150 +21 +150 +150 +135 +23 +21 +111 +146 +150 +25 +142 +150 +146 +68 +90 +86 +47 +142 +146 +150 +74 +150 +72 +146 +150 +146 +150 +150 +49 +45 +21 +150 +150 +58 +87 +142 +146 +27 +27 +27 +37 +146 +45 +46 +36 +34 +35 +33 +35 +37 +37 +37 +33 +33 +33 +43 +46 +47 +40 +27 +31 +150 +150 +146 +150 +150 +150 +142 +146 +146 +150 +22 +21 +146 +22 +138 +21 +142 +146 +22 +150 +23 +23 +23 +35 +75 +150 +145 +23 +31 +150 +150 +146 +41 +26 +34 +44 +40 +29 +40 +36 +40 +39 +43 +43 +42 +35 +34 +37 +33 +35 +36 +38 +42 +149 +23 +23 +28 +32 +31 +31 +31 +31 +31 +31 +30 +30 +31 +30 +30 +30 +29 +27 +27 +26 +23 +27 +146 +147 +139 +146 +150 +146 +138 +146 +150 +149 +146 +150 +89 +21 +22 +140 +150 +146 +147 +146 +21 +148 +27 +101 +21 +100 +73 +56 +60 +148 +33 +150 +145 +146 +52 +66 +78 +51 +49 +54 +46 +66 +44 +44 +24 +47 +23 +150 +146 +21 +67 +60 +150 +71 +146 +21 +21 +21 +21 +142 +21 +149 +76 +150 +150 +146 +146 +150 +21 +130 +140 +146 +22 +150 +146 +150 +150 +21 +150 +142 +150 +21 +150 +31 +41 +26 +97 +37 +34 +34 +32 +32 +33 +150 +150 +146 +31 +150 +148 +67 +146 +21 +146 +25 +146 +150 +21 +142 +22 +89 +67 +116 +129 +146 +146 +150 +146 +150 +150 +150 +129 +102 +146 +134 +150 +150 +150 +23 +150 +22 +23 +23 +23 +23 +23 +23 +150 +150 +145 +21 +142 +84 +148 +150 +22 +23 +23 +23 +89 +116 +29 +91 +68 +21 +108 +102 +122 +121 +82 +146 +34 +146 +150 +35 +28 +21 +150 +146 +150 +28 +150 +148 +150 +27 +150 +149 +26 +42 +150 +150 +146 +150 +95 +21 +150 +21 +150 +35 +148 +111 +22 +29 +48 +52 +56 +37 +52 +23 +150 +37 +53 +56 +44 +56 +24 +24 +53 +56 +60 +43 +43 +55 +110 +23 +23 +116 +145 +150 +150 +146 +106 +48 +21 +40 +21 +150 +146 +143 +150 +150 +150 +21 +21 +150 +146 +150 +43 +75 +106 +106 +50 +150 +21 +146 +146 +150 +142 +147 +146 +150 +146 +150 +150 +146 +21 +150 +150 +21 +148 +26 +53 +146 +26 +32 +27 +142 +150 +142 +150 +142 +146 +150 +26 +146 +31 +150 +21 +150 +34 +46 +35 +44 +33 +47 +48 +39 +41 +41 +39 +150 +146 +92 +150 +91 +146 +150 +30 +44 +44 +40 +38 +37 +44 +41 +39 +37 +42 +39 +38 +24 +42 +150 +21 +150 +146 +149 +150 +146 +146 +150 +146 +150 +21 +22 +21 +21 +150 +150 +146 +144 +90 +146 +62 +21 +91 +150 +22 +150 +150 +146 +150 +21 +32 +55 +82 +64 +85 +114 +121 +146 +47 +146 +150 +29 +45 +68 +64 +33 +41 +31 +150 +31 +28 +30 +29 +29 +29 +21 +56 +67 +51 +61 +56 +58 +45 +39 +53 +69 +45 +41 +41 +41 +42 +53 +34 +21 +146 +150 +150 +146 +146 +144 +146 +150 +104 +146 +150 +150 +142 +150 +150 +28 +34 +77 +32 +32 +150 +32 +47 +32 +31 +33 +31 +30 +33 +30 +30 +25 +28 +39 +37 +42 +39 +52 +24 +39 +35 +23 +26 +23 +39 +58 +39 +142 +146 +21 +150 +119 +21 +148 +150 +142 +22 +150 +21 +146 +21 +150 +27 +142 +146 +142 +21 +21 +150 +21 +23 +23 +150 +150 +146 +21 +81 +146 +21 +21 +82 +142 +146 +150 +146 +21 +21 +146 +146 +146 +150 +21 +34 +31 +63 +21 +27 +146 +150 +21 +150 +146 +150 +21 +145 +150 +150 +21 +150 +21 +150 +68 +92 +143 +150 +147 +146 +150 +142 +150 +21 +146 +150 +150 +150 +21 +21 +150 +148 +60 +146 +146 +150 +146 +150 +23 +150 +100 +93 +91 +88 +83 +79 +75 +71 +68 +21 +146 +146 +150 +146 +111 +24 +150 +146 +146 +37 +61 +53 +49 +150 +146 +148 +39 +142 +150 +24 +24 +24 +24 +26 +22 +24 +26 +26 +30 +24 +24 +24 +150 +142 +146 +21 +145 +150 +22 +46 +23 +142 +150 +146 +150 +146 +146 +150 +150 +150 +22 +150 +146 +150 +21 +146 +146 +148 +22 +21 +150 +150 +150 +148 +21 +150 +149 +35 +146 +146 +146 +21 +142 +146 +72 +34 +28 +21 +30 +30 +26 +26 +26 +30 +26 +26 +25 +34 +150 +38 +31 +35 +35 +34 +34 +34 +30 +31 +34 +30 +27 +142 +150 +148 +36 +150 +150 +27 +30 +51 +146 +146 +150 +148 +109 +46 +146 +150 +150 +146 +140 +37 +80 +36 +150 +21 +149 +143 +63 +42 +62 +70 +49 +58 +69 +66 +70 +65 +77 +59 +59 +48 +70 +67 +66 +41 +70 +72 +68 +71 +146 +146 +146 +21 +52 +85 +37 +121 +150 +112 +140 +146 +150 +22 +150 +140 +22 +143 +21 +48 +150 +21 +146 +150 +146 +142 +142 +150 +150 +21 +146 +146 +146 +148 +96 +150 +22 +150 +150 +146 +150 +55 +27 +98 +96 +71 +82 +41 +94 +55 +128 +39 +150 +150 +146 +150 +150 +150 +148 +146 +146 +146 +146 +150 +150 +142 +100 +115 +150 +135 +21 +146 +150 +146 +146 +23 +23 +117 +150 +150 +146 +148 +146 +146 +147 +150 +146 +146 +36 +78 +87 +126 +68 +137 +146 +146 +150 +25 +142 +150 +37 +21 +146 +23 +23 +150 +150 +23 +146 +41 +150 +150 +150 +21 +146 +130 +138 +150 +147 +142 +150 +150 +74 +72 +61 +33 +32 +65 +58 +60 +35 +60 +66 +45 +145 +150 +150 +21 +21 +150 +146 +142 +146 +29 +27 +138 +24 +64 +60 +28 +146 +31 +146 +146 +148 +150 +146 +146 +146 +79 +146 +39 +71 +150 +146 +150 +150 +150 +150 +138 +150 +149 +33 +33 +33 +78 +45 +72 +61 +44 +61 +56 +145 +67 +56 +56 +43 +22 +150 +150 +150 +21 +146 +23 +23 +23 +150 +149 +150 +28 +146 +142 +21 +150 +146 +150 +21 +150 +142 +52 +146 +150 +22 +22 +84 +148 +150 +142 +146 +45 +80 +148 +150 +34 +150 +150 +146 +146 +150 +150 +150 +150 +22 +142 +22 +150 +22 +146 +150 +150 +134 +150 +58 +89 +89 +55 +54 +81 +29 +24 +22 +27 +142 +146 +146 +139 +104 +106 +145 +146 +150 +22 +37 +146 +150 +26 +146 +150 +146 +22 +22 +142 +145 +52 +150 +146 +21 +148 +35 +23 +22 +150 +21 +148 +148 +32 +146 +146 +150 +150 +146 +144 +142 +148 +26 +150 +150 +48 +147 +33 +33 +35 +51 +71 +66 +56 +69 +60 +29 +78 +66 +28 +42 +56 +146 +150 +150 +150 +64 +75 +41 +139 +59 +22 +146 +146 +21 +21 +142 +146 +47 +75 +135 +150 +146 +150 +22 +127 +146 +142 +150 +148 +150 +146 +146 +142 +150 +150 +150 +142 +146 +47 +90 +61 +79 +43 +51 +114 +56 +150 +150 +150 +22 +150 +32 +150 +150 +142 +146 +150 +21 +146 +149 +150 +21 +146 +146 +90 +51 +144 +150 +59 +60 +36 +55 +86 +39 +52 +58 +76 +75 +50 +83 +69 +87 +59 +93 +37 +54 +47 +52 +84 +83 +51 +51 +94 +53 +48 +47 +21 +22 +59 +75 +80 +24 +37 +36 +30 +80 +142 +103 +21 +24 +24 +130 +150 +150 +146 +142 +26 +148 +117 +22 +51 +55 +77 +93 +104 +146 +150 +150 +146 +149 +146 +21 +150 +22 +150 +150 +21 +146 +21 +21 +21 +141 +100 +90 +150 +150 +146 +146 +146 +22 +150 +27 +150 +150 +81 +148 +150 +146 +150 +150 +146 +30 +150 +48 +51 +54 +23 +42 +49 +52 +45 +34 +34 +46 +72 +45 +59 +82 +78 +143 +95 +94 +150 +146 +146 +87 +148 +146 +150 +142 +24 +135 +84 +39 +29 +29 +31 +69 +150 +57 +57 +23 +146 +30 +26 +150 +31 +26 +26 +36 +29 +30 +24 +29 +24 +30 +34 +23 +27 +24 +23 +27 +25 +27 +25 +26 +21 +21 +23 +23 +150 +22 +150 +21 +150 +22 +146 +150 +150 +150 +142 +146 +150 +150 +146 +150 +33 +148 +142 +149 +150 +139 +150 +33 +22 +29 +29 +24 +25 +29 +22 +34 +29 +22 +21 +26 +46 +27 +23 +27 +30 +27 +25 +21 +150 +91 +57 +97 +54 +146 +146 +146 +146 +28 +150 +21 +146 +150 +146 +146 +150 +150 +146 +43 +146 +150 +150 +47 +81 +49 +150 +50 +146 +24 +21 +44 +69 +40 +21 +23 +55 +23 +23 +58 +64 +68 +54 +58 +31 +150 +26 +52 +59 +53 +51 +23 +63 +41 +41 +39 +40 +150 +22 +150 +150 +146 +24 +44 +51 +40 +32 +44 +23 +35 +32 +35 +100 +45 +30 +38 +49 +21 +30 +24 +60 +30 +30 +26 +26 +26 +30 +26 +26 +25 +77 +65 +61 +38 +49 +95 +79 +80 +86 +50 +42 +33 +62 +51 +23 +26 +40 +23 +56 +21 +32 +150 +150 +150 +21 +146 +146 +150 +150 +146 +146 +22 +146 +150 +36 +36 +150 +142 +150 +91 +97 +28 +28 +148 +26 +146 +21 +150 +142 +142 +23 +21 +21 +150 +39 +111 +23 +23 +150 +142 +113 +21 +120 +109 +115 +150 +142 +146 +150 +76 +34 +31 +42 +25 +35 +27 +27 +25 +27 +27 +74 +146 +96 +31 +72 +37 +61 +64 +60 +60 +35 +25 +43 +57 +50 +56 +34 +30 +69 +70 +53 +43 +35 +64 +26 +146 +23 +150 +150 +150 +142 +139 +146 +150 +146 +22 +150 +146 +150 +146 +150 +146 +150 +88 +150 +25 +146 +150 +23 +146 +150 +146 +150 +146 +22 +148 +146 +150 +22 +146 +150 +21 +23 +150 +146 +71 +67 +146 +150 +150 +41 +146 +90 +73 +146 +146 +27 +144 +150 +148 +143 +144 +150 +146 +147 +150 +150 +25 +150 +146 +150 +146 +150 +142 +83 +126 +21 +96 +99 +146 +146 +27 +143 +150 +142 +150 +150 +146 +23 +146 +31 +150 +31 +150 +22 +150 +142 +145 +22 +150 +150 +146 +146 +51 +146 +64 +34 +34 +34 +37 +34 +34 +31 +34 +42 +45 +45 +38 +40 +33 +33 +33 +35 +33 +33 +34 +31 +27 +28 +146 +23 +150 +150 +26 +26 +26 +34 +24 +21 +142 +142 +22 +148 +150 +150 +150 +21 +146 +30 +138 +143 +26 +21 +150 +146 +150 +150 +48 +79 +46 +138 +76 +64 +150 +150 +150 +150 +150 +49 +22 +150 +150 +150 +142 +146 +21 +21 +150 +150 +146 +150 +147 +146 +129 +146 +25 +150 +21 +150 +24 +45 +45 +49 +46 +38 +45 +45 +32 +148 +42 +44 +39 +37 +32 +33 +36 +27 +32 +30 +42 +25 +32 +34 +108 +150 +144 +150 +150 +137 +150 +150 +150 +146 +21 +21 +143 +22 +28 +92 +141 +146 +150 +39 +22 +21 +150 +150 +150 +111 +46 +48 +46 +48 +112 +102 +124 +88 +76 +67 +44 +150 +148 +70 +71 +61 +42 +55 +40 +79 +94 +96 +102 +100 +100 +85 +98 +125 +121 +23 +142 +150 +22 +150 +150 +150 +150 +102 +143 +40 +146 +146 +22 +150 +21 +146 +142 +143 +51 +142 +27 +150 +149 +60 +58 +65 +66 +142 +95 +97 +57 +56 +80 +43 +21 +28 +35 +23 +28 +23 +30 +32 +33 +23 +55 +82 +75 +73 +47 +42 +40 +30 +24 +30 +21 +23 +49 +32 +41 +39 +38 +147 +24 +146 +146 +150 +150 +26 +146 +150 +23 +148 +25 +150 +74 +22 +150 +21 +40 +66 +64 +60 +49 +49 +138 +21 +146 +150 +150 +24 +24 +24 +146 +146 +30 +29 +29 +29 +29 +38 +21 +29 +26 +138 +51 +148 +146 +150 +150 +148 +22 +150 +23 +146 +27 +56 +25 +35 +26 +26 +26 +26 +34 +30 +25 +25 +24 +27 +25 +23 +23 +23 +32 +43 +47 +50 +58 +58 +51 +48 +34 +30 +30 +146 +150 +150 +150 +148 +22 +146 +146 +138 +150 +146 +150 +55 +90 +142 +150 +21 +146 +150 +146 +146 +21 +21 +150 +150 +150 +150 +150 +150 +134 +146 +146 +138 +138 +146 +22 +73 +144 +50 +41 +94 +79 +51 +146 +51 +49 +33 +60 +43 +38 +58 +55 +35 +35 +30 +30 +69 +38 +77 +54 +24 +24 +48 +149 +21 +22 +150 +146 +150 +21 +25 +137 +138 +148 +146 +146 +22 +150 +45 +50 +55 +81 +106 +39 +72 +67 +113 +63 +67 +94 +53 +22 +35 +47 +27 +39 +29 +33 +42 +40 +23 +54 +80 +30 +53 +71 +59 +73 +36 +41 +25 +30 +30 +30 +30 +30 +30 +30 +30 +26 +48 +150 +146 +127 +92 +101 +138 +37 +65 +62 +64 +69 +58 +60 +62 +62 +38 +44 +65 +41 +55 +60 +38 +55 +53 +27 +46 +39 +28 +23 +47 +58 +53 +43 +25 +150 +150 +35 +38 +34 +34 +48 +32 +41 +32 +31 +33 +31 +30 +30 +30 +30 +25 +30 +36 +36 +32 +36 +36 +150 +21 +150 +142 +146 +21 +150 +22 +150 +150 +72 +71 +23 +24 +23 +21 +22 +22 +21 +22 +22 +22 +22 +28 +21 +21 +21 +21 +142 +97 +28 +28 +150 +150 +21 +150 +146 +146 +21 +150 +150 +25 +25 +21 +146 +21 +66 +22 +24 +22 +137 +148 +142 +149 +146 +150 +150 +56 +148 +150 +150 +150 +150 +146 +21 +146 +150 +150 +102 +150 +148 +86 +144 +150 +146 +146 +60 +141 +150 +23 +150 +150 +138 +146 +21 +150 +22 +146 +26 +40 +34 +30 +146 +34 +150 +150 +146 +150 +21 +22 +55 +93 +146 +103 +98 +144 +146 +38 +150 +142 +142 +146 +150 +150 +29 +146 +142 +148 +97 +142 +107 +146 +49 +150 +144 +118 +150 +150 +146 +146 +150 +150 +146 +150 +150 +45 +139 +147 +146 +150 +143 +146 +23 +146 +22 +150 +22 +148 +22 +150 +150 +150 +146 +21 +21 +21 +138 +150 +23 +72 +38 +146 +21 +150 +146 +150 +150 +146 +146 +150 +71 +127 +150 +100 +137 +106 +71 +104 +143 +49 +93 +128 +94 +142 +51 +122 +95 +90 +106 +84 +81 +41 +51 +51 +25 +150 +150 +146 +150 +150 +150 +21 +150 +142 +144 +150 +148 +26 +21 +42 +149 +93 +63 +22 +29 +150 +21 +150 +75 +70 +28 +28 +146 +98 +51 +149 +149 +150 +21 +21 +150 +146 +150 +150 +150 +146 +150 +21 +150 +21 +117 +150 +150 +150 +36 +148 +146 +142 +150 +150 +146 +23 +32 +39 +150 +23 +23 +23 +21 +38 +36 +36 +41 +144 +150 +21 +41 +84 +114 +21 +44 +39 +150 +146 +138 +150 +150 +146 +150 +146 +138 +146 +146 +146 +142 +147 +22 +22 +28 +44 +150 +76 +142 +46 +150 +148 +150 +150 +138 +56 +64 +96 +150 +142 +146 +149 +150 +142 +146 +150 +150 +150 +22 +150 +22 +146 +148 +28 +146 +150 +29 +34 +146 +148 +150 +47 +33 +55 +28 +32 +27 +27 +29 +28 +27 +23 +26 +26 +26 +23 +23 +22 +29 +24 +139 +150 +84 +44 +124 +150 +148 +29 +36 +38 +31 +150 +33 +41 +43 +45 +32 +150 +150 +146 +23 +146 +41 +55 +146 +24 +146 +21 +146 +21 +21 +146 +150 +146 +150 +32 +22 +146 +21 +21 +34 +150 +146 +150 +150 +150 +150 +148 +142 +150 +148 +150 +78 +148 +22 +21 +21 +150 +146 +146 +38 +37 +36 +39 +39 +41 +39 +42 +28 +36 +36 +32 +33 +21 +47 +93 +26 +150 +92 +71 +144 +44 +146 +150 +146 +142 +21 +21 +150 +150 +150 +150 +24 +23 +23 +22 +21 +22 +21 +25 +21 +21 +23 +21 +21 +21 +21 +22 +21 +21 +148 +146 +21 +68 +150 +150 +147 +142 +150 +21 +146 +147 +21 +74 +26 +26 +150 +34 +150 +146 +146 +150 +146 +147 +150 +28 +60 +150 +64 +44 +72 +22 +54 +50 +24 +24 +32 +39 +53 +36 +44 +35 +24 +42 +23 +43 +113 +21 +95 +93 +21 +21 +78 +74 +72 +67 +21 +122 +55 +29 +24 +22 +142 +21 +22 +150 +21 +150 +21 +150 +131 +86 +150 +150 +21 +33 +150 +62 +66 +150 +103 +21 +22 +150 +150 +150 +146 +146 +150 +142 +28 +150 +150 +73 +76 +150 +21 +150 +146 +150 +146 +150 +22 +146 +48 +57 +34 +50 +42 +47 +37 +44 +32 +45 +51 +46 +57 +52 +57 +46 +42 +46 +56 +53 +35 +31 +33 +28 +44 +150 +142 +150 +146 +119 +52 +138 +69 +45 +146 +150 +21 +146 +146 +146 +146 +146 +150 +138 +48 +30 +150 +21 +150 +31 +146 +150 +146 +22 +150 +21 +146 +150 +150 +146 +142 +150 +142 +124 +150 +30 +150 +21 +146 +142 +21 +150 +28 +35 +53 +72 +40 +42 +125 +57 +32 +36 +56 +21 +35 +43 +55 +33 +45 +37 +50 +36 +33 +22 +63 +46 +81 +80 +150 +22 +22 +150 +43 +22 +150 +150 +22 +146 +22 +21 +143 +150 +150 +150 +24 +26 +146 +150 +150 +150 +21 +150 +150 +142 +146 +146 +146 +23 +23 +150 +150 +23 +150 +150 +23 +150 +106 +150 +22 +21 +150 +142 +147 +149 +150 +146 +148 +21 +150 +48 +150 +150 +145 +21 +142 +150 +150 +146 +25 +142 +21 +42 +45 +36 +44 +33 +42 +146 +27 +28 +150 +142 +146 +21 +139 +132 +21 +23 +150 +142 +142 +150 +150 +24 +150 +125 +100 +150 +146 +51 +51 +147 +22 +22 +150 +148 +150 +22 +150 +143 +30 +23 +40 +24 +23 +29 +34 +49 +117 +150 +51 +145 +150 +60 +79 +150 +150 +24 +144 +150 +150 +25 +148 +143 +150 +150 +146 +21 +21 +21 +21 +21 +21 +21 +21 +21 +21 +150 +150 +27 +150 +150 +146 +24 +146 +21 +147 +146 +139 +150 +37 +148 +143 +72 +111 +138 +150 +146 +150 +30 +142 +144 +150 +125 +150 +38 +39 +146 +150 +21 +146 +150 +150 +142 +23 +21 +150 +21 +150 +38 +25 +150 +52 +150 +146 +150 +21 +21 +146 +150 +146 +146 +30 +43 +41 +32 +22 +146 +146 +144 +146 +138 +150 +150 +23 +66 +146 +147 +150 +107 +86 +146 +146 +150 +29 +148 +150 +150 +66 +150 +138 +142 +33 +22 +22 +22 +22 +22 +22 +22 +22 +22 +22 +27 +27 +28 +27 +27 +28 +27 +27 +27 +28 +23 +142 +146 +150 +142 +146 +150 +150 +150 +150 +146 +22 +129 +95 +77 +150 +142 +150 +150 +62 +149 +150 +27 +138 +142 +150 +24 +22 +150 +22 +22 +26 +23 +150 +146 +64 +142 +23 +76 +61 +72 +142 +146 +22 +22 +146 +139 +21 +134 +146 +142 +146 +146 +150 +47 +33 +32 +32 +28 +40 +29 +37 +31 +33 +34 +31 +37 +36 +33 +24 +44 +43 +35 +47 +45 +50 +49 +47 +48 +50 +41 +27 +33 +33 +35 +31 +25 +30 +30 +30 +28 +22 +150 +21 +146 +21 +146 +142 +150 +150 +150 +150 +150 +21 +22 +150 +36 +21 +146 +142 +22 +146 +150 +150 +150 +24 +150 +21 +21 +21 +21 +146 +150 +142 +21 +135 +25 +21 +21 +22 +22 +150 +24 +23 +146 +146 +146 +22 +21 +150 +140 +146 +146 +146 +150 +148 +146 +150 +21 +21 +150 +150 +150 +146 +150 +21 +146 +146 +150 +139 +150 +150 +21 +150 +23 +150 +37 +150 +53 +55 +58 +50 +50 +47 +27 +45 +150 +146 +21 +21 +150 +62 +24 +139 +129 +146 +27 +21 +27 +21 +21 +148 +150 +146 +150 +75 +128 +146 +146 +146 +21 +150 +21 +109 +150 +109 +31 +146 +22 +21 +23 +147 +150 +142 +142 +22 +146 +150 +146 +142 +150 +146 +136 +150 +141 +142 +150 +146 +82 +70 +146 +150 +37 +28 +150 +54 +150 +22 +47 +150 +31 +31 +39 +150 +146 +146 +150 +142 +150 +150 +59 +142 +23 +148 +150 +21 +150 +150 +150 +142 +37 +146 +150 +150 +21 +146 +150 +27 +27 +28 +150 +142 +21 +22 +146 +146 +21 +148 +55 +55 +24 +36 +51 +25 +150 +35 +29 +55 +54 +34 +55 +55 +35 +39 +22 +89 +150 +146 +150 +146 +150 +148 +150 +150 +101 +107 +95 +89 +86 +80 +77 +74 +71 +69 +65 +150 +21 +38 +36 +33 +31 +27 +23 +150 +150 +146 +21 +150 +150 +29 +28 +27 +22 +146 +148 +24 +119 +100 +109 +146 +22 +100 +35 +150 +148 +146 +21 +150 +149 +150 +150 +138 +150 +138 +150 +142 +127 +48 +48 +116 +120 +39 +35 +38 +150 +31 +31 +150 +150 +21 +148 +21 +150 +150 +150 +150 +146 +146 +142 +150 +28 +30 +30 +30 +35 +146 +146 +150 +150 +150 +59 +149 +75 +62 +49 +77 +70 +37 +52 +36 +41 +36 +73 +27 +53 +66 +74 +34 +37 +36 +48 +46 +38 +39 +26 +34 +34 +39 +34 +22 +35 +31 +31 +146 +147 +146 +96 +150 +22 +21 +150 +150 +51 +146 +56 +45 +36 +50 +33 +140 +21 +21 +150 +32 +35 +33 +34 +32 +32 +32 +32 +32 +32 +32 +30 +29 +22 +29 +29 +27 +32 +24 +32 +34 +32 +32 +32 +32 +32 +32 +73 +150 +61 +33 +63 +50 +39 +35 +56 +57 +42 +52 +52 +67 +40 +71 +24 +23 +87 +37 +148 +148 +21 +150 +150 +21 +22 +150 +22 +149 +150 +146 +22 +23 +150 +150 +146 +22 +150 +21 +150 +150 +150 +23 +146 +137 +52 +81 +85 +150 +66 +72 +36 +31 +150 +150 +150 +22 +146 +150 +146 +146 +150 +150 +146 +150 +150 +23 +23 +150 +21 +22 +63 +140 +146 +150 +150 +146 +150 +150 +22 +150 +150 +150 +147 +62 +150 +150 +25 +21 +142 +91 +88 +148 +72 +148 +27 +140 +21 +21 +150 +146 +146 +44 +146 +50 +54 +56 +47 +54 +55 +49 +35 +43 +39 +53 +43 +54 +43 +48 +51 +36 +34 +150 +150 +146 +21 +150 +21 +143 +26 +141 +24 +41 +46 +50 +47 +36 +38 +42 +38 +34 +34 +45 +40 +28 +26 +26 +142 +142 +21 +150 +146 +21 +150 +143 +22 +147 +22 +31 +26 +32 +146 +139 +150 +146 +22 +145 +150 +150 +150 +150 +146 +150 +148 +120 +150 +21 +27 +21 +21 +124 +150 +82 +75 +147 +150 +146 +150 +47 +21 +150 +146 +150 +150 +146 +53 +143 +150 +150 +21 +146 +146 +49 +146 +29 +150 +36 +82 +124 +62 +62 +58 +33 +36 +38 +40 +39 +37 +39 +105 +24 +39 +40 +21 +21 +148 +150 +146 +21 +146 +100 +23 +111 +101 +146 +146 +150 +146 +36 +42 +150 +138 +95 +131 +81 +146 +21 +150 +146 +21 +146 +146 +150 +150 +150 +142 +146 +146 +146 +146 +135 +24 +21 +21 +30 +23 +142 +146 +150 +150 +146 +21 +150 +146 +146 +21 +146 +21 +21 +150 +146 +146 +22 +150 +147 +142 +150 +38 +98 +150 +149 +27 +27 +23 +22 +23 +23 +23 +23 +21 +23 +23 +30 +23 +26 +25 +25 +21 +22 +130 +96 +36 +26 +25 +29 +29 +25 +25 +25 +25 +29 +25 +28 +28 +28 +27 +28 +23 +23 +27 +23 +27 +26 +26 +37 +35 +35 +35 +35 +150 +31 +23 +24 +146 +150 +149 +150 +71 +150 +85 +59 +150 +142 +146 +146 +146 +22 +59 +150 +21 +100 +80 +43 +128 +98 +55 +22 +148 +25 +29 +35 +37 +150 +36 +150 +150 +146 +111 +27 +146 +150 +150 +21 +150 +146 +150 +150 +150 +148 +116 +149 +150 +21 +21 +21 +78 +132 +33 +150 +150 +150 +150 +147 +146 +150 +146 +146 +67 +137 +22 +91 +146 +21 +21 +150 +150 +142 +146 +140 +150 +150 +141 +150 +146 +150 +22 +150 +150 +150 +71 +110 +130 +146 +97 +21 +21 +21 +21 +21 +21 +21 +21 +150 +146 +146 +150 +150 +146 +150 +146 +146 +150 +21 +150 +146 +146 +146 +150 +150 +150 +150 +22 +146 +138 +22 +22 +150 +25 +34 +150 +87 +142 +92 +32 +41 +39 +34 +115 +149 +75 +94 +75 +97 +120 +116 +86 +113 +150 +146 +61 +64 +21 +148 +144 +27 +27 +80 +74 +149 +146 +21 +150 +138 +142 +142 +55 +150 +50 +51 +47 +52 +85 +40 +55 +21 +52 +142 +150 +150 +148 +150 +30 +150 +146 +142 +150 +150 +148 +21 +21 +146 +21 +150 +150 +23 +150 +150 +21 +150 +21 +21 +88 +21 +21 +146 +146 +142 +145 +21 +150 +146 +146 +150 +150 +146 +141 +62 +62 +106 +102 +30 +35 +150 +35 +138 +148 +146 +140 +21 +130 +71 +70 +134 +28 +82 +74 +49 +85 +69 +42 +71 +54 +76 +150 +150 +26 +146 +150 +150 +33 +146 +150 +146 +142 +21 +150 +146 +21 +21 +22 +150 +150 +143 +150 +88 +31 +146 +150 +146 +79 +147 +21 +21 +146 +142 +146 +142 +142 +146 +146 +142 +146 +21 +24 +150 +144 +150 +110 +92 +146 +150 +150 +21 +21 +28 +150 +150 +130 +86 +136 +146 +23 +22 +35 +34 +146 +150 +146 +21 +150 +150 +106 +49 +146 +34 +53 +28 +49 +150 +64 +52 +22 +150 +23 +22 +149 +21 +138 +23 +150 +146 +23 +26 +24 +27 +22 +140 +150 +22 +150 +65 +67 +69 +30 +62 +55 +76 +39 +81 +150 +150 +150 +147 +142 +150 +147 +27 +36 +34 +21 +33 +146 +47 +144 +142 +146 +150 +146 +21 +147 +150 +150 +34 +125 +146 +150 +93 +70 +21 +150 +150 +143 +142 +122 +23 +148 +146 +91 +101 +142 +150 +150 +150 +150 +150 +134 +101 +129 +150 +150 +67 +148 +146 +138 +22 +146 +148 +150 +145 +146 +143 +142 +150 +146 +150 +85 +21 +43 +111 +27 +146 +146 +23 +138 +150 +21 +146 +37 +24 +25 +146 +146 +21 +146 +146 +21 +150 +23 +34 +88 +146 +150 +142 +146 +150 +150 +146 +150 +56 +150 +108 +146 +141 +21 +150 +23 +147 +146 +32 +29 +27 +27 +26 +150 +150 +23 +31 +150 +146 +49 +136 +21 +150 +99 +123 +146 +142 +21 +21 +146 +42 +146 +150 +138 +21 +21 +21 +150 +150 +146 +34 +54 +59 +63 +52 +55 +55 +54 +54 +61 +55 +42 +47 +42 +41 +39 +35 +39 +22 +36 +32 +21 +24 +32 +48 +32 +49 +38 +40 +34 +146 +22 +22 +146 +146 +150 +21 +21 +150 +142 +150 +146 +146 +146 +146 +146 +21 +150 +150 +150 +21 +146 +150 +150 +142 +21 +150 +150 +147 +146 +150 +150 +150 +150 +23 +87 +87 +150 +150 +144 +150 +150 +146 +146 +21 +150 +101 +33 +40 +30 +22 +21 +32 +46 +46 +46 +27 +27 +27 +28 +128 +146 +37 +146 +150 +150 +21 +31 +150 +31 +44 +52 +150 +21 +146 +100 +150 +150 +150 +150 +21 +21 +148 +30 +150 +148 +146 +21 +150 +150 +145 +95 +22 +150 +144 +150 +21 +146 +21 +21 +146 +150 +150 +33 +33 +144 +146 +146 +24 +122 +150 +150 +150 +69 +126 +21 +150 +150 +33 +146 +25 +150 +21 +150 +150 +150 +30 +28 +35 +146 +29 +146 +23 +21 +150 +150 +24 +23 +22 +22 +25 +29 +146 +142 +65 +115 +107 +146 +146 +146 +21 +21 +146 +142 +38 +23 +146 +150 +146 +150 +27 +150 +150 +150 +150 +142 +150 +142 +150 +23 +146 +150 +21 +150 +136 +50 +150 +142 +71 +76 +146 +146 +150 +150 +146 +150 +146 +150 +47 +25 +34 +36 +25 +47 +26 +24 +150 +22 +21 +21 +146 +146 +150 +76 +22 +150 +42 +146 +150 +22 +150 +150 +150 +149 +150 +29 +36 +40 +36 +38 +35 +31 +39 +40 +33 +38 +144 +21 +150 +25 +150 +23 +21 +84 +142 +142 +101 +79 +143 +70 +150 +146 +150 +150 +81 +102 +139 +21 +149 +150 +150 +146 +150 +146 +21 +150 +146 +109 +58 +106 +52 +50 +62 +56 +59 +92 +45 +131 +150 +41 +127 +149 +81 +150 +98 +67 +21 +134 +33 +27 +42 +31 +150 +39 +26 +40 +24 +24 +34 +45 +22 +21 +21 +40 +22 +146 +150 +146 +49 +142 +55 +146 +21 +146 +43 +29 +50 +47 +22 +34 +36 +41 +150 +150 +150 +150 +137 +86 +93 +142 +21 +102 +92 +80 +98 +76 +54 +62 +23 +23 +78 +130 +143 +74 +82 +88 +104 +94 +77 +53 +52 +59 +50 +146 +21 +150 +150 +146 +30 +104 +150 +25 +29 +28 +23 +32 +146 +28 +142 +150 +150 +150 +21 +144 +146 +100 +22 +58 +144 +146 +150 +150 +134 +150 +150 +150 +35 +148 +21 +71 +137 +146 +146 +40 +59 +44 +35 +35 +26 +57 +47 +47 +38 +45 +68 +49 +42 +53 +58 +45 +41 +32 +28 +32 +32 +37 +31 +41 +33 +149 +23 +22 +95 +23 +142 +77 +69 +45 +47 +82 +146 +22 +22 +21 +142 +91 +148 +42 +146 +150 +146 +150 +140 +21 +21 +21 +23 +150 +150 +21 +21 +142 +146 +22 +150 +137 +21 +142 +146 +142 +115 +21 +21 +21 +150 +142 +150 +150 +150 +21 +146 +146 +150 +150 +150 +45 +150 +22 +150 +21 +23 +22 +143 +30 +147 +150 +21 +21 +148 +150 +142 +150 +150 +148 +22 +114 +38 +150 +142 +34 +41 +46 +48 +47 +47 +40 +42 +46 +35 +39 +44 +37 +45 +40 +36 +43 +26 +44 +33 +44 +150 +56 +148 +142 +139 +150 +53 +138 +55 +55 +48 +48 +40 +36 +33 +32 +37 +32 +28 +24 +43 +33 +30 +39 +26 +146 +150 +145 +94 +94 +142 +138 +146 +150 +150 +21 +150 +22 +150 +150 +150 +100 +21 +33 +150 +146 +150 +150 +150 +22 +150 +150 +148 +23 +150 +150 +29 +23 +22 +24 +25 +150 +146 +146 +146 +23 +138 +150 +22 +22 +150 +21 +146 +146 +24 +24 +24 +52 +146 +150 +142 +21 +150 +21 +150 +150 +150 +150 +142 +146 +146 +148 +150 +67 +26 +146 +21 +21 +24 +150 +21 +150 +146 +22 +99 +146 +21 +22 +150 +150 +26 +146 +146 +94 +146 +60 +150 +26 +23 +146 +101 +50 +150 +150 +56 +87 +144 +146 +142 +150 +47 +30 +39 +150 +96 +150 +21 +21 +144 +146 +89 +148 +150 +62 +69 +38 +73 +32 +30 +42 +40 +146 +28 +32 +23 +150 +150 +138 +150 +21 +146 +75 +142 +141 +45 +146 +83 +84 +149 +21 +138 +21 +23 +134 +23 +23 +23 +23 +29 +33 +33 +32 +146 +112 +87 +146 +146 +150 +150 +150 +146 +150 +146 +54 +141 +150 +21 +150 +150 +150 +150 +41 +21 +142 +149 +146 +142 +150 +150 +150 +23 +21 +146 +98 +150 +146 +150 +142 +31 +144 +150 +150 +120 +98 +67 +138 +150 +150 +142 +145 +122 +146 +146 +146 +146 +150 +150 +150 +150 +150 +42 +150 +134 +148 +142 +138 +150 +33 +146 +21 +21 +150 +146 +150 +58 +57 +150 +35 +35 +150 +146 +150 +148 +150 +150 +150 +142 +150 +146 +150 +24 +21 +150 +146 +41 +146 +149 +150 +99 +146 +142 +150 +150 +150 +146 +146 +146 +150 +41 +24 +144 +49 +146 +146 +146 +142 +150 +146 +150 +150 +146 +150 +150 +119 +94 +150 +54 +22 +150 +150 +146 +150 +150 +150 +138 +150 +49 +147 +146 +150 +22 +146 +150 +150 +150 +146 +146 +150 +146 +150 +51 +146 +150 +146 +146 +23 +23 +23 +146 +146 +138 +60 +34 +134 +150 +144 +148 +146 +146 +22 +142 +150 +88 +66 +150 +150 +111 +120 +60 +146 +146 +21 +21 +21 +150 +150 +27 +150 +22 +26 +111 +124 +44 +150 +150 +150 +144 +146 +28 +148 +150 +146 +150 +150 +68 +150 +150 +150 +150 +66 +63 +139 +59 +36 +73 +61 +70 +75 +92 +75 +81 +50 +64 +43 +30 +41 +41 +41 +30 +39 +31 +28 +35 +38 +33 +31 +28 +50 +77 +150 +69 +101 +92 +89 +28 +150 +150 +150 +150 +22 +150 +142 +150 +32 +146 +150 +150 +150 +142 +150 +146 +146 +146 +119 +48 +132 +142 +129 +142 +146 +150 +43 +150 +37 +148 +150 +37 +62 +72 +43 +142 +146 +142 +146 +146 +84 +150 +150 +119 +144 +146 +150 +150 +65 +148 +144 +146 +142 +150 +150 +32 +146 +150 +146 +150 +150 +150 +146 +150 +146 +142 +150 +150 +150 +22 +24 +24 +24 +23 +150 +150 +146 +31 +148 +36 +150 +149 +150 +150 +150 +142 +93 +150 +29 +148 +78 +131 +21 +150 +150 +150 +142 +150 +150 +150 +150 +150 +147 +148 +26 +45 +46 +148 +150 +21 +22 +146 +150 +146 +150 +146 +150 +150 +142 +150 +123 +150 +142 +150 +150 +150 +125 +146 +33 +150 +146 +150 +150 +150 +150 +146 +28 +150 +150 +150 +21 +146 +146 +146 +150 +150 +150 +100 +146 +150 +115 +128 +99 +146 +150 +21 +146 +150 +31 +150 +150 +150 +148 +150 +150 +21 +150 +142 +53 +146 +146 +150 +125 +133 +146 +146 +150 +150 +150 +150 +138 +150 +138 +146 +150 +22 +150 +146 +146 +146 +35 +150 +143 +82 +54 +75 +150 +28 +27 +150 +36 +144 +146 +138 +150 +138 +86 +148 +150 +146 +147 +136 +146 +92 +89 +42 +29 +37 +37 +41 +64 +29 +29 +29 +29 +29 +62 +48 +38 +25 +50 +39 +37 +37 +35 +71 +37 +78 +148 +76 +80 +116 +104 +86 +84 +100 +50 +31 +39 +31 +28 +35 +38 +33 +31 +30 +41 +41 +41 +43 +30 +67 +74 +79 +61 +79 +46 +150 +146 +146 +150 +150 +146 +57 +146 +121 +150 +146 +146 +146 +21 +150 +150 +142 +146 +146 +150 +150 +141 +146 +144 +150 +37 +140 +104 +25 +93 +150 +30 +150 +25 +150 +150 +150 +150 +150 +150 +104 +150 +150 +150 +146 +146 +34 +44 +32 +142 +87 +79 +148 +150 +146 +150 +146 +37 +24 +22 +22 +24 +150 +146 +150 +21 +39 +150 +150 +146 +39 +144 +150 +24 +41 +31 +56 +28 +49 +148 +139 +55 +69 +101 +113 +150 +150 +150 +143 +52 +48 +47 +150 +65 +146 +21 +138 +146 +138 +142 +146 +150 +61 +150 +150 +150 +142 +146 +146 +146 +150 +146 +21 +143 +142 +150 +150 +146 +150 +146 +143 +124 +150 +146 +146 +150 +146 +57 +143 +25 +150 +149 +142 +150 +150 +142 +150 +150 +78 +148 +146 +150 +44 +147 +150 +146 +21 +150 +150 +150 +150 +138 +150 +150 +150 +21 +146 +21 +146 +85 +150 +150 +150 +150 +150 +150 +150 +150 +21 +149 +150 +21 +142 +150 +150 +150 +146 +142 +150 +150 +146 +35 +150 +150 +142 +148 +146 +25 +150 +146 +73 +37 +150 +142 +150 +150 +32 +146 +147 +64 +147 +142 +66 +123 +118 +35 +122 +43 +28 +38 +21 +150 +150 +146 +39 +150 +51 +146 +150 +147 +37 +150 +21 +134 +146 +146 +150 +146 +150 +146 +150 +150 +150 +150 +150 +150 +150 +27 +150 +95 +23 +23 +61 +146 +77 +150 +150 +36 +134 +28 +150 +47 +101 +24 +46 +146 +150 +142 +150 +150 +150 +21 +146 +150 +146 +150 +150 +150 +146 +150 +150 +150 +150 +142 +145 +150 +150 +75 +93 +79 +88 +150 +73 +46 +150 +150 +39 +146 +35 +150 +26 +23 +150 +148 +114 +101 +150 +148 +150 +35 +73 +52 +65 +146 +146 +146 +142 +138 +39 +150 +49 +150 +150 +148 +150 +150 +65 +146 +55 +150 +45 +150 +146 +132 +150 +150 +150 +100 +37 +142 +148 +148 +26 +148 +50 +43 +150 +142 +21 +150 +150 +146 +146 +61 +86 +150 +146 +146 +150 +146 +42 +150 +150 +150 +47 +119 +133 +146 +142 +146 +142 +146 +150 +146 +142 +146 +146 +146 +150 +150 +146 +150 +35 +150 +150 +150 +23 +150 +150 +150 +148 +52 +21 +146 +52 +146 +85 +21 +150 +146 +150 +28 +146 +146 +150 +58 +150 +49 +150 +146 +146 +146 +150 +150 +150 +146 +150 +43 +150 +142 +142 +150 +150 +146 +21 +150 +150 +145 +150 +150 +36 +150 +150 +146 +150 +150 +148 +22 +146 +38 +150 +146 +150 +150 +150 +150 +21 +30 +144 +149 +150 +144 +148 +150 +31 +121 +150 +150 +150 +150 +148 +150 +46 +150 +146 +150 +37 +38 +33 +36 +39 +32 +30 +47 +93 +96 +150 +144 +149 +146 +150 +101 +44 +146 +146 +146 +138 +62 +53 +38 +56 +65 +86 +91 +85 +150 +142 +150 +73 +51 +71 +147 +32 +150 +149 +93 +108 +56 +28 +26 +26 +25 +26 +29 +29 +22 +22 +22 +24 +26 +22 +24 +21 +22 +22 +21 +21 +21 +21 +25 +24 +25 +21 +22 +23 +23 +24 +24 +30 +35 +22 +150 +150 +150 +150 +146 +150 +150 +150 +25 +142 +54 +106 +42 +150 +150 +150 +150 +150 +150 +38 +139 +31 +146 +150 +37 +146 +146 +148 +145 +150 +78 +33 +150 +146 +150 +74 +146 +150 +21 +146 +59 +97 +150 +150 +150 +38 +22 +36 +150 +148 +138 +26 +26 +22 +21 +21 +21 +21 +21 +21 +21 +21 +150 +150 +130 +143 +150 +146 +144 +150 +62 +146 +91 +150 +150 +149 +150 +150 +146 +146 +150 +120 +36 +146 +146 +123 +41 +146 +66 +76 +146 +21 +146 +150 +146 +150 +146 +146 +150 +142 +150 +26 +21 +138 +146 +142 +150 +141 +146 +150 +89 +63 +150 +146 +150 +150 +146 +146 +150 +150 +21 +119 +124 +91 +89 +72 +146 +114 +130 +146 +150 +146 +30 +150 +146 +146 +150 +150 +24 +150 +28 +24 +23 +150 +146 +50 +150 +150 +48 +140 +150 +150 +146 +150 +33 +150 +21 +21 +150 +150 +150 +150 +21 +142 +146 +141 +95 +43 +52 +113 +35 +147 +146 +150 +80 +150 +146 +135 +115 +93 +43 +150 +41 +150 +146 +146 +150 +150 +31 +142 +150 +150 +150 +150 +150 +146 +142 +150 +150 +142 +58 +148 +41 +148 +84 +150 +142 +146 +150 +146 +70 +146 +150 +33 +146 +150 +82 +68 +150 +94 +150 +150 +146 +142 +142 +21 +150 +146 +21 +150 +142 +150 +142 +142 +150 +37 +142 +150 +146 +150 +21 +41 +88 +150 +150 +146 +150 +142 +147 +146 +150 +150 +150 +150 +146 +142 +150 +146 +150 +92 +93 +134 +150 +86 +85 +150 +45 +150 +150 +150 +144 +36 +150 +150 +150 +22 +22 +150 +150 +150 +146 +21 +150 +143 +150 +150 +146 +142 +85 +146 +150 +150 +100 +142 +142 +150 +150 +150 +150 +150 +73 +148 +83 +144 +23 +22 +150 +134 +150 +138 +150 +150 +142 +150 +150 +150 +150 +146 +146 +51 +69 +146 +150 +150 +56 +146 +146 +142 +150 +146 +150 +142 +142 +22 +150 +80 +37 +41 +146 +142 +150 +150 +146 +146 +150 +150 +146 +150 +146 +22 +146 +147 +146 +150 +26 +26 +27 +26 +26 +26 +26 +28 +27 +28 +27 +24 +24 +27 +26 +25 +30 +25 +25 +28 +25 +24 +25 +25 +26 +25 +26 +21 +142 +150 +124 +24 +150 +39 +150 +146 +150 +25 +142 +40 +150 +136 +21 +150 +150 +150 +146 +146 +146 +21 +25 +150 +150 +150 +146 +146 +150 +142 +61 +150 +41 +122 +150 +150 +142 +148 +30 +29 +147 +142 +31 +150 +26 +142 +128 +78 +81 +150 +150 +150 +146 +150 +150 +150 +27 +143 +146 +146 +150 +22 +146 +150 +85 +142 +146 +150 +150 +74 +150 +146 +146 +25 +150 +146 +150 +101 +144 +149 +148 +150 +150 +150 +150 +150 +42 +39 +45 +38 +35 +40 +39 +21 +21 +22 +22 +22 +22 +22 +21 +21 +21 +21 +21 +21 +21 +21 +22 +21 +150 +150 +146 +150 +146 +146 +21 +146 +150 +146 +146 +150 +146 +146 +150 +150 +101 +26 +30 +30 +137 +142 +21 +146 +67 +144 +150 +45 +146 +146 +146 +49 +21 +150 +22 +23 +150 +27 +21 +21 +21 +146 +142 +150 +150 +146 +149 +150 +142 +150 +146 +150 +49 +142 +27 +150 +150 +68 +71 +148 +150 +150 +150 +150 +21 +26 +138 +150 +150 +146 +147 +146 +150 +84 +150 +150 +146 +150 +150 +91 +150 +150 +150 +150 +37 +50 +39 +43 +46 +56 +40 +150 +150 +46 +136 +21 +150 +100 +82 +45 +142 +96 +146 +31 +150 +146 +43 +146 +80 +67 +150 +150 +82 +140 +150 +42 +148 +150 +21 +45 +150 +146 +146 +148 +142 +150 +145 +146 +28 +28 +28 +27 +27 +25 +26 +26 +25 +25 +74 +24 +25 +21 +150 +27 +26 +27 +26 +25 +27 +25 +25 +26 +27 +24 +26 +28 +25 +147 +139 +57 +150 +24 +23 +21 +150 +146 +150 +146 +55 +146 +150 +148 +52 +146 +146 +148 +150 +142 +59 +75 +150 +122 +150 +150 +150 +46 +146 +146 +150 +39 +39 +38 +54 +144 +146 +150 +150 +147 +28 +150 +150 +146 +148 +146 +22 +46 +146 +150 +150 +150 +150 +100 +70 +150 +150 +150 +150 +146 +28 +32 +146 +26 +29 +148 +36 +100 +42 +28 +126 +150 +60 +150 +146 +142 +146 +26 +37 +150 +34 +146 +150 +68 +150 +59 +90 +70 +74 +44 +95 +97 +113 +61 +150 +146 +31 +150 +150 +146 +149 +150 +29 +26 +27 +27 +26 +27 +29 +30 +28 +26 +24 +24 +25 +146 +28 +28 +26 +26 +26 +26 +26 +25 +26 +27 +26 +28 +25 +27 +21 +150 +26 +23 +150 +148 +142 +146 +146 +150 +150 +150 +150 +146 +46 +146 +150 +150 +150 +148 +146 +148 +142 +146 +148 +150 +150 +146 +146 +74 +79 +82 +88 +87 +69 +150 +52 +150 +150 +150 +150 +142 +150 +133 +95 +35 +150 +150 +120 +70 +146 +146 +150 +150 +21 +150 +146 +146 +21 +142 +146 +142 +21 +21 +146 +63 +91 +122 +150 +146 +150 +65 +150 +150 +65 +146 +150 +150 +142 +148 +146 +150 +150 +31 +146 +96 +110 +95 +30 +150 +50 +146 +143 +146 +142 +61 +72 +146 +146 +115 +28 +146 +146 +150 +146 +57 +150 +21 +146 +146 +146 +22 +148 +150 +23 +148 +146 +48 +21 +23 +21 +22 +21 +21 +138 +146 +150 +118 +139 +45 +144 +105 +37 +148 +53 +148 +150 +146 +148 +64 +146 +150 +146 +150 +150 +146 +27 +120 +95 +142 +139 +150 +22 +150 +21 +142 +21 +46 +146 +150 +147 +150 +142 +150 +150 +142 +146 +93 +111 +98 +150 +150 +146 +146 +150 +146 +150 +150 +146 +146 +150 +37 +150 +150 +150 +150 +146 +21 +150 +144 +92 +51 +150 +150 +150 +150 +147 +35 +150 +148 +142 +146 +150 +150 +150 +146 +31 +43 +150 +32 +146 +23 +150 +146 +29 +29 +116 +26 +150 +148 +32 +144 +144 +146 +146 +150 +146 +145 +146 +78 +117 +21 +93 +33 +57 +148 +142 +142 +142 +147 +98 +146 +150 +125 +150 +146 +150 +148 +142 +146 +148 +142 +150 +150 +146 +150 +150 +97 +150 +66 +22 +138 +142 +103 +146 +146 +137 +148 +27 +146 +32 +146 +150 +146 +42 +150 +145 +150 +21 +150 +150 +146 +146 +142 +150 +100 +35 +141 +45 +44 +54 +150 +147 +146 +30 +150 +150 +146 +150 +51 +150 +142 +32 +37 +148 +92 +146 +150 +148 +47 +146 +150 +146 +144 +142 +150 +72 +66 +39 +27 +30 +53 +74 +146 +21 +150 +150 +150 +146 +150 +29 +150 +147 +64 +24 +52 +148 +146 +148 +142 +146 +21 +78 +150 +150 +146 +146 +138 +150 +75 +148 +142 +146 +146 +150 +146 +150 +71 +76 +74 +150 +150 +150 +150 +146 +150 +146 +150 +21 +22 +146 +63 +43 +150 +150 +146 +150 +146 +133 +138 +29 +129 +150 +25 +150 +57 +150 +149 +86 +57 +142 +142 +150 +145 +44 +150 +150 +146 +150 +150 +150 +150 +61 +143 +51 +138 +146 +150 +142 +50 +21 +150 +33 +150 +57 +143 +148 +149 +21 +146 +150 +146 +146 +150 +150 +150 +146 +52 +150 +150 +150 +146 +146 +23 +146 +150 +146 +146 +150 +146 +65 +29 +148 +74 +150 +150 +148 +146 +94 +121 +150 +150 +150 +138 +137 +142 +44 +146 +146 +36 +59 +138 +81 +146 +146 +150 +146 +146 +41 +146 +142 +146 +39 +150 +150 +33 +30 +27 +150 +23 +150 +150 +146 +150 +28 +26 +28 +26 +28 +28 +26 +26 +27 +27 +26 +27 +25 +21 +150 +28 +28 +27 +27 +27 +27 +26 +26 +26 +25 +25 +26 +26 +150 +54 +150 +27 +150 +150 +150 +76 +150 +146 +146 +150 +21 +21 +150 +26 +146 +150 +70 +150 +21 +150 +150 +150 +146 +65 +58 +150 +64 +147 +146 +28 +30 +35 +42 +50 +45 +35 +34 +146 +150 +146 +150 +150 +150 +44 +150 +150 +41 +150 +150 +150 +150 +150 +41 +150 +35 +150 +35 +30 +148 +142 +83 +125 +138 +74 +150 +148 +141 +146 +144 +150 +146 +146 +138 +150 +150 +147 +33 +42 +134 +46 +150 +26 +27 +27 +28 +27 +26 +26 +26 +27 +25 +24 +21 +27 +27 +150 +27 +27 +27 +28 +27 +27 +28 +26 +26 +26 +28 +26 +26 +26 +22 +146 +147 +150 +146 +147 +150 +119 +70 +150 +68 +150 +146 +21 +142 +148 +146 +150 +150 +47 +146 +150 +150 +150 +34 +55 +21 +150 +150 +57 +146 +142 +146 +26 +28 +25 +28 +26 +26 +25 +33 +26 +26 +27 +26 +25 +25 +28 +150 +27 +28 +28 +28 +27 +27 +26 +28 +28 +26 +21 +25 +28 +26 +142 +150 +150 +93 +148 +33 +150 +142 +146 +150 +150 +150 +142 +138 +71 +149 +150 +21 +142 +29 +148 +150 +150 +150 +146 +146 +150 +150 +146 +90 +146 +150 +101 +142 +142 +142 +146 +142 +142 +150 +146 +52 +148 +146 +150 +150 +62 +146 +142 +69 +69 +146 +58 +146 +150 +146 +146 +78 +94 +104 +143 +146 +146 +146 +146 +142 +150 +105 +50 +142 +150 +142 +145 +147 +150 +146 +142 +138 +150 +148 +150 +150 +150 +150 +146 +142 +150 +21 +150 +150 +134 +56 +31 +35 +142 +52 +150 +150 +150 +150 +150 +150 +146 +150 +150 +142 +146 +150 +150 +146 +150 +21 +150 +150 +146 +150 +146 +28 +142 +65 +150 +54 +146 +150 +150 +150 +146 +150 +150 +150 +150 +41 +146 +146 +150 +21 +150 +65 +138 +141 +150 +57 +147 +142 +150 +150 +146 +146 +146 +146 +60 +91 +146 +148 +147 +150 +150 +24 +105 +83 +150 +150 +150 +142 +142 +150 +27 +32 +40 +33 +51 +26 +41 +146 +52 +150 +150 +150 +146 +150 +146 +150 +46 +150 +33 +150 +146 +146 +40 +142 +150 +150 +147 +150 +49 +142 +146 +150 +150 +145 +146 +146 +146 +86 +60 +150 +59 +75 +79 +47 +150 +94 +45 +150 +150 +150 +150 +150 +68 +146 +42 +144 +146 +150 +150 +21 +150 +150 +121 +92 +86 +59 +150 +150 +146 +150 +26 +146 +146 +144 +146 +40 +136 +150 +150 +61 +146 +150 +39 +41 +51 +65 +43 +146 +146 +150 +37 +55 +148 +46 +148 +55 +150 +142 +142 +146 +146 +57 +150 +43 +35 +37 +150 +150 +150 +150 +146 +146 +150 +150 +150 +150 +68 +47 +136 +74 +61 +51 +121 +58 +32 +47 +150 +142 +150 +23 +142 +30 +123 +130 +146 +138 +150 +44 +144 +150 +150 +21 +64 +138 +43 +41 +86 +150 +56 +146 +150 +150 +21 +150 +21 +150 +143 +34 +150 +148 +148 +136 +150 +22 +150 +150 +150 +146 +146 +21 +150 +150 +31 +146 +150 +28 +148 +150 +150 +150 +150 +150 +150 +24 +32 +150 +146 +43 +142 +150 +142 +150 +150 +34 +150 +148 +150 +150 +146 +71 +148 +142 +150 +147 +142 +22 +63 +144 +150 +150 +81 +73 +150 +35 +34 +146 +146 +68 +74 +150 +146 +150 +58 +42 +150 +150 +150 +39 +30 +30 +21 +145 +108 +52 +150 +150 +146 +150 +146 +150 +142 +26 +146 +150 +150 +150 +148 +150 +146 +45 +150 +33 +144 +150 +34 +146 +146 +150 +146 +142 +150 +150 +146 +149 +150 +150 +150 +36 +150 +150 +150 +148 +146 +150 +146 +146 +146 +146 +42 +146 +94 +80 +30 +95 +95 +95 +99 +89 +78 +150 +25 +150 +150 +146 +126 +139 +43 +150 +146 +150 +21 +146 +146 +146 +150 +127 +100 +150 +143 +146 +150 +150 +150 +28 +146 +142 +146 +148 +150 +60 +56 +150 +150 +146 +142 +54 +146 +150 +22 +150 +142 +108 +37 +24 +45 +126 +150 +146 +22 +146 +146 +146 +150 +150 +130 +150 +30 +150 +32 +150 +150 +52 +150 +57 +150 +150 +150 +150 +142 +142 +42 +40 +58 +150 +146 +148 +146 +150 +146 +150 +150 +146 +142 +146 +23 +150 +150 +138 +150 +146 +97 +98 +100 +96 +98 +150 +150 +150 +46 +28 +146 +146 +150 +150 +146 +150 +146 +146 +142 +150 +44 +35 +59 +146 +150 +26 +142 +126 +146 +150 +150 +21 +21 +146 +150 +150 +150 +22 +146 +144 +125 +146 +146 +146 +150 +150 +146 +150 +28 +28 +22 +150 +29 +31 +25 +25 +25 +25 +25 +25 +25 +25 +25 +27 +22 +26 +22 +27 +24 +21 +21 +22 +22 +22 +27 +21 +23 +27 +25 +25 +22 +23 +23 +23 +22 +25 +25 +25 +25 +150 +146 +146 +150 +146 +146 +150 +139 +108 +145 +142 +146 +28 +147 +60 +150 +146 +142 +142 +150 +150 +150 +146 +150 +66 +55 +32 +34 +63 +55 +40 +53 +22 +22 +24 +23 +25 +25 +25 +25 +21 +25 +84 +138 +28 +147 +150 +146 +150 +148 +138 +145 +150 +32 +150 +150 +36 +140 +150 +150 +150 +150 +150 +43 +146 +150 +150 +72 +142 +150 +150 +150 +150 +42 +40 +23 +31 +56 +124 +150 +21 +22 +22 +148 +150 +21 +21 +146 +150 +150 +150 +146 +150 +146 +148 +40 +146 +150 +150 +50 +146 +150 +146 +150 +150 +146 +146 +148 +150 +27 +29 +146 +57 +142 +146 +33 +51 +42 +150 +56 +45 +150 +32 +146 +142 +150 +150 +150 +26 +146 +150 +150 +150 +150 +150 +142 +150 +22 +112 +125 +150 +150 +146 +146 +150 +150 +150 +150 +78 +150 +150 +150 +150 +150 +146 +146 +146 +150 +146 +150 +150 +150 +21 +150 +150 +146 +146 +44 +75 +150 +107 +146 +146 +146 +150 +150 +150 +22 +150 +146 +21 +149 +146 +150 +142 +144 +146 +41 +97 +98 +98 +146 +91 +111 +150 +146 +146 +112 +135 +142 +150 +146 +150 +150 +21 +146 +78 +54 +150 +138 +79 +146 +150 +150 +150 +142 +150 +61 +150 +32 +130 +146 +21 +146 +150 +146 +150 +150 +21 +49 +122 +150 +146 +150 +143 +142 +22 +146 +146 +150 +42 +150 +150 +146 +138 +150 +65 +146 +73 +146 +150 +146 +146 +142 +150 +150 +146 +129 +112 +95 +85 +71 +64 +59 +46 +37 +35 +147 +96 +93 +88 +82 +74 +27 +23 +21 +150 +146 +146 +146 +127 +142 +146 +33 +150 +146 +149 +146 +41 +150 +150 +21 +150 +150 +146 +146 +35 +146 +150 +146 +146 +146 +24 +150 +26 +146 +150 +150 +150 +150 +150 +150 +150 +77 +146 +146 +146 +148 +142 +150 +145 +146 +146 +150 +45 +146 +150 +150 +31 +148 +150 +138 +150 +150 +141 +146 +150 +150 +150 +146 +146 +149 +146 +53 +150 +150 +150 +150 +148 +150 +150 +23 +150 +146 +150 +150 +48 +54 +97 +150 +142 +150 +150 +64 +148 +146 +45 +146 +150 +21 +150 +150 +146 +146 +138 +146 +150 +146 +146 +146 +150 +52 +150 +54 +150 +150 +142 +150 +150 +150 +146 +25 +146 +150 +41 +146 +147 +24 +146 +150 +140 +33 +146 +142 +142 +72 +109 +142 +148 +74 +34 +150 +145 +24 +115 +47 +146 +150 +52 +109 +47 +148 +56 +148 +22 +24 +21 +150 +22 +24 +22 +23 +23 +24 +23 +24 +24 +142 +146 +146 +150 +144 +66 +150 +87 +44 +57 +146 +37 +144 +146 +150 +146 +146 +150 +148 +146 +150 +138 +22 +150 +68 +93 +37 +146 +142 +35 +148 +40 +68 +142 +111 +97 +108 +94 +89 +62 +56 +40 +150 +150 +146 +150 +150 +54 +83 +36 +113 +133 +77 +150 +150 +142 +150 +144 +23 +24 +150 +146 +150 +150 +143 +150 +146 +150 +25 +49 +73 +146 +150 +150 +146 +126 +96 +123 +148 +146 +146 +150 +150 +150 +150 +150 +146 +146 +142 +150 +150 +62 +67 +150 +150 +86 +146 +146 +150 +150 +150 +146 +146 +146 +150 +142 +53 +53 +104 +85 +88 +78 +150 +147 +146 +150 +146 +146 +146 +150 +150 +142 +150 +150 +135 +116 +150 +150 +138 +142 +150 +150 +150 +150 +150 +150 +146 +150 +150 +150 +150 +146 +23 +24 +24 +66 +53 +150 +146 +150 +74 +102 +146 +146 +146 +146 +146 +77 +115 +150 +30 +150 +33 +150 +150 +142 +146 +150 +150 +22 +145 +31 +148 +96 +67 +88 +146 +146 +150 +150 +150 +148 +146 +146 +21 +36 +146 +51 +150 +146 +146 +150 +56 +36 +149 +146 +73 +32 +146 +99 +148 +22 +22 +150 +150 +150 +108 +41 +146 +146 +150 +146 +22 +150 +69 +43 +150 +31 +73 +146 +26 +150 +150 +150 +142 +146 +142 +146 +146 +21 +31 +148 +150 +146 +146 +150 +150 +150 +147 +148 +21 +150 +150 +150 +146 +150 +75 +144 +146 +150 +150 +23 +118 +91 +150 +142 +150 +146 +133 +142 +150 +24 +136 +73 +150 +22 +22 +150 +150 +100 +46 +64 +150 +146 +150 +146 +148 +90 +146 +35 +150 +25 +35 +146 +146 +21 +150 +142 +150 +150 +150 +146 +148 +144 +150 +96 +146 +86 +144 +103 +115 +21 +150 +146 +147 +150 +150 +150 +35 +150 +58 +32 +55 +45 +142 +150 +148 +150 +146 +146 +110 +58 +150 +146 +146 +150 +150 +139 +21 +142 +146 +142 +150 +150 +150 +150 +142 +38 +146 +150 +22 +146 +146 +54 +148 +31 +146 +148 +146 +150 +150 +146 +146 +150 +74 +91 +138 +150 +47 +150 +146 +146 +146 +146 +23 +150 +38 +61 +40 +30 +147 +21 +85 +133 +86 +83 +77 +73 +138 +148 +150 +74 +69 +66 +61 +55 +150 +150 +146 +148 +150 +146 +146 +146 +150 +142 +30 +26 +150 +142 +146 +150 +21 +150 +142 +146 +146 +150 +22 +22 +142 +150 +146 +150 +150 +150 +146 +150 +150 +150 +128 +150 +108 +146 +139 +150 +150 +146 +148 +150 +21 +150 +142 +150 +150 +42 +40 +27 +94 +142 +150 +150 +27 +58 +67 +85 +150 +150 +140 +150 +150 +146 +142 +142 +150 +143 +47 +148 +126 +150 +145 +150 +150 +150 +150 +150 +146 +150 +150 +84 +120 +148 +148 +100 +146 +21 +150 +150 +22 +146 +131 +105 +150 +150 +150 +142 +142 +150 +122 +21 +146 +146 +150 +146 +86 +97 +76 +150 +146 +146 +146 +146 +142 +98 +89 +150 +146 +37 +41 +53 +50 +51 +41 +57 +53 +49 +28 +46 +54 +42 +41 +42 +49 +46 +41 +44 +35 +48 +37 +24 +38 +47 +21 +30 +45 +45 +38 +33 +44 +43 +48 +48 +48 +45 +40 +45 +31 +41 +45 +37 +43 +41 +39 +36 +48 +29 +46 +74 +146 +108 +62 +71 +36 +47 +70 +52 +70 +47 +64 +47 +63 +75 +58 +47 +56 +59 +48 +72 +53 +68 +85 +30 +71 +68 +69 +73 +76 +66 +73 +68 +62 +43 +41 +61 +72 +93 +64 +65 +23 +58 +75 +122 +86 +93 +89 +126 +72 +51 +24 +63 +84 +109 +56 +88 +150 +90 +96 +146 +150 +146 +146 +50 +71 +109 +150 +146 +144 +71 +21 +150 +142 +146 +146 +22 +23 +142 +22 +23 +23 +23 +22 +23 +150 +21 +150 +150 +146 +146 +125 +150 +150 +146 +150 +150 +76 +120 +150 +146 +150 +146 +150 +150 +21 +150 +146 +146 +61 +84 +150 +146 +145 +150 +150 +21 +146 +22 +21 +21 +22 +53 +22 +21 +22 +150 +24 +21 +22 +22 +23 +23 +23 +23 +23 +23 +142 +146 +144 +90 +147 +150 +150 +146 +146 +150 +150 +145 +33 +102 +146 +44 +146 +146 +147 +146 +150 +150 +148 +150 +142 +148 +140 +42 +25 +54 +147 +146 +150 +146 +138 +150 +30 +28 +34 +28 +32 +133 +150 +150 +150 +150 +35 +23 +30 +88 +143 +150 +150 +146 +150 +146 +150 +146 +150 +150 +146 +150 +150 +150 +150 +150 +146 +150 +150 +150 +150 +150 +146 +146 +148 +142 +80 +150 +150 +36 +148 +150 +148 +148 +150 +146 +21 +150 +146 +146 +142 +150 +150 +150 +150 +142 +150 +138 +32 +31 +34 +36 +27 +34 +32 +27 +34 +34 +31 +30 +34 +27 +37 +31 +24 +35 +36 +30 +39 +30 +34 +35 +40 +34 +28 +31 +32 +28 +31 +31 +31 +30 +32 +23 +23 +24 +28 +34 +32 +31 +29 +22 +34 +31 +35 +28 +32 +150 +82 +104 +138 +94 +74 +126 +97 +66 +51 +21 +28 +146 +70 +104 +82 +47 +79 +56 +38 +146 +138 +146 +146 +150 +23 +23 +42 +150 +150 +146 +146 +142 +150 +95 +68 +142 +150 +142 +150 +146 +23 +24 +146 +150 +150 +150 +51 +150 +150 +150 +150 +150 +29 +150 +142 +150 +150 +142 +69 +150 +150 +150 +150 +150 +150 +96 +150 +146 +146 +146 +45 +83 +150 +150 +138 +146 +26 +142 +21 +142 +149 +150 +139 +146 +146 +146 +143 +150 +146 +150 +146 +49 +145 +21 +60 +122 +150 +116 +82 +46 +98 +88 +150 +150 +146 +150 +146 +142 +62 +88 +62 +89 +146 +21 +54 +36 +146 +54 +150 +138 +102 +21 +142 +150 +150 +146 +150 +150 +150 +23 +150 +150 +142 +146 +150 +150 +142 +150 +150 +150 +150 +142 +150 +146 +146 +21 +150 +21 +21 +35 +150 +150 +51 +150 +150 +74 +90 +120 +146 +150 +146 +150 +150 +142 +150 +150 +150 +32 +134 +150 +150 +150 +150 +27 +142 +142 +149 +142 +146 +150 +150 +26 +25 +25 +26 +24 +27 +26 +22 +30 +23 +26 +23 +23 +24 +23 +26 +26 +21 +24 +24 +150 +21 +48 +26 +48 +32 +37 +41 +26 +37 +45 +45 +45 +24 +41 +40 +44 +21 +35 +44 +43 +42 +34 +47 +45 +42 +44 +42 +42 +30 +48 +37 +42 +46 +45 +34 +32 +29 +150 +143 +149 +150 +150 +142 +21 +150 +150 +150 +138 +150 +150 +146 +92 +150 +150 +150 +142 +146 +39 +21 +150 +123 +150 +150 +150 +148 +144 +150 +82 +126 +96 +150 +150 +146 +150 +146 +23 +28 +146 +63 +91 +150 +98 +114 +145 +23 +45 +51 +146 +150 +150 +150 +146 +100 +42 +26 +150 +150 +146 +142 +150 +138 +72 +144 +23 +150 +150 +150 +150 +150 +150 +146 +142 +56 +148 +150 +146 +150 +142 +142 +150 +150 +150 +142 +150 +150 +150 +150 +142 +146 +142 +146 +150 +150 +150 +150 +150 +23 +146 +135 +50 +37 +148 +150 +146 +142 +146 +25 +25 +23 +23 +24 +23 +24 +23 +21 +24 +22 +24 +21 +24 +31 +29 +25 +31 +28 +29 +24 +24 +29 +30 +30 +24 +28 +27 +29 +24 +27 +27 +79 +134 +74 +142 +119 +106 +86 +64 +71 +51 +51 +49 +49 +47 +46 +43 +43 +40 +40 +30 +150 +150 +100 +150 +150 +148 +150 +146 +146 +146 +138 +146 +150 +146 +150 +146 +33 +150 +90 +54 +54 +47 +150 +45 +35 +39 +39 +39 +38 +149 +53 +146 +39 +144 +150 +150 +36 +36 +36 +36 +35 +136 +34 +35 +37 +26 +90 +94 +78 +90 +98 +56 +31 +33 +40 +32 +43 +27 +33 +36 +23 +146 +142 +146 +146 +138 +142 +22 +150 +49 +93 +140 +150 +150 +146 +146 +142 +150 +150 +150 +150 +146 +146 +146 +150 +150 +142 +150 +150 +150 +150 +150 +142 +148 +150 +79 +100 +150 +150 +35 +148 +80 +92 +88 +90 +78 +149 +146 +150 +150 +144 +150 +142 +150 +150 +146 +150 +150 +138 +150 +146 +150 +146 +150 +23 +150 +146 +145 +142 +150 +150 +150 +146 +146 +150 +25 +150 +108 +24 +23 +142 +150 +150 +150 +146 +73 +89 +142 +150 +150 +146 +146 +54 +148 +150 +142 +150 +142 +56 +32 +25 +100 +71 +53 +150 +40 +150 +100 +127 +150 +146 +76 +121 +143 +150 +150 +150 +146 +150 +150 +46 +94 +103 +145 +46 +94 +150 +146 +146 +150 +146 +134 +146 +148 +150 +23 +150 +150 +148 +22 +142 +130 +41 +150 +87 +150 +132 +146 +146 +150 +150 +150 +21 +148 +150 +141 +58 +132 +138 +45 +134 +150 +94 +91 +100 +76 +76 +74 +74 +72 +71 +68 +68 +65 +65 +55 +49 +146 +22 +32 +28 +36 +30 +26 +28 +26 +23 +24 +26 +29 +23 +25 +32 +22 +24 +24 +24 +24 +24 +31 +23 +22 +22 +22 +22 +22 +22 +146 +150 +148 +150 +146 +35 +146 +148 +142 +149 +146 +150 +148 +146 +150 +140 +146 +37 +148 +150 +150 +150 +150 +146 +150 +90 +145 +142 +150 +150 +100 +98 +147 +37 +148 +129 +61 +88 +146 +69 +133 +146 +146 +150 +108 +146 +150 +121 +21 +150 +102 +21 +21 +25 +150 +146 +146 +150 +150 +150 +150 +62 +150 +98 +94 +90 +87 +83 +150 +146 +150 +140 +61 +138 +84 +146 +150 +150 +56 +59 +92 +57 +56 +56 +39 +48 +35 +49 +35 +35 +32 +22 +38 +146 +34 +72 +111 +72 +43 +49 +42 +136 +121 +150 +150 +33 +128 +78 +74 +21 +21 +142 +91 +89 +150 +81 +82 +101 +138 +150 +147 +150 +142 +46 +90 +150 +48 +60 +39 +144 +143 +68 +150 +150 +148 +150 +150 +143 +146 +87 +58 +148 +83 +146 +144 +21 +146 +146 +150 +22 +56 +146 +53 +35 +150 +144 +150 +150 +146 +142 +146 +150 +148 +150 +142 +146 +150 +146 +146 +150 +150 +150 +37 +39 +43 +37 +25 +47 +37 +39 +38 +46 +40 +43 +53 +49 +45 +42 +50 +41 +35 +55 +39 +38 +36 +62 +66 +41 +51 +39 +49 +46 +32 +53 +30 +34 +41 +47 +30 +48 +30 +34 +28 +47 +45 +28 +33 +34 +50 +43 +29 +46 +26 +150 +150 +150 +146 +150 +146 +146 +150 +146 +150 +48 +137 +150 +76 +146 +47 +28 +150 +146 +147 +150 +150 +48 +150 +87 +150 +146 +57 +144 +93 +146 +86 +149 +67 +146 +119 +121 +146 +146 +24 +21 +150 +101 +29 +24 +21 +58 +150 +150 +146 +146 +146 +148 +97 +150 +150 +150 +146 +143 +150 +146 +98 +150 +127 +142 +73 +148 +150 +150 +42 +42 +38 +54 +53 +53 +37 +39 +42 +47 +44 +38 +47 +48 +51 +45 +37 +38 +41 +134 +40 +41 +48 +43 +52 +53 +48 +54 +52 +46 +47 +38 +47 +53 +41 +38 +37 +42 +38 +40 +150 +150 +97 +39 +150 +150 +150 +142 +103 +150 +150 +142 +71 +87 +144 +150 +150 +150 +150 +150 +146 +21 +21 +24 +25 +23 +26 +26 +22 +22 +22 +22 +21 +23 +21 +150 +150 +150 +28 +31 +150 +138 +56 +150 +146 +142 +150 +44 +150 +69 +69 +67 +45 +77 +64 +81 +76 +66 +69 +69 +64 +62 +40 +68 +40 +49 +74 +39 +52 +49 +42 +44 +63 +39 +54 +55 +64 +29 +50 +62 +61 +70 +49 +36 +51 +68 +45 +44 +52 +53 +60 +67 +144 +150 +43 +150 +150 +146 +146 +150 +142 +146 +150 +138 +146 +21 +21 +150 +21 +150 +150 +142 +146 +150 +59 +142 +89 +26 +90 +146 +150 +66 +150 +150 +150 +146 +150 +150 +22 +44 +144 +130 +150 +142 +150 +59 +150 +150 +86 +93 +31 +146 +146 +32 +124 +109 +146 +21 +133 +142 +146 +142 +147 +150 +142 +22 +146 +129 +100 +74 +72 +61 +102 +60 +62 +77 +80 +150 +97 +59 +41 +30 +150 +142 +29 +142 +146 +150 +150 +148 +146 +150 +150 +28 +48 +147 +89 +136 +150 +148 +150 +150 +146 +150 +150 +22 +150 +150 +146 +146 +150 +22 +142 +150 +146 +149 +150 +146 +57 +32 +150 +150 +150 +25 +25 +25 +25 +25 +21 +24 +24 +24 +25 +26 +22 +26 +25 +26 +26 +22 +26 +25 +27 +25 +25 +25 +25 +22 +22 +22 +22 +22 +21 +21 +22 +28 +21 +28 +27 +27 +27 +27 +27 +27 +34 +24 +30 +24 +26 +30 +24 +24 +29 +136 +25 +25 +25 +24 +24 +24 +25 +24 +24 +24 +25 +24 +24 +24 +23 +23 +23 +22 +23 +23 +22 +22 +22 +22 +150 +140 +142 +150 +146 +146 +21 +146 +150 +148 +150 +146 +146 +150 +76 +41 +68 +46 +146 +26 +59 +84 +40 +148 +150 +150 +150 +146 +150 +146 +146 +150 +150 +68 +146 +82 +106 +150 +150 +150 +142 +146 +88 +147 +115 +120 +148 +146 +150 +150 +59 +62 +150 +150 +146 +150 +146 +150 +146 +144 +22 +146 +150 +146 +27 +34 +33 +30 +28 +31 +30 +31 +38 +29 +29 +25 +25 +32 +28 +33 +28 +34 +28 +105 +101 +88 +21 +49 +58 +31 +48 +36 +32 +37 +36 +41 +44 +30 +38 +37 +33 +38 +41 +41 +45 +24 +37 +37 +47 +50 +41 +45 +56 +47 +30 +30 +37 +35 +39 +32 +33 +29 +38 +34 +47 +35 +42 +41 +150 +146 +150 +129 +146 +78 +23 +145 +89 +96 +84 +69 +100 +67 +21 +44 +27 +141 +67 +55 +144 +148 +146 +146 +150 +150 +150 +150 +146 +150 +150 +142 +146 +150 +148 +146 +150 +146 +143 +150 +141 +142 +24 +150 +24 +150 +146 +150 +89 +150 +150 +146 +146 +27 +25 +25 +24 +27 +26 +24 +27 +22 +22 +21 +25 +24 +22 +27 +27 +27 +27 +27 +27 +146 +150 +150 +27 +150 +23 +23 +23 +146 +29 +118 +140 +34 +35 +37 +26 +98 +98 +82 +98 +106 +52 +35 +37 +35 +33 +40 +31 +33 +39 +23 +27 +146 +148 +150 +150 +149 +45 +32 +38 +54 +25 +44 +26 +37 +37 +33 +23 +29 +37 +37 +33 +30 +37 +38 +25 +29 +30 +33 +48 +31 +33 +37 +54 +29 +41 +43 +42 +28 +28 +26 +23 +26 +23 +25 +150 +56 +91 +150 +150 +146 +150 +150 +150 +150 +142 +150 +61 +96 +101 +37 +38 +58 +55 +134 +95 +101 +96 +72 +63 +116 +98 +101 +82 +27 +35 +146 +150 +150 +76 +136 +150 +150 +68 +97 +32 +78 +95 +63 +73 +146 +30 +23 +93 +150 +54 +67 +150 +122 +146 +150 +150 +142 +150 +142 +150 +40 +48 +50 +55 +52 +58 +55 +46 +54 +50 +52 +45 +41 +37 +31 +38 +62 +44 +54 +42 +150 +48 +54 +54 +52 +54 +62 +45 +58 +47 +38 +40 +38 +47 +30 +47 +56 +52 +41 +150 +146 +57 +144 +150 +142 +141 +150 +150 +148 +150 +150 +150 +150 +150 +146 +82 +62 +126 +75 +73 +58 +48 +146 +98 +29 +104 +92 +66 +65 +68 +30 +150 +150 +21 +139 +146 +146 +150 +150 +150 +150 +150 +150 +138 +146 +150 +43 +146 +150 +144 +150 +40 +34 +22 +22 +37 +23 +22 +22 +33 +28 +41 +25 +24 +27 +41 +32 +32 +33 +37 +24 +109 +30 +31 +31 +33 +43 +25 +25 +148 +146 +150 +150 +150 +142 +142 +150 +140 +122 +142 +42 +144 +150 +147 +78 +60 +150 +21 +150 +125 +60 +52 +49 +100 +85 +82 +125 +85 +93 +55 +45 +133 +38 +34 +57 +57 +51 +51 +150 +146 +23 +21 +21 +30 +150 +146 +142 +146 +146 +150 +150 +150 +150 +150 +146 +138 +146 +146 +146 +146 +133 +53 +148 +148 +142 +46 +43 +34 +40 +71 +34 +65 +46 +42 +38 +32 +41 +39 +25 +39 +35 +36 +39 +29 +39 +35 +24 +29 +37 +37 +23 +33 +33 +35 +33 +39 +39 +23 +33 +38 +31 +30 +39 +42 +35 +30 +21 +38 +35 +148 +146 +150 +146 +63 +80 +23 +146 +83 +32 +62 +47 +45 +45 +56 +150 +42 +21 +21 +21 +56 +67 +150 +150 +146 +146 +150 +146 +143 +150 +150 +110 +150 +93 +73 +150 +150 +150 +150 +146 +150 +146 +77 +41 +43 +148 +71 +69 +53 +51 +150 +147 +150 +25 +150 +134 +150 +126 +118 +23 +63 +74 +73 +52 +38 +44 +42 +75 +33 +75 +62 +53 +28 +135 +150 +88 +116 +68 +90 +96 +66 +35 +35 +26 +26 +150 +55 +112 +100 +64 +146 +150 +98 +101 +98 +52 +150 +79 +47 +150 +60 +146 +58 +146 +150 +146 +150 +150 +150 +23 +126 +150 +146 +146 +150 +146 +150 +150 +146 +146 +150 +150 +150 +150 +150 +150 +146 +150 +146 +150 +142 +74 +85 +142 +150 +76 +150 +143 +145 +150 +146 +146 +146 +150 +150 +150 +148 +150 +146 +150 +150 +142 +146 +36 +103 +142 +150 +146 +150 +35 +53 +38 +43 +56 +41 +33 +32 +41 +27 +47 +38 +51 +29 +28 +146 +138 +142 +150 +81 +150 +142 +150 +150 +146 +150 +150 +150 +146 +150 +44 +24 +150 +25 +96 +150 +22 +103 +68 +146 +146 +82 +150 +150 +24 +150 +25 +146 +146 +150 +150 +150 +22 +141 +150 +146 +146 +146 +146 +142 +110 +146 +150 +146 +146 +142 +84 +150 +148 +74 +146 +142 +83 +146 +150 +150 +146 +150 +21 +146 +91 +129 +21 +146 +31 +24 +24 +23 +27 +26 +23 +27 +26 +28 +30 +28 +26 +27 +30 +22 +25 +27 +24 +24 +21 +38 +33 +38 +31 +101 +118 +150 +146 +146 +142 +150 +150 +146 +140 +150 +89 +150 +69 +48 +42 +150 +76 +59 +95 +142 +150 +150 +150 +150 +143 +150 +142 +150 +150 +142 +150 +150 +150 +142 +146 +146 +22 +147 +142 +150 +146 +148 +148 +141 +150 +146 +150 +63 +100 +150 +150 +22 +150 +113 +146 +70 +48 +100 +150 +150 +150 +142 +150 +150 +146 +96 +29 +32 +27 +28 +24 +27 +28 +27 +27 +28 +28 +25 +27 +23 +26 +25 +26 +22 +26 +23 +25 +24 +24 +25 +24 +24 +31 +30 +26 +150 +146 +150 +38 +74 +50 +62 +62 +60 +23 +54 +36 +44 +47 +51 +65 +38 +150 +45 +34 +34 +56 +38 +52 +68 +38 +46 +84 +77 +76 +76 +83 +85 +66 +58 +71 +36 +37 +43 +47 +39 +37 +45 +44 +43 +39 +38 +38 +37 +42 +43 +41 +29 +46 +32 +58 +78 +42 +62 +31 +31 +35 +42 +33 +39 +34 +58 +70 +35 +21 +150 +146 +150 +150 +146 +150 +146 +150 +150 +22 +150 +146 +150 +142 +146 +150 +150 +150 +145 +149 +150 +150 +142 +150 +150 +34 +150 +48 +47 +37 +42 +50 +150 +49 +37 +38 +41 +48 +86 +42 +55 +46 +38 +39 +44 +48 +50 +47 +142 +93 +54 +42 +38 +44 +43 +49 +48 +50 +37 +50 +41 +45 +42 +42 +40 +42 +148 +150 +146 +150 +150 +150 +89 +23 +150 +150 +146 +146 +150 +146 +150 +142 +124 +124 +104 +150 +147 +150 +21 +21 +150 +148 +146 +48 +43 +45 +38 +47 +43 +48 +38 +53 +30 +44 +41 +46 +37 +37 +39 +46 +44 +49 +142 +41 +40 +40 +42 +41 +39 +39 +38 +38 +40 +37 +37 +39 +38 +38 +30 +39 +150 +150 +150 +146 +146 +150 +150 +150 +150 +79 +21 +72 +150 +150 +150 +134 +79 +127 +150 +150 +150 +148 +27 +93 +78 +150 +146 +27 +27 +27 +27 +31 +26 +27 +27 +26 +26 +26 +24 +23 +26 +25 +21 +25 +24 +21 +26 +22 +26 +21 +23 +146 +150 +150 +150 +146 +146 +22 +146 +150 +150 +138 +150 +142 +150 +146 +150 +30 +47 +150 +148 +106 +142 +146 +150 +146 +142 +148 +148 +64 +146 +146 +144 +124 +140 +148 +150 +150 +150 +150 +150 +150 +150 +150 +80 +49 +150 +150 +142 +150 +150 +150 +43 +31 +33 +28 +59 +21 +45 +36 +44 +32 +37 +31 +30 +24 +32 +52 +35 +35 +34 +33 +23 +41 +36 +24 +42 +79 +150 +37 +46 +76 +26 +26 +33 +33 +26 +33 +26 +28 +32 +25 +27 +32 +32 +32 +25 +29 +27 +26 +23 +23 +29 +31 +31 +31 +29 +28 +29 +29 +28 +28 +146 +140 +31 +150 +146 +146 +150 +150 +150 +150 +150 +30 +57 +150 +146 +146 +150 +146 +146 +126 +127 +95 +112 +124 +146 +65 +101 +142 +87 +61 +148 +73 +26 +24 +146 +37 +24 +29 +26 +142 +26 +22 +22 +146 +150 +21 +150 +150 +150 +142 +146 +144 +40 +41 +36 +29 +22 +43 +32 +22 +24 +40 +29 +33 +33 +37 +35 +27 +39 +41 +44 +53 +43 +31 +40 +44 +32 +32 +34 +26 +32 +36 +33 +26 +32 +37 +32 +33 +23 +27 +30 +36 +39 +31 +29 +41 +45 +24 +41 +37 +41 +144 +111 +36 +109 +146 +150 +146 +142 +146 +21 +21 +87 +80 +116 +110 +84 +144 +61 +150 +146 +150 +150 +142 +150 +150 +21 +150 +139 +43 +79 +84 +81 +81 +56 +150 +92 +86 +42 +150 +148 +150 +146 +150 +150 +142 +146 +150 +142 +146 +146 +150 +150 +56 +50 +48 +44 +37 +43 +46 +46 +42 +34 +28 +47 +38 +42 +34 +42 +33 +39 +39 +39 +33 +39 +35 +24 +29 +37 +37 +33 +47 +29 +23 +48 +42 +39 +36 +39 +54 +35 +46 +25 +69 +32 +38 +36 +44 +146 +38 +125 +41 +146 +42 +64 +60 +66 +146 +146 +150 +146 +39 +148 +65 +150 +142 +150 +150 +150 +54 +142 +150 +150 +146 +150 +150 +150 +146 +150 +21 +150 +150 +146 +35 +150 +83 +76 +150 +146 +146 +146 +138 +150 +142 +146 +150 +146 +150 +142 +150 +146 +43 +24 +25 +24 +24 +27 +24 +22 +22 +22 +95 +102 +97 +95 +146 +126 +97 +71 +47 +146 +150 +146 +150 +150 +150 +138 +147 +150 +146 +150 +142 +146 +146 +146 +52 +142 +146 +148 +150 +150 +150 +148 +150 +150 +150 +21 +150 +39 +35 +55 +39 +39 +35 +65 +49 +61 +39 +35 +31 +48 +148 +33 +33 +33 +55 +65 +54 +54 +41 +58 +58 +54 +58 +50 +37 +43 +56 +41 +56 +84 +147 +148 +121 +146 +150 +150 +146 +144 +150 +141 +150 +146 +146 +150 +146 +146 +150 +146 +146 +150 +39 +150 +150 +150 +22 +21 +146 +146 +134 +150 +146 +138 +150 +21 +150 +150 +150 +102 +46 +148 +150 +51 +67 +100 +79 +150 +146 +146 +150 +56 +112 +108 +21 +51 +46 +71 +91 +150 +97 +98 +56 +150 +142 +36 +132 +102 +98 +97 +95 +95 +93 +89 +86 +76 +74 +70 +61 +59 +55 +50 +36 +42 +150 +93 +91 +87 +85 +78 +73 +46 +41 +31 +28 +24 +146 +150 +143 +140 +150 +150 +144 +142 +150 +28 +150 +30 +29 +22 +25 +107 +148 +150 +146 +27 +146 +150 +146 +119 +150 +150 +139 +99 +35 +41 +146 +150 +146 +144 +44 +150 +148 +146 +148 +142 +21 +146 +23 +40 +140 +150 +150 +150 +150 +150 +44 +84 +32 +21 +149 +21 +21 +98 +97 +97 +61 +22 +122 +106 +57 +35 +81 +126 +89 +100 +91 +69 +54 +51 +28 +27 +138 +131 +36 +127 +65 +67 +53 +50 +38 +150 +150 +142 +150 +150 +147 +149 +71 +142 +142 +146 +50 +61 +146 +149 +30 +23 +93 +142 +150 +150 +61 +144 +146 +146 +67 +150 +150 +150 +146 +146 +150 +150 +128 +52 +138 +46 +150 +148 +150 +150 +146 +139 +21 +103 +65 +150 +150 +150 +150 +138 +146 +29 +29 +25 +27 +29 +30 +29 +30 +31 +30 +23 +22 +24 +23 +24 +24 +21 +26 +27 +24 +25 +24 +22 +21 +23 +23 +23 +21 +22 +23 +25 +21 +22 +23 +150 +148 +143 +146 +132 +150 +150 +146 +150 +150 +142 +146 +145 +120 +142 +22 +149 +150 +150 +143 +146 +150 +146 +150 +55 +146 +94 +65 +67 +146 +150 +138 +150 +150 +142 +150 +150 +150 +49 +30 +28 +146 +150 +146 +22 +88 +77 +150 +150 +83 +91 +90 +34 +34 +77 +34 +150 +41 +55 +57 +50 +113 +146 +146 +146 +26 +129 +149 +146 +146 +23 +30 +30 +150 +142 +142 +145 +138 +150 +150 +21 +26 +22 +22 +21 +150 +24 +25 +24 +29 +21 +150 +146 +97 +142 +144 +150 +22 +150 +73 +65 +30 +150 +100 +150 +146 +150 +150 +138 +58 +57 +53 +41 +52 +54 +56 +59 +49 +52 +48 +48 +59 +38 +46 +56 +39 +31 +53 +21 +58 +138 +40 +38 +39 +41 +38 +37 +37 +39 +37 +41 +37 +41 +44 +39 +40 +37 +38 +40 +42 +52 +31 +142 +144 +146 +22 +22 +146 +146 +149 +150 +150 +150 +21 +24 +142 +143 +150 +70 +46 +150 +150 +146 +146 +150 +146 +150 +150 +146 +150 +26 +150 +91 +91 +150 +32 +150 +146 +96 +150 +150 +150 +150 +146 +150 +146 +80 +85 +146 +150 +27 +24 +24 +24 +22 +23 +24 +22 +21 +49 +21 +150 +150 +146 +150 +148 +146 +150 +150 +100 +25 +150 +150 +144 +150 +150 +22 +23 +23 +23 +23 +31 +30 +22 +26 +27 +26 +26 +26 +26 +150 +98 +102 +148 +142 +57 +64 +41 +40 +103 +57 +99 +140 +116 +134 +105 +92 +74 +80 +72 +68 +56 +57 +150 +33 +144 +150 +146 +146 +150 +150 +146 +146 +146 +22 +150 +83 +148 +150 +150 +150 +150 +148 +58 +148 +57 +150 +130 +150 +150 +146 +150 +150 +150 +146 +150 +146 +51 +36 +40 +41 +150 +48 +38 +38 +150 +142 +150 +22 +150 +150 +150 +147 +146 +146 +146 +150 +150 +150 +30 +30 +150 +150 +146 +53 +48 +47 +50 +43 +57 +39 +53 +56 +48 +38 +38 +39 +39 +46 +39 +52 +56 +38 +67 +46 +146 +44 +48 +44 +53 +38 +49 +45 +58 +40 +39 +52 +43 +39 +39 +41 +97 +42 +48 +109 +44 +146 +150 +146 +142 +150 +150 +27 +27 +27 +26 +21 +26 +28 +25 +23 +150 +58 +77 +150 +150 +142 +146 +146 +150 +40 +38 +30 +42 +28 +38 +138 +138 +43 +150 +148 +143 +46 +150 +44 +150 +40 +38 +47 +39 +39 +150 +40 +74 +43 +41 +37 +37 +142 +150 +146 +32 +23 +26 +27 +25 +29 +25 +23 +23 +150 +150 +147 +150 +150 +150 +146 +146 +41 +31 +30 +41 +33 +36 +36 +38 +37 +33 +33 +39 +39 +33 +38 +31 +24 +34 +47 +39 +30 +33 +25 +33 +39 +37 +31 +37 +38 +37 +29 +35 +41 +37 +37 +39 +40 +38 +39 +37 +41 +38 +30 +29 +38 +38 +31 +32 +38 +37 +35 +24 +24 +35 +33 +26 +150 +23 +26 +146 +60 +57 +150 +67 +38 +36 +150 +150 +146 +150 +146 +142 +148 +37 +146 +150 +150 +150 +59 +33 +55 +50 +50 +56 +54 +51 +58 +55 +50 +59 +49 +41 +39 +38 +47 +52 +49 +52 +54 +67 +55 +57 +52 +47 +57 +50 +48 +57 +48 +48 +56 +46 +38 +79 +39 +33 +51 +46 +48 +55 +150 +142 +150 +148 +150 +150 +148 +25 +146 +23 +144 +150 +128 +89 +150 +34 +31 +34 +31 +22 +25 +25 +25 +25 +25 +26 +25 +25 +25 +25 +23 +23 +23 +22 +36 +32 +39 +40 +32 +32 +39 +32 +35 +32 +31 +29 +34 +31 +34 +150 +150 +146 +143 +146 +150 +146 +150 +147 +130 +48 +110 +142 +146 +150 +134 +149 +21 +145 +146 +145 +93 +77 +150 +143 +143 +148 +140 +146 +150 +150 +150 +22 +150 +150 +146 +33 +142 +150 +146 +150 +150 +142 +146 +150 +146 +142 +146 +150 +146 +150 +146 +51 +39 +36 +83 +150 +59 +146 +150 +150 +150 +150 +62 +148 +32 +32 +32 +142 +150 +22 +145 +150 +150 +147 +150 +146 +150 +144 +150 +150 +146 +150 +150 +147 +146 +146 +150 +144 +142 +146 +146 +139 +150 +29 +23 +25 +24 +29 +25 +26 +23 +23 +27 +24 +24 +23 +21 +24 +45 +146 +41 +26 +26 +31 +29 +29 +23 +28 +40 +22 +33 +29 +24 +28 +28 +31 +24 +21 +21 +28 +32 +31 +31 +32 +27 +31 +22 +22 +29 +28 +32 +27 +36 +36 +37 +27 +28 +25 +29 +30 +128 +71 +149 +67 +150 +146 +87 +70 +85 +150 +50 +22 +95 +150 +21 +150 +146 +142 +150 +146 +146 +150 +150 +146 +142 +139 +150 +146 +98 +70 +46 +72 +72 +40 +92 +150 +109 +64 +62 +59 +53 +54 +49 +24 +50 +67 +51 +48 +56 +46 +63 +50 +54 +38 +47 +43 +48 +46 +46 +41 +38 +54 +63 +64 +54 +57 +37 +61 +26 +42 +25 +61 +65 +28 +65 +26 +28 +150 +22 +22 +26 +24 +27 +27 +24 +25 +27 +27 +25 +27 +25 +25 +25 +25 +21 +34 +25 +21 +47 +21 +21 +25 +96 +89 +25 +89 +85 +36 +88 +85 +31 +81 +85 +46 +78 +49 +73 +81 +47 +21 +146 +95 +138 +97 +110 +105 +80 +50 +54 +26 +26 +24 +24 +150 +45 +56 +50 +52 +54 +44 +37 +37 +54 +37 +44 +45 +31 +44 +60 +44 +33 +54 +40 +51 +21 +150 +45 +46 +41 +40 +39 +50 +50 +39 +59 +39 +39 +46 +48 +38 +40 +39 +38 +38 +30 +37 +146 +76 +146 +58 +37 +80 +38 +150 +150 +150 +146 +150 +150 +150 +142 +150 +21 +56 +29 +146 +146 +148 +142 +146 +150 +150 +150 +150 +44 +56 +150 +31 +77 +146 +146 +146 +138 +82 +103 +146 +146 +146 +146 +148 +146 +91 +150 +22 +146 +150 +21 +146 +150 +112 +34 +36 +33 +30 +52 +51 +53 +52 +49 +52 +51 +146 +150 +150 +114 +146 +146 +142 +142 +150 +150 +150 +68 +146 +26 +25 +43 +22 +142 +102 +150 +150 +146 +35 +24 +24 +30 +38 +31 +46 +40 +34 +40 +40 +68 +36 +39 +33 +27 +42 +60 +43 +21 +34 +44 +26 +27 +42 +22 +27 +24 +34 +27 +150 +21 +21 +21 +21 +21 +21 +150 +150 +142 +97 +86 +67 +67 +35 +67 +35 +22 +21 +146 +150 +55 +74 +22 +150 +144 +73 +146 +147 +150 +32 +144 +44 +150 +150 +59 +138 +150 +146 +127 +105 +150 +28 +81 +150 +118 +37 +150 +150 +150 +21 +21 +21 +149 +147 +150 +142 +150 +150 +146 +138 +150 +146 +150 +146 +146 +145 +150 +146 +146 +135 +150 +150 +150 +146 +142 +150 +146 +50 +146 +146 +142 +27 +30 +27 +31 +27 +27 +27 +27 +27 +27 +26 +27 +27 +25 +21 +150 +29 +29 +28 +25 +27 +22 +21 +146 +142 +142 +60 +150 +146 +146 +146 +150 +68 +146 +146 +150 +150 +23 +150 +150 +100 +95 +38 +97 +80 +142 +146 +60 +146 +35 +23 +150 +58 +40 +150 +150 +146 +150 +146 +146 +150 +21 +150 +146 +60 +137 +150 +23 +21 +146 +150 +138 +112 +148 +150 +146 +149 +86 +150 +150 +77 +150 +150 +142 +150 +81 +147 +150 +130 +34 +150 +65 +86 +150 +150 +61 +146 +142 +150 +146 +150 +146 +150 +150 +150 +21 +146 +36 +150 +80 +41 +90 +150 +150 +148 +77 +135 +142 +21 +150 +150 +150 +121 +150 +126 +142 +34 +82 +150 +150 +150 +28 +23 +150 +127 +150 +146 +146 +150 +150 +146 +51 +144 +150 +150 +142 +146 +146 +150 +142 +32 +28 +146 +150 +146 +150 +150 +150 +146 +60 +146 +146 +150 +150 +149 +150 +131 +150 +146 +142 +142 +35 +37 +71 +150 +47 +101 +130 +150 +139 +148 +35 +105 +26 +63 +122 +93 +38 +60 +67 +101 +122 +100 +55 +26 +53 +38 +35 +75 +133 +25 +119 +125 +142 +44 +59 +25 +93 +87 +80 +32 +142 +150 +68 +150 +146 +146 +146 +150 +150 +98 +22 +146 +150 +146 +150 +142 +150 +146 +150 +107 +150 +142 +142 +146 +148 +140 +150 +146 +150 +150 +150 +146 +26 +33 +29 +32 +29 +32 +22 +34 +32 +32 +32 +32 +32 +27 +31 +24 +30 +25 +29 +29 +29 +23 +29 +26 +29 +26 +25 +150 +41 +36 +38 +37 +44 +30 +39 +30 +37 +43 +41 +42 +37 +28 +37 +24 +22 +24 +32 +35 +34 +28 +38 +35 +36 +21 +36 +34 +27 +33 +28 +28 +34 +150 +146 +146 +146 +146 +146 +146 +22 +48 +60 +93 +146 +150 +150 +142 +148 +150 +146 +150 +51 +138 +22 +150 +150 +23 +21 +102 +24 +21 +43 +150 +142 +150 +150 +150 +150 +148 +142 +148 +35 +142 +150 +150 +150 +148 +150 +146 +146 +146 +150 +89 +146 +138 +150 +79 +123 +81 +150 +150 +146 +21 +150 +146 +150 +25 +146 +24 +23 +146 +150 +142 +142 +135 +52 +63 +77 +62 +87 +61 +88 +62 +48 +62 +50 +63 +69 +44 +110 +103 +48 +44 +44 +142 +133 +142 +35 +97 +35 +142 +150 +23 +146 +150 +75 +59 +24 +21 +68 +61 +138 +150 +21 +21 +24 +25 +23 +26 +26 +22 +22 +22 +22 +21 +23 +21 +146 +150 +146 +150 +149 +150 +146 +150 +138 +142 +55 +146 +146 +150 +148 +134 +47 +29 +84 +43 +30 +149 +24 +22 +37 +33 +106 +33 +26 +146 +150 +150 +150 +138 +97 +149 +150 +21 +146 +40 +36 +29 +46 +27 +54 +58 +51 +48 +33 +72 +41 +29 +25 +53 +44 +43 +41 +27 +40 +21 +47 +52 +55 +51 +56 +51 +64 +56 +44 +54 +48 +51 +42 +64 +55 +41 +52 +34 +33 +49 +40 +38 +57 +37 +33 +33 +32 +42 +44 +41 +30 +43 +39 +36 +36 +44 +41 +43 +44 +41 +33 +39 +38 +27 +32 +37 +33 +44 +29 +24 +29 +40 +30 +30 +47 +21 +38 +41 +52 +31 +57 +21 +22 +66 +21 +150 +150 +150 +150 +150 +69 +148 +150 +150 +150 +150 +150 +150 +146 +146 +150 +34 +33 +29 +37 +32 +31 +38 +25 +31 +33 +28 +22 +31 +29 +22 +23 +21 +21 +28 +32 +32 +36 +28 +31 +22 +22 +30 +29 +27 +26 +147 +22 +26 +21 +22 +28 +25 +25 +23 +22 +23 +22 +24 +23 +22 +22 +142 +150 +150 +150 +146 +79 +53 +57 +142 +39 +34 +39 +39 +67 +21 +42 +150 +52 +150 +123 +40 +150 +150 +150 +150 +150 +146 +150 +142 +142 +146 +146 +142 +150 +26 +150 +150 +150 +150 +150 +104 +93 +43 +72 +51 +68 +72 +68 +60 +70 +39 +38 +73 +74 +51 +43 +53 +58 +51 +61 +68 +42 +73 +55 +60 +75 +52 +70 +49 +80 +71 +73 +49 +41 +69 +38 +83 +59 +56 +35 +32 +25 +30 +51 +64 +48 +66 +60 +56 +33 +66 +146 +50 +50 +58 +66 +66 +66 +66 +66 +66 +57 +61 +58 +61 +65 +61 +50 +60 +37 +59 +63 +54 +67 +69 +63 +59 +51 +32 +65 +32 +33 +144 +150 +146 +150 +142 +146 +150 +126 +26 +25 +28 +21 +146 +25 +108 +146 +150 +109 +149 +146 +37 +150 +146 +146 +150 +150 +142 +23 +28 +22 +30 +24 +150 +150 +146 +150 +146 +38 +92 +52 +41 +38 +38 +40 +38 +40 +38 +40 +39 +38 +37 +37 +39 +40 +38 +40 +40 +37 +40 +37 +37 +42 +40 +38 +150 +41 +40 +37 +45 +44 +39 +40 +70 +42 +38 +38 +146 +138 +21 +150 +69 +58 +46 +34 +63 +49 +37 +42 +33 +40 +37 +150 +150 +146 +145 +150 +150 +150 +22 +150 +21 +150 +146 +142 +150 +150 +150 +150 +146 +150 +150 +150 +150 +150 +150 +142 +22 +150 +28 +60 +147 +146 +150 +144 +147 +146 +146 +150 +70 +150 +146 +140 +147 +22 +150 +30 +142 +150 +146 +150 +150 +150 +150 +150 +146 +27 +23 +26 +146 +66 +149 +37 +150 +68 +142 +150 +150 +97 +95 +58 +142 +107 +146 +150 +146 +143 +150 +146 +45 +24 +22 +150 +148 +150 +146 +146 +146 +150 +146 +150 +150 +22 +134 +51 +146 +150 +146 +111 +108 +142 +150 +150 +139 +43 +61 +31 +37 +40 +94 +95 +35 +98 +127 +150 +150 +21 +150 +150 +150 +150 +150 +74 +56 +105 +115 +48 +43 +150 +146 +26 +22 +26 +26 +26 +27 +26 +150 +25 +26 +23 +25 +22 +21 +21 +22 +23 +22 +24 +22 +22 +23 +23 +23 +23 +23 +24 +27 +150 +146 +57 +131 +142 +150 +150 +146 +51 +38 +38 +48 +49 +40 +44 +46 +39 +43 +35 +36 +41 +35 +34 +34 +33 +37 +32 +40 +30 +42 +31 +35 +34 +37 +37 +31 +30 +30 +31 +86 +135 +150 +146 +150 +26 +146 +150 +21 +150 +146 +21 +146 +146 +56 +142 +52 +75 +150 +33 +69 +49 +65 +144 +107 +119 +150 +150 +146 +69 +109 +36 +27 +30 +32 +21 +138 +146 +142 +63 +117 +85 +141 +150 +150 +150 +146 +143 +21 +146 +150 +146 +150 +150 +93 +63 +146 +150 +146 +146 +86 +146 +150 +146 +146 +36 +49 +150 +148 +150 +115 +150 +131 +150 +118 +71 +150 +146 +150 +150 +148 +38 +150 +42 +150 +126 +146 +138 +146 +150 +148 +146 +145 +150 +56 +89 +82 +26 +146 +150 +150 +147 +150 +40 +33 +37 +39 +40 +134 +41 +39 +39 +39 +39 +39 +40 +45 +38 +39 +40 +38 +37 +37 +37 +37 +40 +29 +150 +150 +140 +143 +146 +146 +146 +150 +76 +79 +150 +150 +150 +138 +146 +21 +70 +146 +135 +37 +58 +64 +49 +47 +57 +37 +39 +50 +62 +24 +39 +37 +38 +62 +37 +63 +58 +55 +64 +57 +26 +41 +38 +42 +52 +64 +35 +51 +43 +64 +63 +61 +49 +50 +59 +59 +57 +52 +52 +53 +52 +61 +61 +60 +41 +56 +45 +52 +148 +150 +27 +100 +95 +85 +73 +64 +47 +38 +27 +22 +150 +146 +21 +146 +23 +23 +23 +150 +150 +146 +150 +139 +150 +22 +22 +146 +33 +77 +62 +61 +57 +71 +60 +46 +62 +62 +64 +71 +59 +51 +59 +66 +57 +48 +43 +48 +60 +53 +52 +43 +64 +48 +56 +54 +54 +62 +63 +69 +69 +70 +142 +150 +150 +150 +150 +146 +150 +146 +150 +146 +128 +34 +60 +142 +146 +150 +146 +146 +150 +150 +146 +150 +146 +150 +146 +73 +95 +146 +150 +55 +142 +150 +150 +146 +146 +142 +26 +150 +24 +24 +21 +25 +146 +150 +150 +21 +21 +150 +148 +150 +150 +22 +146 +146 +146 +21 +142 +150 +147 +142 +146 +146 +150 +56 +148 +146 +53 +77 +150 +148 +146 +146 +115 +124 +21 +149 +150 +146 +53 +148 +150 +94 +150 +138 +150 +150 +146 +146 +143 +142 +138 +150 +150 +42 +150 +149 +150 +146 +28 +25 +150 +139 +150 +150 +142 +40 +106 +150 +146 +150 +148 +150 +150 +150 +77 +114 +146 +150 +150 +138 +142 +146 +139 +150 +150 +150 +58 +30 +137 +21 +21 +22 +21 +26 +21 +23 +21 +21 +21 +26 +23 +40 +22 +134 +26 +26 +146 +36 +150 +146 +150 +150 +150 +146 +150 +150 +146 +150 +150 +150 +21 +146 +142 +142 +150 +150 +150 +21 +21 +146 +27 +69 +139 +40 +142 +150 +146 +150 +146 +150 +146 +148 +66 +150 +146 +150 +146 +146 +150 +146 +52 +146 +150 +150 +150 +26 +22 +150 +80 +63 +36 +30 +142 +139 +146 +139 +150 +150 +84 +150 +59 +22 +149 +38 +107 +96 +80 +22 +150 +67 +141 +83 +90 +146 +150 +142 +142 +150 +150 +150 +150 +150 +146 +146 +142 +150 +142 +146 +146 +146 +150 +150 +146 +142 +91 +150 +150 +150 +23 +23 +22 +146 +150 +146 +150 +150 +150 +150 +149 +146 +146 +150 +146 +146 +150 +148 +150 +100 +46 +146 +23 +144 +150 +52 +150 +56 +118 +150 +96 +142 +110 +88 +76 +150 +148 +52 +140 +121 +54 +150 +142 +21 +146 +150 +91 +142 +142 +146 +147 +100 +66 +64 +148 +150 +150 +150 +150 +150 +142 +145 +150 +60 +146 +150 +24 +146 +150 +150 +146 +150 +150 +150 +92 +43 +94 +135 +150 +150 +142 +150 +150 +21 +146 +42 +26 +150 +150 +142 +146 +150 +150 +58 +58 +33 +58 +30 +58 +29 +49 +39 +21 +46 +32 +43 +21 +21 +21 +44 +21 +43 +21 +150 +49 +49 +41 +38 +32 +48 +44 +48 +48 +43 +47 +39 +43 +47 +46 +46 +38 +41 +28 +31 +31 +28 +44 +44 +35 +35 +43 +39 +37 +150 +148 +146 +22 +21 +146 +150 +150 +150 +146 +29 +32 +89 +85 +96 +83 +150 +32 +28 +150 +142 +150 +146 +150 +146 +146 +138 +146 +146 +43 +150 +25 +43 +146 +150 +150 +150 +150 +146 +55 +141 +52 +40 +146 +142 +150 +146 +150 +150 +30 +104 +21 +143 +24 +23 +148 +150 +142 +150 +150 +146 +150 +150 +150 +150 +146 +142 +150 +149 +146 +146 +150 +150 +150 +146 +113 +148 +26 +150 +150 +150 +150 +146 +39 +32 +150 +150 +21 +64 +56 +146 +150 +133 +150 +150 +146 +21 +150 +146 +146 +107 +121 +132 +46 +99 +117 +93 +82 +37 +134 +148 +150 +150 +27 +141 +38 +108 +150 +125 +78 +142 +150 +146 +120 +109 +142 +150 +150 +150 +58 +142 +94 +68 +95 +109 +148 +150 +143 +150 +150 +150 +146 +142 +150 +143 +146 +146 +21 +150 +60 +64 +80 +59 +54 +85 +86 +149 +44 +75 +112 +48 +67 +62 +27 +69 +50 +61 +39 +142 +63 +95 +71 +111 +104 +94 +63 +72 +47 +71 +41 +58 +44 +58 +28 +43 +38 +47 +64 +21 +110 +31 +21 +27 +24 +28 +31 +31 +31 +27 +28 +31 +73 +31 +29 +24 +29 +24 +24 +35 +23 +24 +24 +24 +26 +90 +146 +150 +104 +148 +150 +146 +146 +150 +150 +150 +150 +146 +150 +150 +142 +150 +146 +150 +70 +90 +60 +138 +89 +150 +105 +146 +148 +38 +38 +38 +39 +38 +42 +42 +43 +42 +40 +45 +40 +26 +40 +43 +43 +43 +35 +33 +39 +37 +37 +43 +28 +41 +37 +33 +39 +33 +38 +37 +32 +35 +45 +27 +33 +23 +46 +46 +43 +40 +43 +48 +39 +25 +46 +38 +42 +26 +150 +21 +150 +150 +146 +49 +150 +146 +146 +146 +150 +150 +138 +150 +150 +146 +150 +127 +26 +146 +101 +97 +74 +86 +130 +41 +41 +95 +59 +49 +150 +43 +80 +49 +67 +67 +58 +31 +73 +148 +133 +62 +138 +150 +146 +150 +150 +150 +150 +142 +146 +150 +146 +67 +135 +146 +146 +146 +142 +142 +142 +21 +21 +70 +28 +27 +32 +150 +32 +28 +29 +27 +26 +25 +25 +25 +25 +23 +23 +23 +26 +26 +41 +23 +150 +150 +142 +91 +146 +142 +146 +150 +150 +146 +128 +45 +148 +118 +150 +146 +146 +142 +150 +146 +150 +146 +33 +110 +21 +150 +146 +150 +150 +150 +150 +28 +146 +45 +24 +21 +35 +146 +147 +146 +150 +150 +149 +150 +150 +150 +57 +49 +146 +100 +22 +34 +32 +26 +23 +28 +25 +30 +31 +31 +26 +26 +29 +30 +27 +29 +29 +27 +32 +32 +23 +24 +24 +22 +33 +34 +27 +31 +25 +26 +23 +25 +28 +25 +32 +31 +33 +88 +23 +25 +24 +146 +140 +150 +142 +144 +146 +150 +142 +69 +146 +61 +25 +150 +150 +150 +148 +150 +138 +150 +150 +150 +148 +150 +150 +150 +150 +24 +150 +146 +146 +150 +146 +142 +146 +146 +142 +150 +138 +138 +22 +150 +150 +146 +146 +146 +146 +146 +47 +47 +39 +54 +39 +47 +54 +25 +26 +28 +28 +28 +37 +28 +34 +36 +38 +44 +33 +54 +33 +39 +39 +46 +40 +30 +42 +34 +35 +35 +35 +24 +35 +35 +42 +37 +35 +36 +150 +150 +21 +21 +142 +150 +146 +150 +150 +146 +150 +150 +146 +150 +150 +150 +150 +150 +146 +150 +150 +150 +150 +150 +109 +23 +90 +150 +27 +30 +24 +24 +24 +26 +31 +26 +27 +28 +26 +26 +22 +22 +26 +22 +23 +26 +25 +21 +21 +21 +22 +30 +22 +25 +29 +23 +27 +30 +30 +28 +25 +25 +25 +82 +80 +146 +138 +150 +128 +150 +150 +49 +142 +138 +146 +56 +75 +150 +25 +148 +150 +146 +21 +21 +24 +150 +146 +142 +146 +150 +142 +150 +146 +146 +150 +150 +146 +150 +148 +26 +26 +26 +23 +150 +40 +142 +150 +150 +148 +150 +150 +146 +149 +150 +150 +95 +150 +94 +93 +34 +75 +34 +34 +142 +98 +94 +74 +84 +57 +61 +32 +43 +21 +150 +146 +150 +76 +149 +37 +21 +150 +146 +146 +43 +30 +53 +64 +31 +148 +71 +71 +46 +39 +72 +30 +150 +150 +150 +146 +150 +110 +150 +138 +142 +150 +143 +146 +146 +150 +146 +146 +75 +116 +146 +146 +146 +146 +146 +146 +21 +146 +150 +46 +146 +58 +43 +129 +146 +146 +150 +139 +144 +150 +83 +109 +74 +66 +34 +25 +85 +146 +84 +57 +56 +48 +30 +145 +146 +150 +146 +38 +37 +29 +103 +108 +146 +150 +146 +150 +142 +142 +26 +150 +139 +146 +137 +150 +150 +144 +150 +146 +150 +150 +150 +38 +150 +42 +40 +47 +38 +38 +38 +38 +39 +38 +37 +37 +37 +37 +45 +42 +41 +43 +37 +38 +37 +51 +38 +39 +38 +38 +39 +40 +38 +37 +83 +94 +42 +38 +42 +40 +38 +40 +40 +39 +38 +39 +148 +150 +98 +137 +146 +146 +146 +150 +109 +146 +150 +21 +150 +22 +29 +29 +25 +23 +45 +40 +33 +37 +26 +30 +28 +28 +21 +28 +25 +23 +25 +146 +150 +150 +22 +150 +146 +150 +150 +150 +146 +146 +146 +150 +150 +150 +150 +150 +150 +143 +146 +150 +146 +146 +97 +150 +150 +150 +142 +150 +146 +146 +146 +89 +105 +150 +146 +138 +148 +33 +144 +148 +146 +150 +150 +146 +142 +150 +146 +25 +85 +98 +98 +150 +93 +150 +150 +150 +26 +30 +150 +30 +35 +41 +31 +150 +146 +150 +146 +146 +150 +150 +142 +142 +146 +148 +34 +32 +27 +26 +24 +23 +24 +27 +23 +23 +24 +23 +24 +21 +25 +142 +134 +146 +150 +100 +150 +150 +148 +150 +146 +150 +148 +150 +150 +31 +27 +26 +37 +24 +27 +24 +26 +25 +25 +22 +22 +22 +22 +22 +24 +25 +22 +25 +150 +150 +31 +22 +22 +22 +22 +22 +22 +150 +150 +23 +150 +146 +150 +50 +72 +111 +103 +146 +150 +150 +150 +146 +150 +144 +146 +150 +142 +150 +24 +120 +150 +40 +39 +146 +21 +146 +150 +122 +146 +150 +150 +150 +150 +72 +150 +51 +150 +142 +146 +150 +49 +146 +118 +89 +50 +76 +34 +44 +52 +51 +44 +46 +34 +52 +150 +77 +80 +30 +71 +41 +98 +75 +98 +48 +78 +47 +79 +89 +36 +69 +30 +150 +89 +90 +150 +146 +32 +148 +92 +150 +150 +76 +105 +47 +146 +150 +138 +21 +146 +146 +150 +150 +150 +146 +150 +72 +146 +138 +55 +45 +97 +108 +50 +69 +32 +42 +31 +66 +63 +42 +106 +21 +76 +73 +56 +41 +31 +31 +134 +29 +103 +112 +98 +97 +94 +83 +60 +47 +35 +24 +142 +142 +150 +146 +150 +146 +128 +150 +90 +54 +146 +55 +146 +71 +82 +89 +76 +107 +150 +150 +21 +138 +138 +150 +53 +150 +150 +150 +149 +146 +146 +145 +150 +150 +150 +142 +115 +121 +142 +150 +87 +26 +146 +25 +47 +66 +150 +62 +35 +23 +150 +150 +144 +146 +150 +150 +124 +150 +36 +150 +147 +146 +150 +146 +144 +68 +94 +144 +146 +150 +150 +86 +87 +146 +142 +150 +146 +146 +150 +150 +150 +150 +146 +150 +146 +150 +150 +112 +150 +146 +68 +98 +146 +146 +150 +146 +150 +43 +35 +30 +29 +22 +22 +22 +36 +43 +26 +47 +46 +43 +40 +31 +41 +36 +41 +36 +38 +36 +26 +40 +40 +38 +41 +37 +37 +32 +37 +36 +38 +34 +35 +21 +25 +24 +33 +38 +40 +33 +33 +33 +33 +38 +38 +38 +49 +38 +49 +41 +39 +45 +40 +34 +38 +39 +25 +26 +150 +150 +150 +146 +150 +148 +60 +150 +146 +146 +150 +146 +150 +21 +150 +22 +106 +23 +145 +150 +146 +146 +150 +29 +150 +142 +148 +138 +150 +142 +150 +150 +150 +150 +150 +150 +150 +146 +150 +150 +23 +22 +146 +27 +146 +21 +150 +150 +53 +56 +146 +150 +142 +150 +150 +21 +23 +146 +150 +146 +150 +150 +150 +146 +23 +146 +150 +146 +109 +150 +143 +60 +56 +53 +146 +87 +142 +150 +31 +85 +150 +150 +150 +142 +150 +142 +146 +23 +146 +60 +94 +150 +146 +52 +107 +150 +150 +150 +150 +38 +21 +24 +150 +38 +24 +146 +146 +79 +65 +83 +96 +150 +46 +25 +150 +150 +150 +144 +142 +150 +150 +51 +86 +148 +47 +32 +150 +142 +146 +150 +135 +108 +150 +21 +21 +146 +146 +150 +150 +146 +150 +148 +142 +91 +85 +150 +63 +45 +150 +40 +33 +35 +35 +40 +35 +25 +25 +35 +30 +33 +33 +33 +34 +28 +39 +34 +150 +150 +144 +150 +150 +146 +146 +146 +150 +146 +27 +150 +150 +146 +146 +22 +149 +147 +116 +149 +32 +36 +28 +26 +30 +34 +34 +30 +35 +32 +32 +23 +32 +32 +28 +28 +32 +28 +48 +34 +32 +28 +91 +44 +94 +28 +100 +92 +50 +92 +91 +36 +79 +51 +94 +73 +53 +72 +75 +73 +150 +149 +148 +150 +136 +150 +150 +146 +146 +150 +138 +21 +150 +34 +146 +150 +142 +69 +150 +150 +150 +146 +150 +150 +150 +150 +146 +146 +150 +23 +150 +127 +55 +150 +73 +52 +55 +52 +54 +50 +51 +56 +53 +48 +48 +40 +38 +37 +32 +48 +52 +46 +146 +45 +41 +45 +46 +44 +49 +43 +46 +39 +38 +42 +38 +44 +30 +41 +44 +39 +38 +39 +39 +40 +139 +49 +150 +146 +150 +150 +21 +146 +21 +142 +150 +150 +142 +150 +150 +150 +138 +66 +146 +74 +150 +150 +150 +150 +150 +150 +146 +37 +35 +150 +86 +47 +150 +123 +150 +150 +146 +150 +146 +150 +142 +150 +150 +146 +150 +150 +147 +150 +56 +47 +43 +52 +52 +150 +49 +27 +53 +60 +31 +34 +34 +33 +29 +35 +36 +26 +34 +47 +30 +37 +48 +30 +43 +35 +31 +48 +28 +25 +29 +29 +25 +37 +60 +48 +34 +29 +146 +150 +146 +150 +148 +144 +150 +134 +146 +146 +150 +150 +150 +146 +150 +150 +146 +146 +146 +146 +146 +104 +148 +150 +150 +142 +94 +92 +94 +148 +146 +26 +146 +146 +149 +146 +146 +146 +150 +146 +147 +148 +70 +144 +47 +34 +98 +51 +150 +138 +21 +138 +150 +146 +150 +150 +150 +53 +142 +146 +150 +146 +146 +150 +54 +142 +150 +150 +21 +150 +150 +27 +146 +21 +21 +150 +71 +50 +54 +36 +150 +63 +150 +150 +150 +146 +146 +150 +146 +144 +138 +150 +150 +146 +71 +123 +22 +33 +150 +150 +142 +148 +150 +26 +150 +150 +146 +92 +146 +150 +146 +146 +72 +140 +58 +150 +150 +146 +148 +30 +150 +146 +146 +30 +146 +83 +146 +150 +142 +147 +150 +150 +150 +138 +150 +130 +28 +150 +150 +146 +29 +150 +96 +143 +62 +138 +150 +86 +146 +149 +150 +150 +150 +150 +142 +150 +146 +147 +150 +150 +150 +150 +68 +78 +149 +82 +148 +138 +146 +150 +27 +28 +22 +23 +21 +24 +25 +21 +21 +21 +21 +21 +21 +23 +21 +150 +150 +74 +146 +150 +146 +150 +150 +146 +67 +144 +150 +150 +142 +150 +150 +142 +61 +145 +148 +150 +142 +61 +150 +150 +150 +134 +141 +150 +150 +150 +150 +146 +150 +146 +138 +146 +146 +150 +146 +142 +150 +22 +146 +150 +96 +24 +150 +148 +144 +150 +150 +146 +30 +76 +94 +150 +146 +146 +150 +150 +150 +21 +24 +142 +150 +107 +23 +150 +146 +150 +150 +150 +150 +150 +42 +42 +24 +150 +125 +64 +150 +150 +128 +27 +27 +44 +47 +30 +150 +142 +36 +150 +31 +80 +107 +134 +68 +48 +148 +86 +56 +28 +150 +150 +150 +150 +71 +46 +150 +146 +50 +146 +77 +39 +59 +50 +150 +148 +150 +150 +150 +150 +142 +150 +146 +150 +150 +146 +21 +135 +24 +21 +21 +98 +26 +146 +45 +150 +114 +64 +59 +48 +150 +33 +91 +84 +54 +150 +150 +150 +146 +68 +71 +102 +80 +98 +150 +146 +146 +146 +148 +76 +82 +150 +148 +21 +146 +22 +22 +22 +22 +23 +25 +25 +138 +24 +23 +23 +23 +150 +150 +29 +43 +146 +28 +26 +23 +31 +31 +31 +31 +31 +36 +36 +45 +36 +146 +25 +65 +47 +41 +74 +146 +146 +29 +33 +26 +145 +146 +146 +25 +125 +146 +150 +61 +150 +150 +150 +142 +150 +138 +34 +25 +23 +23 +33 +24 +24 +24 +21 +26 +30 +25 +24 +27 +23 +150 +147 +21 +22 +21 +28 +28 +150 +150 +150 +27 +143 +146 +142 +150 +146 +150 +146 +150 +138 +44 +82 +150 +146 +21 +150 +21 +139 +150 +146 +138 +150 +150 +146 +146 +146 +85 +146 +150 +44 +146 +146 +150 +150 +25 +134 +146 +150 +150 +150 +35 +26 +24 +26 +29 +25 +23 +21 +21 +107 +150 +95 +70 +75 +96 +81 +146 +78 +80 +138 +146 +146 +148 +40 +150 +150 +146 +150 +146 +148 +146 +146 +146 +150 +142 +150 +21 +23 +23 +23 +23 +24 +23 +23 +23 +30 +22 +22 +25 +24 +23 +22 +150 +49 +38 +146 +150 +146 +146 +150 +145 +146 +146 +150 +54 +67 +150 +146 +142 +146 +150 +150 +146 +150 +150 +146 +150 +129 +150 +146 +150 +150 +71 +68 +150 +71 +111 +93 +91 +22 +85 +142 +51 +136 +146 +31 +27 +87 +150 +110 +150 +150 +146 +143 +150 +142 +150 +43 +86 +77 +107 +150 +146 +147 +59 +148 +147 +150 +150 +148 +146 +23 +146 +150 +150 +146 +146 +146 +150 +47 +146 +142 +150 +150 +150 +150 +150 +146 +146 +150 +146 +146 +150 +148 +21 +77 +146 +150 +142 +150 +146 +143 +142 +150 +150 +143 +22 +146 +146 +142 +150 +143 +150 +150 +146 +150 +146 +142 +142 +150 +150 +146 +146 +146 +142 +150 +150 +102 +96 +146 +146 +150 +150 +82 +54 +29 +150 +81 +81 +74 +146 +146 +22 +22 +150 +150 +146 +150 +29 +28 +29 +23 +26 +28 +23 +28 +21 +25 +22 +25 +25 +29 +22 +22 +24 +21 +24 +21 +23 +24 +26 +24 +29 +26 +142 +98 +21 +138 +142 +150 +150 +150 +91 +32 +102 +137 +29 +142 +42 +91 +149 +72 +148 +150 +150 +150 +28 +142 +146 +150 +138 +150 +92 +91 +148 +150 +150 +146 +58 +82 +127 +150 +150 +150 +146 +150 +148 +140 +146 +21 +150 +150 +142 +142 +150 +150 +146 +150 +142 +150 +142 +148 +146 +150 +150 +150 +146 +146 +22 +150 +146 +150 +146 +144 +134 +131 +146 +150 +150 +148 +138 +142 +143 +142 +142 +41 +148 +112 +150 +146 +150 +32 +22 +150 +27 +150 +146 +149 +146 +150 +109 +91 +45 +83 +74 +146 +72 +27 +146 +146 +146 +150 +27 +146 +150 +146 +146 +138 +146 +150 +146 +150 +150 +38 +55 +146 +146 +98 +146 +40 +128 +64 +54 +150 +22 +85 +41 +150 +150 +43 +34 +37 +39 +35 +35 +39 +28 +39 +35 +34 +37 +30 +35 +27 +31 +29 +29 +27 +25 +34 +30 +25 +33 +25 +31 +39 +142 +21 +21 +142 +150 +150 +145 +150 +146 +150 +150 +150 +146 +150 +146 +146 +150 +150 +150 +142 +142 +91 +140 +39 +150 +146 +21 +150 +22 +146 +142 +146 +139 +66 +148 +142 +150 +146 +150 +150 +150 +150 +150 +146 +139 +29 +81 +150 +29 +150 +42 +109 +146 +150 +145 +62 +56 +58 +138 +54 +52 +150 +144 +146 +143 +150 +146 +150 +146 +31 +146 +147 +21 +142 +142 +146 +70 +150 +150 +142 +142 +21 +150 +146 +146 +146 +150 +111 +150 +150 +150 +133 +150 +146 +146 +142 +150 +150 +150 +49 +150 +150 +150 +150 +150 +146 +150 +146 +146 +141 +118 +51 +88 +150 +26 +150 +146 +21 +49 +145 +146 +150 +150 +150 +138 +125 +150 +120 +44 +42 +45 +44 +37 +41 +39 +150 +146 +150 +150 +150 +150 +150 +150 +150 +146 +150 +150 +150 +150 +146 +148 +150 +150 +146 +150 +74 +42 +45 +62 +150 +150 +146 +150 +150 +146 +150 +149 +150 +146 +150 +148 +56 +150 +146 +28 +148 +76 +150 +146 +146 +138 +150 +134 +150 +23 +23 +22 +84 +148 +142 +44 +149 +150 +146 +142 +23 +149 +150 +150 +146 +32 +150 +136 +30 +34 +150 +150 +146 +146 +114 +47 +146 +101 +59 +150 +21 +150 +142 +146 +142 +150 +150 +150 +150 +146 +148 +148 +150 +145 +137 +29 +30 +26 +23 +26 +150 +34 +39 +34 +27 +33 +150 +105 +150 +142 +150 +144 +150 +81 +100 +92 +150 +114 +37 +97 +150 +26 +24 +36 +29 +150 +146 +150 +150 +139 +150 +142 +142 +143 +142 +150 +150 +142 +150 +146 +146 +146 +146 +86 +100 +150 +85 +70 +104 +98 +150 +28 +150 +21 +92 +144 +138 +146 +150 +146 +35 +150 +150 +150 +146 +150 +146 +130 +146 +150 +60 +44 +27 +29 +45 +41 +45 +45 +34 +34 +60 +34 +30 +48 +25 +48 +26 +38 +25 +25 +25 +23 +23 +24 +25 +24 +21 +41 +34 +23 +146 +22 +87 +146 +140 +23 +144 +150 +150 +146 +146 +146 +142 +23 +138 +26 +146 +150 +148 +150 +146 +150 +143 +21 +114 +146 +150 +150 +150 +150 +39 +39 +96 +47 +51 +29 +47 +32 +43 +45 +33 +29 +37 +32 +31 +43 +32 +33 +24 +49 +29 +34 +27 +30 +33 +32 +35 +33 +38 +30 +36 +27 +33 +38 +90 +38 +31 +49 +30 +46 +27 +37 +33 +33 +33 +25 +28 +30 +25 +27 +146 +146 +22 +150 +146 +37 +42 +100 +69 +150 +150 +89 +144 +131 +116 +21 +33 +24 +24 +24 +23 +27 +28 +30 +28 +23 +23 +24 +25 +27 +24 +22 +139 +146 +148 +48 +146 +146 +142 +150 +21 +146 +146 +111 +30 +146 +150 +150 +150 +38 +150 +47 +146 +150 +150 +27 +83 +126 +97 +146 +146 +150 +150 +142 +150 +150 +146 +147 +150 +144 +142 +150 +21 +146 +138 +146 +146 +146 +150 +150 +150 +150 +120 +150 +150 +146 +150 +54 +149 +54 +23 +23 +22 +86 +21 +21 +21 +36 +25 +32 +29 +67 +38 +146 +146 +146 +146 +139 +147 +150 +150 +21 +146 +150 +146 +22 +150 +150 +150 +150 +150 +148 +78 +84 +149 +69 +149 +150 +150 +24 +25 +37 +31 +26 +31 +28 +26 +29 +24 +29 +31 +47 +25 +31 +29 +35 +31 +26 +24 +28 +29 +33 +45 +46 +43 +26 +41 +37 +21 +37 +49 +31 +40 +36 +148 +150 +146 +146 +150 +35 +39 +37 +52 +36 +38 +22 +38 +45 +35 +35 +45 +42 +39 +43 +25 +33 +33 +45 +41 +41 +24 +37 +37 +41 +38 +29 +33 +37 +39 +39 +36 +40 +37 +39 +31 +41 +40 +39 +37 +47 +37 +41 +59 +48 +54 +46 +32 +47 +27 +29 +29 +29 +29 +25 +29 +29 +21 +29 +29 +25 +40 +50 +32 +103 +134 +65 +107 +79 +72 +62 +68 +49 +86 +39 +57 +39 +150 +50 +30 +66 +50 +70 +117 +40 +69 +57 +79 +71 +54 +45 +42 +54 +150 +150 +150 +150 +144 +27 +25 +27 +21 +150 +25 +24 +22 +22 +23 +22 +32 +22 +22 +22 +22 +22 +150 +21 +150 +146 +150 +150 +150 +146 +150 +150 +146 +150 +150 +142 +150 +150 +150 +147 +145 +150 +150 +150 +21 +150 +146 +150 +146 +146 +150 +150 +146 +150 +150 +146 +150 +142 +150 +150 +150 +146 +146 +21 +21 +21 +21 +146 +150 +146 +146 +147 +150 +42 +148 +58 +120 +149 +66 +150 +142 +23 +22 diff --git a/regression_test/test_regression_protein_good_result b/regression_test/test_regression_protein_good_result new file mode 100644 index 0000000..9c5b62c --- /dev/null +++ b/regression_test/test_regression_protein_good_result @@ -0,0 +1,30000 @@ +73 +74 +392 +66 +43 +93 +66 +41 +57 +70 +49 +52 +83 +56 +50 +64 +91 +58 +39 +48 +53 +70 +66 +68 +39 +48 +82 +72 +40 +69 +72 +50 +67 +72 +58 +58 +41 +62 +38 +378 +50 +811 +59 +53 +64 +64 +58 +208 +74 +43 +250 +68 +50 +33 +35 +27 +38 +36 +263 +48 +77 +60 +90 +59 +31 +55 +39 +56 +39 +73 +65 +78 +61 +63 +73 +585 +59 +81 +72 +61 +52 +50 +65 +61 +80 +38 +55 +54 +69 +51 +50 +52 +74 +48 +55 +35 +68 +48 +383 +504 +30 +37 +45 +33 +62 +74 +430 +33 +37 +40 +61 +58 +57 +61 +64 +55 +73 +53 +45 +61 +212 +258 +42 +71 +56 +59 +69 +41 +40 +61 +45 +62 +45 +60 +35 +43 +64 +68 +40 +64 +51 +75 +48 +54 +46 +52 +51 +257 +47 +69 +72 +77 +45 +45 +53 +63 +193 +198 +192 +30 +72 +86 +71 +38 +65 +86 +43 +45 +72 +42 +56 +67 +55 +94 +56 +60 +61 +45 +405 +64 +54 +41 +65 +53 +49 +54 +38 +41 +61 +49 +85 +83 +41 +87 +57 +54 +70 +63 +40 +65 +42 +31 +87 +43 +65 +66 +44 +43 +51 +52 +68 +41 +53 +67 +65 +62 +61 +65 +51 +69 +44 +90 +71 +73 +73 +70 +72 +77 +57 +38 +39 +133 +46 +39 +39 +40 +46 +53 +59 +77 +47 +71 +51 +37 +61 +65 +47 +806 +394 +69 +50 +58 +32 +55 +131 +128 +55 +72 +37 +39 +54 +38 +44 +39 +66 +68 +64 +42 +37 +42 +56 +57 +38 +49 +64 +91 +57 +65 +74 +84 +53 +381 +146 +49 +34 +39 +61 +73 +56 +78 +48 +42 +401 +57 +65 +307 +52 +334 +29 +334 +198 +31 +43 +49 +44 +43 +37 +55 +49 +66 +74 +64 +37 +58 +79 +328 +35 +70 +53 +106 +114 +46 +41 +344 +56 +61 +97 +42 +59 +65 +54 +90 +48 +78 +52 +77 +216 +214 +260 +49 +61 +42 +38 +60 +51 +60 +67 +38 +33 +55 +34 +31 +62 +55 +57 +46 +58 +38 +41 +57 +45 +62 +77 +76 +37 +46 +46 +51 +35 +55 +71 +46 +53 +57 +50 +45 +70 +61 +78 +81 +52 +50 +76 +63 +60 +54 +56 +54 +67 +38 +57 +32 +56 +91 +68 +32 +40 +55 +67 +74 +57 +64 +80 +69 +65 +47 +33 +41 +38 +80 +87 +58 +51 +35 +49 +47 +50 +43 +47 +52 +39 +27 +28 +87 +54 +54 +39 +37 +52 +62 +46 +63 +53 +52 +60 +59 +59 +31 +44 +65 +55 +61 +58 +56 +44 +50 +59 +44 +42 +56 +40 +39 +43 +53 +45 +54 +29 +44 +36 +64 +45 +65 +49 +64 +37 +72 +70 +58 +68 +40 +61 +66 +59 +55 +52 +302 +41 +314 +28 +321 +181 +57 +37 +440 +134 +55 +43 +40 +37 +45 +52 +53 +54 +51 +56 +71 +63 +69 +62 +32 +55 +52 +80 +67 +44 +61 +78 +40 +84 +56 +54 +36 +71 +57 +34 +48 +62 +78 +43 +79 +66 +50 +82 +52 +67 +43 +60 +34 +53 +48 +43 +58 +54 +64 +67 +42 +58 +66 +45 +73 +55 +53 +50 +65 +67 +61 +70 +40 +41 +72 +59 +55 +52 +49 +51 +31 +52 +43 +64 +55 +47 +40 +67 +60 +52 +43 +52 +50 +105 +72 +51 +72 +83 +43 +43 +48 +49 +63 +94 +41 +63 +65 +53 +68 +58 +63 +49 +64 +41 +60 +55 +78 +51 +55 +41 +58 +40 +33 +59 +57 +54 +52 +47 +39 +38 +43 +62 +61 +335 +45 +42 +93 +58 +61 +72 +60 +67 +45 +60 +56 +52 +62 +45 +43 +51 +48 +104 +83 +66 +56 +103 +44 +62 +63 +51 +39 +37 +35 +33 +47 +44 +36 +66 +70 +43 +50 +53 +60 +46 +60 +44 +53 +50 +42 +39 +55 +41 +63 +33 +70 +58 +58 +81 +90 +62 +67 +48 +94 +74 +69 +54 +63 +47 +71 +230 +79 +45 +57 +40 +37 +43 +89 +39 +70 +56 +67 +62 +72 +71 +60 +57 +54 +50 +74 +61 +43 +60 +60 +72 +50 +57 +62 +55 +451 +70 +385 +42 +203 +74 +44 +67 +36 +63 +49 +73 +97 +62 +54 +50 +40 +82 +66 +66 +66 +57 +38 +48 +51 +49 +68 +56 +53 +70 +51 +50 +64 +73 +614 +59 +48 +48 +57 +28 +41 +24 +77 +26 +48 +66 +56 +42 +87 +67 +37 +65 +73 +48 +61 +47 +47 +59 +71 +53 +39 +48 +49 +40 +60 +63 +66 +42 +74 +33 +42 +310 +56 +291 +29 +40 +294 +183 +32 +431 +145 +42 +421 +67 +66 +51 +611 +51 +55 +52 +83 +78 +57 +49 +57 +80 +43 +48 +60 +46 +59 +79 +78 +56 +48 +50 +56 +52 +66 +55 +67 +41 +76 +65 +80 +339 +45 +64 +77 +126 +131 +345 +381 +66 +119 +78 +71 +64 +69 +52 +41 +65 +57 +48 +46 +59 +56 +50 +45 +50 +56 +58 +37 +42 +48 +46 +80 +36 +54 +50 +43 +66 +45 +163 +66 +76 +38 +54 +60 +65 +62 +43 +53 +57 +41 +66 +43 +61 +819 +800 +60 +63 +43 +75 +60 +46 +47 +52 +74 +75 +50 +63 +41 +40 +73 +65 +72 +53 +60 +65 +61 +75 +37 +48 +65 +38 +50 +53 +61 +61 +41 +80 +53 +54 +56 +34 +61 +40 +34 +49 +56 +67 +49 +66 +62 +82 +80 +81 +40 +58 +65 +46 +51 +55 +58 +71 +55 +47 +161 +121 +56 +65 +38 +30 +65 +63 +48 +73 +63 +63 +64 +66 +65 +37 +56 +52 +54 +66 +64 +71 +57 +52 +67 +265 +48 +39 +43 +40 +61 +66 +59 +58 +51 +72 +74 +60 +48 +43 +38 +40 +57 +69 +47 +53 +42 +58 +56 +41 +111 +64 +92 +46 +52 +72 +56 +76 +35 +58 +48 +47 +73 +50 +57 +115 +66 +45 +60 +73 +54 +47 +55 +39 +52 +59 +60 +59 +65 +71 +51 +63 +42 +42 +54 +41 +44 +55 +67 +72 +63 +74 +86 +57 +68 +68 +53 +36 +56 +73 +50 +53 +58 +47 +42 +57 +48 +37 +59 +61 +42 +74 +76 +70 +62 +50 +72 +80 +56 +89 +52 +66 +59 +49 +41 +31 +40 +43 +54 +48 +75 +57 +65 +69 +47 +52 +62 +76 +63 +57 +55 +55 +42 +58 +48 +64 +37 +44 +34 +138 +54 +54 +117 +141 +43 +152 +55 +39 +59 +60 +63 +35 +91 +55 +34 +52 +47 +50 +70 +74 +73 +62 +58 +64 +74 +68 +67 +46 +80 +47 +38 +46 +38 +53 +40 +70 +59 +68 +57 +66 +49 +80 +44 +71 +217 +201 +49 +57 +29 +79 +55 +48 +74 +63 +53 +46 +38 +76 +62 +66 +39 +52 +63 +65 +42 +68 +51 +40 +66 +76 +46 +46 +40 +77 +51 +49 +61 +54 +68 +48 +49 +48 +49 +48 +46 +80 +82 +41 +42 +55 +42 +53 +48 +32 +42 +52 +756 +35 +58 +55 +55 +48 +63 +52 +77 +67 +54 +49 +50 +49 +47 +49 +38 +36 +66 +72 +69 +45 +42 +74 +46 +43 +63 +67 +48 +36 +95 +69 +70 +60 +49 +44 +77 +62 +41 +72 +54 +36 +37 +61 +39 +69 +68 +75 +67 +77 +86 +60 +68 +70 +53 +271 +129 +63 +49 +133 +37 +291 +279 +50 +265 +39 +56 +38 +689 +64 +63 +54 +62 +68 +55 +64 +39 +66 +76 +67 +66 +40 +38 +59 +78 +61 +51 +83 +57 +28 +63 +66 +41 +63 +67 +47 +47 +53 +66 +47 +54 +74 +42 +79 +75 +76 +63 +99 +61 +43 +38 +60 +34 +35 +34 +90 +35 +38 +44 +33 +38 +50 +42 +46 +33 +66 +51 +62 +51 +32 +38 +51 +64 +50 +51 +63 +56 +54 +66 +644 +49 +608 +80 +47 +80 +65 +74 +91 +56 +79 +81 +72 +54 +48 +67 +47 +53 +53 +52 +50 +74 +57 +67 +41 +38 +59 +36 +44 +39 +44 +137 +48 +43 +65 +70 +773 +53 +48 +51 +61 +32 +62 +74 +59 +70 +61 +77 +67 +44 +77 +67 +58 +46 +66 +50 +57 +43 +44 +51 +47 +44 +75 +581 +51 +47 +58 +74 +60 +62 +57 +57 +598 +59 +69 +63 +70 +65 +46 +34 +40 +36 +206 +32 +53 +56 +59 +57 +53 +60 +40 +93 +57 +42 +48 +57 +39 +46 +36 +62 +29 +45 +109 +70 +80 +71 +47 +72 +58 +46 +53 +54 +50 +41 +70 +50 +44 +60 +56 +48 +47 +67 +56 +57 +38 +69 +59 +59 +59 +66 +71 +33 +115 +34 +36 +56 +270 +48 +53 +62 +74 +57 +49 +41 +60 +34 +58 +35 +68 +74 +69 +53 +70 +72 +52 +35 +45 +31 +87 +60 +46 +63 +66 +50 +40 +40 +41 +50 +49 +61 +45 +34 +51 +56 +54 +64 +47 +66 +77 +48 +43 +46 +50 +32 +72 +40 +40 +73 +61 +41 +56 +61 +34 +78 +110 +56 +29 +67 +70 +85 +53 +131 +63 +81 +42 +101 +54 +84 +55 +54 +57 +44 +53 +65 +62 +38 +68 +66 +38 +86 +53 +39 +50 +68 +39 +51 +65 +78 +64 +62 +54 +88 +63 +67 +34 +62 +33 +51 +67 +67 +47 +30 +52 +49 +51 +64 +78 +44 +81 +257 +67 +58 +48 +71 +51 +37 +61 +69 +48 +81 +34 +123 +34 +36 +353 +62 +58 +72 +47 +53 +80 +54 +42 +68 +43 +40 +59 +63 +36 +100 +62 +40 +66 +56 +34 +41 +56 +64 +59 +82 +66 +60 +58 +64 +62 +763 +36 +71 +68 +47 +38 +44 +69 +69 +71 +55 +60 +75 +56 +74 +63 +64 +58 +58 +30 +55 +58 +56 +68 +67 +67 +53 +78 +55 +73 +54 +51 +73 +59 +58 +35 +936 +69 +87 +63 +41 +50 +39 +66 +58 +71 +48 +39 +38 +41 +43 +66 +51 +64 +82 +47 +50 +48 +58 +46 +43 +33 +65 +213 +43 +87 +78 +66 +51 +67 +81 +63 +55 +42 +81 +39 +61 +77 +72 +67 +83 +63 +65 +54 +57 +46 +56 +47 +284 +46 +57 +42 +47 +37 +32 +48 +66 +57 +72 +41 +38 +38 +54 +48 +48 +69 +62 +38 +57 +40 +25 +53 +40 +45 +47 +57 +77 +56 +70 +65 +47 +62 +47 +53 +57 +38 +41 +52 +75 +51 +38 +33 +39 +449 +50 +48 +70 +44 +227 +258 +250 +187 +36 +191 +33 +192 +59 +42 +214 +49 +31 +78 +44 +37 +74 +619 +58 +76 +35 +59 +60 +82 +49 +51 +92 +84 +41 +51 +76 +64 +109 +100 +69 +45 +75 +45 +67 +62 +67 +48 +66 +77 +56 +48 +56 +33 +42 +50 +71 +58 +69 +54 +72 +36 +69 +69 +42 +27 +69 +48 +37 +47 +85 +70 +84 +60 +50 +58 +43 +60 +71 +39 +71 +55 +97 +41 +92 +58 +50 +45 +44 +48 +59 +38 +45 +72 +43 +55 +66 +72 +62 +62 +529 +48 +58 +38 +74 +40 +62 +67 +56 +62 +46 +49 +65 +57 +48 +47 +44 +57 +47 +51 +35 +52 +64 +59 +63 +53 +59 +64 +67 +88 +71 +68 +50 +36 +76 +59 +55 +38 +49 +77 +49 +52 +56 +49 +67 +62 +52 +51 +47 +56 +283 +41 +47 +58 +62 +44 +34 +39 +38 +47 +30 +60 +89 +60 +63 +67 +56 +47 +36 +62 +41 +65 +54 +66 +74 +517 +63 +89 +35 +67 +48 +84 +89 +76 +502 +73 +43 +50 +42 +33 +55 +84 +43 +76 +74 +67 +84 +66 +57 +90 +58 +45 +40 +45 +45 +75 +54 +40 +49 +51 +74 +50 +40 +56 +68 +55 +38 +60 +64 +66 +55 +74 +521 +403 +147 +45 +55 +50 +36 +44 +40 +35 +55 +47 +72 +64 +49 +38 +48 +58 +72 +56 +42 +55 +309 +338 +329 +66 +122 +480 +33 +233 +77 +134 +58 +79 +62 +50 +58 +38 +40 +44 +37 +51 +52 +76 +75 +70 +46 +56 +320 +54 +45 +60 +245 +70 +36 +61 +43 +60 +71 +56 +69 +56 +67 +62 +76 +70 +35 +75 +125 +42 +55 +51 +52 +61 +50 +59 +65 +51 +68 +68 +47 +65 +72 +61 +59 +61 +51 +59 +62 +57 +74 +59 +56 +51 +72 +48 +52 +73 +69 +62 +68 +73 +37 +43 +49 +55 +77 +70 +63 +50 +43 +56 +47 +110 +55 +834 +48 +67 +43 +54 +55 +41 +70 +60 +42 +43 +43 +38 +38 +42 +35 +49 +39 +34 +51 +50 +48 +52 +40 +56 +61 +61 +61 +41 +67 +37 +35 +49 +26 +60 +52 +68 +69 +45 +232 +54 +58 +49 +41 +36 +59 +51 +167 +48 +72 +64 +84 +206 +54 +39 +73 +44 +94 +43 +56 +63 +49 +37 +39 +48 +42 +37 +42 +40 +37 +55 +55 +33 +67 +59 +55 +54 +60 +73 +46 +33 +54 +52 +64 +50 +89 +72 +44 +54 +77 +33 +45 +34 +55 +53 +50 +69 +67 +61 +70 +57 +73 +57 +64 +40 +65 +59 +38 +49 +64 +53 +46 +46 +56 +46 +59 +41 +49 +42 +55 +49 +61 +43 +53 +493 +43 +50 +55 +80 +51 +39 +85 +53 +50 +48 +61 +44 +54 +31 +32 +38 +45 +59 +53 +54 +55 +40 +47 +40 +38 +69 +65 +76 +88 +68 +36 +37 +74 +51 +61 +80 +42 +34 +57 +60 +83 +72 +98 +36 +48 +50 +67 +100 +44 +57 +44 +45 +41 +46 +206 +60 +64 +56 +65 +54 +70 +46 +63 +45 +34 +43 +37 +51 +59 +214 +45 +331 +42 +39 +65 +47 +71 +44 +42 +38 +50 +59 +214 +45 +329 +40 +539 +56 +45 +83 +80 +65 +59 +58 +52 +73 +69 +52 +30 +73 +51 +59 +270 +46 +48 +39 +80 +47 +45 +74 +68 +73 +54 +60 +83 +62 +72 +67 +53 +46 +62 +71 +60 +81 +56 +65 +39 +85 +49 +78 +33 +312 +35 +49 +220 +60 +103 +249 +454 +52 +80 +248 +60 +71 +79 +59 +67 +79 +72 +51 +77 +52 +53 +82 +54 +39 +62 +52 +60 +61 +45 +60 +85 +79 +63 +57 +68 +50 +51 +77 +46 +57 +56 +55 +43 +48 +72 +52 +70 +71 +73 +49 +63 +45 +49 +56 +65 +78 +56 +56 +87 +217 +59 +46 +43 +426 +53 +69 +52 +32 +66 +52 +75 +52 +70 +63 +62 +57 +36 +55 +45 +57 +36 +57 +54 +63 +64 +71 +59 +55 +65 +68 +87 +59 +41 +66 +55 +54 +37 +42 +88 +56 +63 +64 +39 +39 +86 +39 +57 +63 +71 +50 +39 +72 +66 +59 +235 +233 +225 +34 +213 +39 +252 +231 +37 +255 +43 +42 +59 +331 +48 +44 +54 +54 +37 +40 +55 +44 +60 +49 +98 +65 +43 +50 +74 +69 +35 +35 +51 +61 +56 +49 +69 +56 +46 +74 +47 +67 +65 +50 +46 +66 +66 +45 +47 +53 +66 +62 +49 +56 +53 +43 +48 +59 +46 +48 +72 +49 +47 +87 +46 +56 +73 +75 +50 +89 +77 +43 +59 +37 +54 +50 +45 +68 +54 +69 +63 +43 +33 +46 +36 +36 +60 +42 +54 +49 +41 +422 +56 +497 +315 +50 +353 +46 +289 +332 +62 +57 +690 +720 +57 +41 +70 +83 +49 +42 +59 +36 +50 +41 +65 +42 +48 +68 +64 +79 +40 +33 +68 +63 +52 +73 +71 +52 +86 +64 +34 +51 +45 +67 +61 +66 +50 +75 +40 +68 +69 +55 +69 +46 +43 +51 +70 +69 +51 +53 +73 +64 +52 +61 +90 +46 +49 +49 +53 +90 +84 +61 +33 +68 +84 +80 +60 +60 +54 +58 +47 +48 +47 +65 +63 +90 +40 +65 +64 +44 +45 +48 +63 +74 +60 +64 +58 +45 +72 +58 +71 +47 +79 +55 +36 +53 +55 +50 +48 +70 +57 +55 +71 +46 +38 +57 +43 +30 +44 +33 +57 +36 +68 +51 +59 +44 +45 +43 +41 +39 +55 +55 +42 +64 +57 +41 +63 +48 +30 +53 +40 +31 +43 +37 +31 +43 +54 +42 +47 +64 +70 +65 +60 +34 +62 +68 +68 +52 +40 +50 +63 +61 +41 +85 +62 +60 +55 +42 +80 +50 +63 +77 +53 +53 +82 +75 +46 +59 +47 +55 +41 +47 +43 +29 +40 +44 +41 +70 +62 +70 +51 +62 +48 +60 +62 +82 +87 +72 +69 +64 +37 +69 +49 +72 +64 +48 +86 +51 +41 +58 +36 +41 +49 +72 +69 +66 +44 +39 +35 +240 +45 +211 +40 +54 +52 +57 +57 +57 +46 +39 +406 +61 +415 +370 +50 +373 +50 +271 +331 +440 +193 +52 +96 +83 +230 +330 +70 +70 +290 +76 +68 +64 +49 +29 +343 +46 +45 +39 +53 +45 +34 +44 +44 +47 +51 +44 +57 +67 +46 +113 +58 +53 +52 +60 +55 +109 +121 +107 +72 +40 +44 +116 +52 +100 +43 +50 +55 +80 +47 +52 +84 +62 +59 +83 +89 +60 +64 +84 +60 +91 +68 +92 +84 +60 +73 +97 +62 +40 +52 +61 +66 +56 +57 +57 +38 +67 +52 +51 +41 +54 +281 +67 +49 +60 +61 +53 +94 +32 +59 +60 +69 +57 +62 +53 +76 +57 +57 +76 +74 +58 +75 +43 +38 +40 +43 +69 +63 +47 +55 +67 +69 +67 +40 +53 +72 +72 +57 +79 +35 +66 +53 +87 +58 +66 +79 +73 +57 +66 +53 +56 +64 +79 +78 +69 +68 +62 +54 +55 +69 +48 +32 +78 +63 +46 +49 +62 +71 +70 +69 +99 +60 +57 +63 +66 +53 +49 +59 +57 +52 +42 +47 +60 +47 +58 +52 +37 +46 +42 +45 +64 +36 +35 +40 +50 +42 +38 +77 +54 +38 +60 +55 +81 +50 +63 +84 +49 +55 +74 +67 +74 +56 +38 +74 +54 +74 +50 +63 +43 +60 +69 +39 +71 +55 +94 +88 +70 +78 +54 +59 +59 +58 +51 +58 +62 +67 +52 +62 +41 +55 +62 +51 +49 +57 +53 +45 +69 +46 +43 +57 +51 +69 +59 +46 +73 +61 +34 +88 +59 +49 +43 +66 +97 +50 +79 +62 +63 +44 +63 +43 +40 +87 +59 +69 +82 +53 +66 +57 +76 +45 +94 +121 +342 +385 +30 +374 +205 +42 +32 +133 +368 +135 +359 +337 +127 +40 +48 +111 +55 +214 +124 +246 +128 +41 +134 +111 +59 +67 +42 +59 +46 +64 +45 +73 +1055 +33 +56 +58 +55 +49 +52 +56 +55 +769 +63 +64 +70 +62 +64 +59 +73 +66 +67 +64 +49 +73 +810 +791 +71 +63 +79 +27 +65 +799 +48 +51 +48 +56 +67 +46 +61 +38 +38 +51 +28 +40 +45 +29 +46 +39 +56 +53 +44 +25 +51 +44 +95 +89 +42 +41 +52 +43 +39 +63 +65 +47 +56 +61 +65 +51 +83 +63 +52 +37 +68 +54 +48 +45 +32 +64 +47 +68 +69 +37 +59 +86 +81 +70 +73 +72 +56 +61 +70 +63 +54 +82 +66 +50 +58 +43 +69 +41 +45 +76 +45 +72 +50 +48 +62 +43 +54 +73 +56 +37 +45 +50 +56 +56 +51 +43 +47 +40 +41 +512 +60 +39 +71 +56 +52 +61 +60 +50 +53 +50 +54 +40 +37 +57 +40 +46 +58 +42 +94 +38 +41 +43 +42 +45 +50 +93 +410 +50 +56 +48 +47 +69 +56 +56 +65 +72 +50 +65 +66 +54 +60 +64 +69 +77 +32 +29 +65 +55 +56 +60 +42 +53 +59 +459 +67 +58 +434 +300 +67 +42 +68 +347 +282 +331 +456 +53 +442 +116 +75 +39 +63 +55 +68 +47 +62 +73 +52 +44 +40 +70 +66 +71 +61 +51 +47 +60 +54 +46 +45 +36 +39 +49 +37 +29 +36 +44 +63 +60 +56 +64 +57 +72 +60 +67 +86 +59 +42 +51 +45 +51 +46 +61 +55 +58 +41 +65 +43 +64 +62 +69 +51 +52 +52 +92 +38 +45 +42 +42 +45 +49 +91 +441 +49 +48 +478 +37 +52 +35 +42 +53 +72 +50 +43 +75 +52 +61 +198 +213 +79 +66 +47 +56 +50 +46 +72 +99 +71 +57 +60 +57 +81 +44 +46 +35 +49 +39 +50 +42 +45 +67 +39 +69 +35 +37 +44 +43 +42 +35 +53 +364 +55 +55 +295 +42 +43 +251 +47 +38 +55 +47 +30 +35 +50 +34 +31 +38 +65 +48 +54 +66 +51 +57 +76 +45 +49 +45 +41 +50 +37 +51 +49 +49 +69 +81 +49 +45 +51 +65 +52 +55 +74 +70 +768 +57 +48 +76 +54 +79 +61 +28 +783 +67 +62 +62 +61 +66 +51 +82 +65 +65 +329 +365 +26 +372 +207 +39 +40 +150 +337 +43 +324 +321 +52 +48 +41 +107 +44 +237 +50 +250 +148 +49 +99 +380 +48 +30 +64 +38 +63 +81 +82 +48 +51 +72 +66 +36 +65 +48 +57 +107 +57 +69 +43 +47 +65 +66 +64 +71 +64 +45 +44 +61 +54 +45 +49 +69 +50 +40 +61 +58 +53 +51 +83 +75 +40 +42 +43 +236 +52 +56 +49 +57 +52 +47 +50 +39 +70 +59 +69 +58 +47 +82 +57 +59 +53 +58 +59 +53 +76 +58 +77 +55 +75 +80 +61 +81 +45 +86 +97 +45 +38 +38 +49 +41 +40 +62 +64 +66 +84 +60 +63 +68 +62 +62 +57 +56 +55 +65 +48 +66 +61 +65 +40 +49 +67 +92 +56 +63 +78 +64 +28 +58 +30 +49 +62 +58 +49 +65 +53 +59 +65 +53 +62 +56 +45 +83 +38 +39 +46 +38 +34 +48 +83 +64 +74 +52 +48 +56 +66 +75 +58 +58 +69 +71 +73 +65 +83 +60 +60 +76 +84 +29 +70 +70 +72 +79 +66 +73 +83 +59 +71 +65 +64 +62 +130 +156 +32 +73 +52 +82 +53 +594 +74 +45 +32 +61 +78 +242 +46 +237 +31 +39 +36 +48 +335 +59 +67 +42 +59 +46 +64 +73 +1066 +56 +58 +55 +52 +52 +55 +1057 +39 +59 +44 +30 +51 +60 +32 +53 +51 +36 +34 +59 +45 +49 +58 +48 +58 +51 +75 +36 +48 +50 +29 +357 +34 +49 +56 +34 +57 +64 +42 +71 +68 +90 +51 +59 +71 +56 +56 +61 +66 +89 +33 +54 +62 +81 +64 +56 +53 +59 +57 +48 +89 +64 +62 +62 +39 +41 +59 +50 +63 +59 +73 +90 +44 +67 +66 +39 +50 +45 +38 +51 +60 +39 +69 +53 +70 +48 +56 +60 +686 +31 +72 +55 +62 +51 +58 +58 +49 +57 +43 +42 +41 +48 +54 +429 +502 +306 +46 +65 +49 +338 +67 +298 +325 +41 +502 +414 +45 +122 +57 +459 +33 +115 +34 +53 +42 +41 +53 +71 +31 +60 +66 +80 +82 +67 +69 +75 +57 +72 +77 +41 +47 +57 +39 +53 +50 +51 +59 +36 +52 +46 +52 +76 +80 +58 +48 +66 +47 +45 +60 +28 +61 +55 +50 +47 +81 +48 +43 +55 +41 +58 +46 +57 +58 +55 +57 +54 +62 +37 +63 +33 +33 +39 +37 +41 +49 +63 +43 +63 +66 +75 +68 +62 +76 +46 +62 +44 +81 +405 +61 +384 +68 +50 +38 +39 +56 +79 +58 +59 +38 +58 +47 +55 +61 +37 +57 +71 +74 +61 +71 +44 +100 +53 +34 +48 +45 +49 +43 +39 +38 +33 +53 +58 +63 +72 +48 +48 +44 +42 +51 +59 +44 +47 +49 +43 +53 +40 +40 +52 +52 +61 +41 +70 +58 +52 +47 +57 +49 +54 +56 +85 +38 +69 +66 +45 +57 +74 +55 +52 +48 +42 +61 +59 +44 +46 +52 +78 +44 +41 +85 +77 +54 +42 +56 +62 +38 +54 +51 +54 +62 +49 +68 +49 +53 +51 +43 +56 +48 +35 +35 +59 +42 +42 +46 +115 +46 +330 +137 +41 +64 +51 +60 +55 +54 +58 +61 +78 +29 +55 +55 +44 +61 +52 +58 +59 +38 +54 +78 +40 +56 +41 +56 +37 +58 +59 +67 +45 +50 +63 +63 +82 +75 +66 +42 +51 +52 +48 +48 +45 +54 +38 +375 +62 +58 +88 +58 +62 +91 +363 +254 +80 +32 +246 +265 +39 +241 +39 +52 +376 +342 +107 +97 +388 +45 +102 +377 +52 +37 +73 +81 +76 +93 +63 +80 +73 +64 +44 +63 +48 +53 +226 +33 +54 +49 +54 +56 +42 +51 +75 +60 +65 +46 +49 +46 +45 +42 +38 +44 +62 +47 +45 +39 +56 +58 +44 +40 +50 +33 +68 +33 +36 +38 +34 +53 +134 +36 +64 +70 +42 +55 +83 +47 +73 +65 +65 +54 +67 +49 +66 +66 +76 +47 +62 +42 +63 +34 +36 +56 +65 +70 +45 +65 +57 +54 +63 +55 +52 +57 +48 +70 +46 +52 +45 +49 +90 +60 +64 +46 +56 +69 +88 +40 +56 +45 +42 +69 +48 +59 +75 +75 +70 +51 +52 +75 +44 +65 +55 +42 +68 +53 +66 +45 +52 +55 +48 +44 +43 +46 +66 +59 +64 +67 +67 +64 +51 +44 +55 +87 +61 +53 +32 +55 +27 +42 +63 +27 +60 +49 +42 +45 +66 +56 +42 +74 +51 +67 +59 +47 +58 +43 +46 +49 +43 +56 +32 +32 +49 +46 +42 +72 +88 +59 +82 +69 +58 +58 +46 +84 +72 +62 +38 +41 +74 +44 +53 +43 +63 +44 +705 +52 +443 +58 +38 +38 +35 +54 +41 +40 +75 +42 +48 +34 +52 +50 +58 +56 +45 +62 +75 +954 +46 +51 +65 +45 +69 +56 +58 +273 +48 +75 +51 +59 +61 +73 +66 +62 +72 +75 +71 +55 +82 +91 +48 +58 +50 +60 +56 +61 +67 +48 +164 +66 +72 +37 +67 +75 +76 +45 +59 +85 +52 +59 +76 +70 +72 +36 +45 +52 +41 +57 +75 +77 +30 +37 +50 +60 +50 +83 +83 +56 +77 +75 +36 +72 +45 +44 +83 +36 +41 +41 +39 +35 +31 +46 +65 +53 +33 +63 +60 +59 +43 +49 +52 +67 +62 +63 +56 +48 +66 +42 +72 +44 +42 +55 +50 +36 +50 +60 +59 +74 +82 +58 +62 +52 +58 +57 +55 +99 +53 +42 +25 +396 +148 +60 +146 +367 +234 +298 +43 +278 +47 +64 +278 +54 +380 +365 +118 +132 +438 +153 +400 +55 +319 +77 +323 +41 +66 +41 +51 +36 +68 +193 +50 +93 +76 +230 +330 +68 +70 +291 +69 +58 +64 +49 +29 +343 +46 +896 +71 +52 +70 +54 +77 +66 +34 +32 +47 +37 +32 +56 +31 +40 +57 +39 +73 +60 +85 +89 +53 +85 +72 +71 +50 +104 +53 +77 +54 +53 +64 +75 +50 +56 +51 +66 +62 +32 +45 +37 +60 +51 +56 +50 +65 +59 +83 +46 +71 +53 +72 +63 +41 +54 +57 +48 +44 +32 +49 +43 +39 +40 +32 +56 +88 +42 +62 +83 +56 +53 +49 +64 +54 +56 +57 +52 +44 +48 +81 +48 +58 +60 +83 +65 +40 +69 +70 +54 +56 +50 +43 +64 +61 +83 +48 +53 +57 +50 +45 +60 +58 +56 +54 +80 +44 +54 +52 +59 +49 +50 +47 +61 +39 +29 +55 +52 +71 +32 +31 +149 +44 +61 +49 +55 +149 +34 +26 +35 +270 +53 +62 +64 +96 +41 +46 +109 +299 +377 +51 +119 +58 +338 +232 +35 +289 +34 +102 +316 +325 +117 +34 +295 +313 +225 +58 +241 +50 +38 +55 +57 +39 +35 +73 +74 +65 +73 +50 +46 +49 +45 +45 +66 +363 +69 +63 +57 +53 +76 +42 +65 +64 +54 +44 +35 +77 +40 +57 +70 +62 +62 +54 +50 +41 +62 +47 +48 +47 +34 +60 +41 +44 +45 +86 +77 +91 +47 +80 +37 +43 +53 +42 +60 +55 +44 +61 +45 +44 +65 +57 +62 +44 +73 +58 +55 +73 +75 +59 +49 +60 +53 +54 +65 +66 +50 +54 +49 +59 +65 +65 +54 +62 +41 +263 +68 +84 +70 +68 +56 +71 +217 +65 +46 +60 +62 +81 +41 +53 +54 +42 +58 +54 +68 +37 +63 +55 +61 +49 +50 +64 +55 +62 +49 +51 +39 +67 +60 +58 +54 +35 +49 +62 +71 +40 +70 +70 +36 +60 +88 +55 +42 +67 +105 +83 +56 +46 +67 +48 +47 +46 +50 +36 +38 +59 +42 +42 +64 +56 +41 +55 +242 +54 +68 +44 +47 +42 +83 +43 +60 +52 +72 +819 +49 +90 +71 +57 +50 +68 +64 +43 +49 +42 +54 +42 +61 +81 +43 +58 +56 +44 +36 +45 +34 +70 +216 +40 +536 +345 +343 +54 +40 +55 +56 +93 +71 +32 +49 +39 +35 +28 +40 +68 +34 +38 +47 +77 +63 +63 +40 +45 +62 +42 +34 +41 +54 +54 +63 +76 +52 +52 +62 +61 +48 +76 +91 +44 +85 +62 +92 +41 +80 +60 +62 +54 +54 +57 +45 +35 +43 +55 +31 +34 +39 +41 +37 +293 +45 +47 +49 +38 +36 +66 +61 +47 +55 +60 +56 +579 +42 +35 +49 +46 +48 +38 +47 +65 +71 +769 +53 +48 +51 +61 +30 +786 +67 +61 +60 +65 +783 +49 +73 +45 +32 +30 +35 +42 +37 +34 +46 +65 +91 +53 +74 +29 +49 +55 +47 +44 +316 +52 +339 +27 +339 +198 +34 +555 +442 +44 +56 +423 +203 +255 +51 +367 +341 +49 +40 +34 +519 +62 +52 +55 +57 +41 +65 +70 +61 +69 +84 +73 +62 +54 +65 +68 +52 +66 +38 +92 +51 +43 +75 +59 +70 +83 +64 +84 +67 +76 +78 +39 +39 +46 +33 +80 +67 +54 +58 +54 +52 +68 +73 +61 +57 +61 +54 +56 +41 +83 +99 +128 +136 +121 +104 +49 +39 +121 +113 +131 +54 +108 +187 +138 +126 +140 +111 +143 +126 +109 +54 +87 +68 +58 +65 +80 +42 +66 +48 +41 +63 +37 +61 +72 +75 +56 +68 +54 +62 +66 +41 +76 +79 +43 +57 +58 +53 +61 +50 +63 +73 +63 +83 +44 +43 +44 +38 +226 +45 +496 +353 +351 +57 +50 +513 +57 +80 +83 +59 +46 +46 +48 +44 +54 +33 +65 +36 +49 +29 +42 +33 +37 +44 +48 +37 +43 +35 +30 +40 +34 +48 +68 +66 +69 +57 +72 +64 +91 +73 +74 +51 +53 +40 +41 +44 +62 +51 +55 +40 +50 +51 +53 +51 +63 +66 +43 +43 +70 +56 +44 +41 +59 +51 +47 +68 +69 +65 +57 +77 +59 +45 +56 +39 +40 +48 +61 +42 +45 +80 +64 +40 +65 +65 +38 +64 +69 +67 +49 +71 +49 +64 +51 +50 +54 +50 +45 +67 +73 +474 +51 +63 +56 +46 +57 +60 +58 +89 +49 +56 +69 +53 +46 +66 +72 +46 +49 +89 +44 +244 +46 +237 +597 +59 +52 +44 +57 +48 +51 +62 +47 +71 +63 +46 +57 +65 +714 +68 +61 +70 +50 +63 +57 +42 +52 +63 +41 +54 +51 +33 +66 +51 +74 +73 +48 +64 +67 +46 +68 +68 +47 +77 +75 +75 +40 +40 +52 +52 +52 +40 +40 +65 +75 +67 +63 +53 +67 +58 +72 +75 +74 +52 +66 +61 +64 +42 +49 +65 +80 +62 +76 +58 +71 +52 +42 +42 +32 +40 +39 +69 +64 +44 +53 +69 +58 +45 +57 +60 +43 +69 +64 +42 +37 +66 +59 +53 +62 +47 +74 +70 +37 +78 +58 +55 +67 +32 +40 +91 +66 +73 +38 +75 +50 +68 +50 +60 +47 +94 +43 +59 +58 +61 +52 +64 +85 +57 +46 +59 +49 +72 +83 +46 +65 +43 +39 +46 +46 +40 +37 +52 +352 +58 +54 +283 +40 +43 +48 +28 +241 +363 +77 +41 +48 +48 +61 +77 +54 +65 +86 +51 +66 +67 +48 +115 +36 +69 +66 +52 +66 +44 +50 +66 +70 +75 +48 +61 +58 +89 +62 +55 +54 +66 +87 +87 +69 +72 +50 +54 +734 +52 +81 +59 +54 +76 +74 +80 +53 +52 +89 +64 +46 +82 +55 +60 +75 +64 +44 +34 +43 +37 +51 +59 +214 +45 +331 +42 +539 +534 +49 +44 +43 +40 +54 +340 +348 +297 +61 +60 +42 +49 +46 +60 +60 +57 +62 +61 +51 +37 +70 +48 +71 +49 +46 +43 +35 +37 +57 +50 +38 +72 +60 +46 +35 +62 +44 +61 +68 +80 +58 +51 +72 +53 +52 +58 +49 +55 +62 +49 +44 +46 +41 +43 +34 +43 +52 +46 +37 +26 +44 +49 +54 +335 +35 +64 +42 +49 +503 +52 +45 +61 +60 +46 +32 +64 +40 +48 +38 +44 +46 +48 +72 +50 +55 +62 +61 +45 +42 +54 +62 +63 +57 +46 +36 +74 +65 +79 +61 +59 +52 +39 +45 +49 +64 +51 +115 +62 +49 +39 +48 +120 +181 +39 +194 +117 +47 +59 +43 +79 +52 +64 +82 +78 +738 +86 +64 +39 +37 +41 +66 +63 +73 +69 +44 +39 +48 +45 +55 +56 +48 +49 +49 +39 +62 +69 +70 +35 +80 +55 +60 +55 +66 +39 +55 +74 +67 +50 +77 +87 +160 +88 +81 +55 +57 +53 +39 +54 +51 +54 +51 +60 +70 +42 +48 +32 +44 +50 +53 +39 +55 +48 +40 +37 +44 +38 +44 +70 +55 +45 +42 +60 +55 +68 +66 +43 +46 +52 +337 +51 +363 +31 +350 +208 +376 +107 +348 +363 +104 +45 +41 +212 +112 +44 +249 +43 +389 +331 +105 +44 +371 +42 +61 +44 +61 +49 +43 +44 +33 +45 +46 +66 +40 +61 +323 +61 +33 +42 +29 +35 +59 +45 +32 +56 +33 +43 +33 +44 +47 +36 +33 +36 +70 +77 +72 +62 +53 +47 +43 +69 +65 +70 +50 +59 +115 +63 +49 +68 +73 +716 +84 +70 +52 +62 +49 +67 +71 +69 +73 +47 +47 +302 +55 +38 +61 +51 +85 +56 +38 +56 +55 +246 +254 +244 +198 +40 +262 +252 +264 +46 +32 +40 +53 +311 +51 +36 +47 +510 +264 +46 +250 +44 +109 +260 +54 +261 +81 +59 +56 +71 +77 +57 +49 +55 +49 +34 +49 +64 +67 +50 +610 +47 +48 +692 +92 +605 +68 +42 +57 +62 +58 +54 +88 +53 +53 +49 +50 +88 +698 +49 +32 +41 +97 +388 +134 +57 +135 +155 +51 +363 +237 +298 +49 +275 +133 +282 +375 +345 +109 +129 +418 +151 +41 +402 +337 +511 +234 +112 +26 +32 +30 +40 +30 +29 +69 +69 +60 +58 +51 +63 +73 +44 +77 +59 +72 +72 +50 +47 +385 +62 +61 +387 +286 +287 +37 +47 +248 +37 +37 +54 +294 +380 +45 +358 +404 +48 +390 +480 +342 +248 +363 +35 +48 +42 +33 +69 +53 +53 +37 +53 +42 +60 +67 +72 +82 +61 +49 +80 +60 +49 +57 +54 +72 +59 +57 +50 +62 +52 +75 +66 +46 +58 +57 +63 +55 +63 +45 +45 +82 +45 +45 +49 +47 +40 +69 +57 +87 +57 +54 +48 +50 +59 +63 +49 +59 +50 +56 +86 +48 +51 +51 +46 +48 +49 +60 +66 +52 +43 +49 +57 +77 +46 +47 +62 +56 +51 +46 +73 +58 +54 +42 +51 +76 +46 +59 +52 +48 +41 +231 +68 +36 +54 +69 +43 +37 +47 +56 +40 +46 +113 +63 +86 +46 +52 +480 +42 +62 +64 +78 +35 +52 +39 +48 +68 +55 +265 +482 +36 +46 +36 +36 +45 +42 +29 +34 +70 +388 +443 +54 +35 +434 +205 +333 +30 +65 +313 +314 +129 +45 +72 +237 +260 +48 +113 +390 +50 +369 +56 +39 +337 +142 +27 +364 +278 +30 +38 +38 +48 +39 +30 +47 +49 +29 +33 +38 +61 +43 +53 +69 +62 +73 +81 +56 +71 +73 +73 +76 +51 +77 +61 +55 +46 +71 +62 +58 +72 +47 +75 +29 +60 +57 +61 +36 +26 +108 +52 +51 +39 +35 +64 +56 +43 +40 +49 +61 +51 +60 +46 +56 +71 +61 +42 +49 +49 +33 +38 +38 +43 +28 +39 +38 +48 +47 +49 +47 +54 +45 +58 +65 +51 +42 +78 +30 +36 +41 +51 +44 +48 +47 +56 +45 +34 +49 +56 +61 +54 +35 +48 +36 +45 +50 +47 +54 +46 +34 +48 +38 +34 +91 +57 +44 +60 +60 +70 +81 +54 +42 +49 +53 +64 +54 +83 +42 +241 +75 +47 +53 +61 +39 +52 +50 +36 +57 +36 +41 +70 +43 +30 +48 +69 +49 +54 +53 +39 +62 +44 +55 +55 +59 +52 +89 +53 +55 +48 +38 +49 +68 +46 +62 +45 +67 +50 +51 +37 +42 +38 +63 +36 +63 +56 +49 +45 +49 +76 +49 +59 +52 +58 +68 +67 +60 +56 +59 +111 +52 +75 +43 +54 +50 +57 +67 +59 +58 +55 +67 +67 +49 +62 +39 +43 +112 +62 +69 +61 +64 +52 +51 +75 +77 +70 +46 +54 +51 +48 +71 +48 +51 +72 +67 +48 +46 +51 +508 +61 +49 +76 +84 +60 +34 +53 +31 +61 +47 +45 +34 +236 +244 +234 +38 +200 +31 +246 +238 +263 +38 +36 +57 +319 +47 +462 +38 +248 +38 +252 +52 +73 +33 +59 +252 +46 +156 +256 +450 +262 +73 +53 +63 +821 +71 +46 +60 +76 +50 +34 +89 +67 +55 +64 +60 +34 +53 +53 +86 +48 +68 +47 +59 +63 +69 +69 +61 +47 +37 +39 +34 +76 +60 +51 +60 +56 +79 +59 +76 +59 +98 +76 +61 +77 +130 +49 +81 +105 +42 +77 +51 +94 +63 +64 +53 +57 +130 +73 +57 +57 +49 +27 +68 +71 +58 +64 +62 +52 +50 +61 +73 +80 +61 +63 +71 +75 +52 +71 +80 +540 +57 +52 +48 +43 +54 +43 +65 +75 +56 +33 +60 +453 +53 +68 +76 +57 +62 +66 +60 +71 +81 +45 +54 +57 +69 +59 +448 +40 +50 +53 +192 +45 +53 +51 +58 +76 +71 +54 +57 +47 +252 +233 +238 +47 +205 +50 +33 +234 +53 +227 +43 +41 +38 +246 +46 +34 +56 +330 +44 +427 +47 +99 +238 +46 +240 +55 +132 +238 +50 +157 +231 +410 +110 +58 +48 +239 +460 +51 +64 +49 +76 +105 +48 +68 +61 +45 +57 +49 +46 +96 +79 +74 +49 +61 +80 +63 +95 +98 +68 +888 +92 +52 +63 +72 +75 +103 +56 +48 +57 +86 +50 +63 +79 +56 +62 +61 +69 +59 +52 +67 +61 +55 +72 +64 +61 +68 +76 +84 +51 +41 +78 +60 +65 +63 +50 +72 +60 +65 +71 +76 +51 +80 +63 +70 +78 +66 +51 +75 +70 +44 +96 +65 +52 +83 +70 +59 +75 +61 +47 +27 +91 +37 +64 +79 +64 +50 +75 +66 +182 +61 +61 +39 +48 +48 +39 +39 +48 +34 +46 +44 +41 +51 +58 +60 +60 +67 +63 +40 +54 +56 +42 +59 +55 +65 +62 +78 +49 +73 +37 +58 +46 +67 +42 +39 +363 +65 +141 +137 +55 +169 +344 +40 +232 +65 +68 +59 +291 +32 +42 +294 +136 +270 +370 +51 +356 +131 +108 +414 +153 +387 +50 +320 +68 +487 +239 +122 +31 +463 +44 +333 +105 +52 +78 +61 +33 +66 +84 +76 +51 +44 +63 +42 +71 +39 +68 +71 +57 +68 +36 +49 +66 +60 +59 +65 +70 +67 +35 +46 +68 +48 +41 +38 +39 +34 +33 +38 +46 +69 +53 +31 +46 +445 +52 +56 +45 +54 +49 +52 +70 +65 +70 +43 +56 +60 +79 +43 +83 +64 +64 +58 +59 +45 +35 +70 +45 +75 +554 +48 +67 +575 +304 +72 +54 +53 +45 +36 +54 +37 +40 +36 +52 +64 +81 +37 +63 +100 +68 +144 +49 +101 +73 +98 +49 +83 +54 +76 +68 +54 +54 +55 +65 +58 +60 +45 +144 +114 +913 +44 +57 +50 +49 +45 +52 +51 +61 +46 +42 +58 +70 +82 +44 +36 +42 +58 +45 +46 +46 +43 +45 +44 +44 +39 +36 +52 +38 +31 +44 +234 +62 +60 +29 +150 +46 +56 +53 +63 +52 +48 +80 +56 +37 +84 +63 +49 +58 +49 +56 +52 +37 +38 +101 +37 +29 +52 +76 +86 +44 +59 +66 +63 +45 +56 +58 +58 +57 +56 +53 +57 +68 +54 +57 +76 +47 +54 +56 +313 +374 +31 +360 +199 +44 +37 +151 +328 +58 +317 +313 +62 +45 +57 +266 +142 +50 +120 +385 +59 +454 +46 +336 +146 +347 +275 +377 +271 +238 +86 +60 +52 +55 +55 +84 +66 +60 +53 +40 +64 +47 +68 +59 +75 +37 +45 +35 +45 +70 +160 +55 +58 +194 +54 +146 +58 +45 +47 +45 +48 +102 +38 +46 +52 +48 +54 +64 +44 +43 +53 +37 +64 +40 +56 +41 +58 +51 +63 +37 +33 +49 +75 +67 +48 +47 +49 +49 +28 +60 +42 +44 +47 +44 +60 +55 +69 +55 +48 +55 +40 +67 +58 +44 +45 +52 +59 +69 +53 +51 +49 +45 +57 +52 +31 +37 +38 +40 +52 +53 +72 +70 +44 +58 +61 +57 +60 +54 +59 +62 +46 +86 +47 +67 +61 +60 +94 +47 +77 +45 +54 +76 +47 +51 +52 +45 +44 +45 +55 +75 +67 +58 +62 +61 +58 +49 +53 +62 +60 +29 +150 +46 +56 +53 +63 +52 +48 +80 +56 +573 +49 +46 +67 +72 +48 +66 +69 +82 +74 +72 +73 +88 +59 +65 +92 +62 +50 +37 +65 +57 +40 +74 +44 +66 +82 +77 +68 +33 +73 +54 +50 +80 +78 +44 +52 +53 +55 +40 +46 +60 +63 +63 +48 +51 +52 +32 +50 +63 +50 +59 +63 +57 +65 +98 +100 +37 +58 +66 +56 +47 +40 +98 +59 +48 +65 +64 +42 +41 +54 +69 +48 +71 +42 +42 +62 +46 +52 +56 +53 +55 +49 +31 +55 +63 +64 +50 +60 +31 +44 +63 +58 +41 +61 +53 +63 +60 +48 +62 +45 +39 +63 +37 +60 +60 +60 +54 +50 +50 +44 +74 +58 +57 +65 +41 +70 +58 +51 +60 +62 +53 +71 +59 +57 +48 +41 +45 +57 +36 +49 +55 +77 +41 +68 +45 +88 +60 +39 +58 +55 +68 +41 +32 +48 +48 +45 +48 +42 +60 +117 +37 +49 +45 +75 +41 +62 +37 +54 +72 +36 +49 +36 +54 +45 +70 +55 +54 +42 +40 +46 +44 +54 +38 +46 +50 +57 +82 +49 +81 +59 +83 +76 +53 +270 +44 +45 +72 +61 +58 +68 +63 +40 +55 +52 +52 +47 +58 +59 +71 +61 +69 +69 +66 +58 +47 +44 +59 +46 +61 +74 +51 +68 +78 +32 +69 +43 +66 +58 +62 +62 +71 +45 +62 +87 +59 +46 +68 +67 +84 +54 +64 +60 +65 +59 +52 +55 +105 +58 +57 +65 +51 +48 +41 +59 +49 +66 +56 +48 +50 +53 +67 +69 +57 +80 +58 +61 +46 +92 +48 +64 +69 +84 +50 +42 +41 +48 +44 +41 +41 +39 +56 +33 +52 +61 +48 +55 +65 +62 +54 +66 +51 +47 +54 +65 +62 +65 +59 +55 +49 +68 +43 +51 +71 +60 +66 +43 +58 +75 +57 +69 +68 +57 +56 +64 +62 +68 +43 +61 +47 +53 +59 +61 +48 +61 +63 +43 +41 +45 +38 +51 +69 +48 +58 +509 +42 +55 +406 +437 +63 +35 +53 +54 +35 +32 +43 +53 +41 +45 +48 +36 +34 +38 +38 +42 +51 +52 +52 +56 +57 +47 +68 +56 +33 +45 +43 +67 +52 +40 +59 +40 +60 +75 +31 +48 +51 +38 +72 +52 +559 +59 +81 +84 +72 +559 +55 +71 +51 +38 +29 +47 +31 +178 +55 +119 +144 +143 +51 +54 +144 +58 +50 +46 +56 +70 +63 +60 +81 +56 +67 +70 +65 +69 +56 +63 +50 +65 +77 +75 +63 +69 +59 +90 +46 +64 +53 +58 +72 +49 +57 +65 +33 +35 +56 +56 +49 +67 +67 +72 +57 +59 +67 +75 +81 +54 +69 +41 +45 +45 +61 +80 +57 +47 +52 +50 +50 +344 +60 +85 +82 +55 +44 +54 +60 +60 +48 +51 +80 +84 +98 +84 +67 +74 +50 +87 +62 +39 +49 +104 +49 +67 +74 +53 +47 +67 +63 +60 +42 +50 +70 +65 +68 +78 +51 +38 +65 +71 +90 +59 +61 +59 +70 +40 +67 +71 +50 +75 +63 +36 +78 +71 +38 +97 +51 +77 +53 +67 +75 +25 +53 +45 +90 +85 +83 +52 +56 +98 +55 +56 +61 +81 +62 +58 +47 +65 +48 +854 +71 +62 +43 +54 +65 +64 +61 +65 +73 +65 +88 +65 +48 +69 +65 +69 +67 +65 +59 +76 +44 +56 +46 +54 +62 +58 +43 +68 +46 +52 +54 +66 +82 +47 +62 +60 +49 +58 +43 +43 +41 +82 +47 +60 +43 +63 +50 +56 +710 +52 +448 +58 +44 +43 +715 +52 +47 +48 +39 +38 +39 +46 +37 +52 +41 +56 +51 +95 +34 +78 +54 +40 +52 +48 +43 +52 +59 +51 +36 +63 +74 +51 +54 +72 +39 +62 +60 +69 +59 +47 +66 +48 +58 +40 +45 +71 +79 +31 +65 +74 +57 +71 +89 +81 +69 +65 +69 +84 +57 +44 +41 +47 +189 +48 +36 +45 +38 +43 +37 +46 +38 +41 +41 +45 +63 +61 +50 +52 +38 +79 +51 +46 +77 +83 +72 +52 +57 +48 +50 +32 +41 +73 +55 +35 +46 +41 +59 +44 +57 +63 +75 +68 +62 +61 +33 +60 +72 +60 +97 +36 +49 +42 +56 +44 +37 +41 +74 +78 +38 +75 +48 +48 +61 +64 +73 +531 +37 +40 +64 +50 +48 +42 +52 +175 +68 +56 +45 +96 +53 +68 +79 +92 +53 +67 +49 +84 +74 +74 +78 +80 +75 +49 +59 +63 +48 +47 +72 +50 +38 +49 +58 +70 +57 +42 +51 +50 +49 +58 +42 +78 +62 +72 +68 +65 +72 +73 +43 +64 +233 +223 +158 +33 +188 +196 +214 +38 +34 +44 +281 +47 +386 +37 +36 +225 +38 +204 +51 +47 +41 +198 +44 +209 +395 +225 +402 +377 +220 +39 +45 +32 +314 +34 +43 +42 +64 +61 +74 +65 +45 +52 +64 +51 +79 +77 +67 +72 +64 +56 +57 +87 +54 +69 +77 +41 +72 +33 +54 +316 +54 +313 +47 +36 +49 +33 +31 +29 +33 +63 +54 +40 +71 +45 +52 +51 +56 +80 +67 +67 +63 +59 +43 +57 +36 +52 +33 +63 +60 +47 +40 +67 +44 +53 +37 +51 +56 +72 +48 +48 +54 +59 +48 +50 +68 +49 +35 +67 +56 +53 +86 +50 +40 +50 +65 +59 +78 +41 +77 +41 +45 +83 +51 +76 +52 +56 +75 +65 +43 +83 +43 +58 +71 +79 +74 +74 +603 +52 +170 +54 +65 +58 +50 +56 +620 +60 +592 +46 +56 +50 +78 +44 +47 +33 +41 +33 +42 +47 +48 +51 +41 +68 +70 +53 +48 +51 +76 +65 +81 +53 +66 +61 +68 +40 +48 +50 +59 +67 +77 +58 +66 +94 +70 +68 +52 +53 +41 +45 +52 +66 +39 +80 +61 +53 +72 +34 +59 +45 +39 +62 +51 +56 +62 +61 +77 +58 +55 +731 +55 +68 +47 +46 +67 +65 +44 +50 +66 +59 +52 +48 +44 +293 +50 +59 +62 +48 +32 +56 +40 +59 +75 +52 +58 +45 +47 +46 +59 +56 +66 +62 +43 +50 +42 +52 +63 +69 +52 +47 +49 +38 +36 +66 +61 +47 +55 +60 +56 +48 +47 +60 +49 +71 +60 +45 +52 +49 +66 +56 +46 +63 +447 +72 +43 +64 +51 +52 +48 +58 +49 +56 +50 +39 +54 +61 +62 +50 +58 +34 +73 +64 +56 +53 +56 +48 +34 +58 +55 +50 +62 +62 +56 +62 +37 +58 +42 +72 +54 +50 +74 +39 +49 +42 +56 +60 +34 +60 +59 +54 +51 +45 +63 +51 +59 +51 +48 +62 +69 +57 +53 +72 +55 +65 +71 +73 +58 +66 +58 +59 +59 +27 +60 +35 +69 +67 +76 +59 +70 +94 +48 +53 +37 +59 +60 +58 +59 +67 +52 +42 +77 +53 +52 +60 +51 +67 +40 +81 +58 +39 +85 +95 +59 +55 +84 +73 +291 +30 +66 +58 +42 +79 +65 +42 +91 +60 +38 +51 +53 +38 +51 +65 +71 +67 +60 +90 +53 +56 +70 +60 +60 +57 +60 +52 +60 +66 +51 +38 +32 +355 +36 +44 +57 +44 +38 +44 +34 +72 +223 +40 +528 +346 +344 +53 +557 +500 +341 +58 +56 +40 +34 +35 +34 +54 +38 +52 +50 +43 +50 +52 +47 +69 +60 +37 +57 +43 +59 +70 +63 +71 +40 +57 +66 +68 +66 +58 +59 +54 +40 +41 +58 +47 +42 +40 +68 +59 +47 +46 +76 +82 +73 +49 +71 +43 +68 +74 +61 +72 +48 +45 +76 +58 +57 +53 +63 +61 +60 +55 +58 +70 +66 +59 +85 +62 +52 +42 +52 +64 +50 +52 +53 +52 +42 +77 +87 +63 +78 +61 +62 +51 +51 +56 +41 +69 +54 +61 +74 +59 +46 +74 +57 +48 +48 +68 +43 +53 +69 +54 +58 +54 +44 +38 +43 +43 +60 +72 +59 +58 +63 +49 +53 +62 +49 +62 +61 +44 +68 +68 +63 +66 +83 +65 +66 +70 +53 +54 +67 +55 +55 +66 +64 +56 +56 +57 +58 +53 +64 +57 +57 +58 +79 +51 +58 +58 +74 +47 +315 +65 +59 +57 +81 +115 +70 +75 +59 +65 +61 +149 +320 +75 +248 +68 +94 +89 +50 +61 +65 +62 +34 +37 +37 +67 +48 +39 +57 +57 +49 +51 +53 +63 +52 +217 +55 +239 +713 +48 +468 +321 +76 +315 +279 +46 +67 +53 +44 +61 +71 +39 +59 +37 +44 +60 +54 +35 +51 +27 +42 +42 +47 +37 +46 +50 +47 +77 +66 +60 +66 +71 +62 +68 +54 +56 +58 +61 +39 +68 +77 +55 +49 +232 +240 +230 +206 +47 +225 +242 +41 +48 +233 +47 +40 +40 +40 +314 +38 +471 +91 +256 +47 +242 +45 +110 +228 +40 +40 +240 +483 +108 +50 +247 +423 +377 +107 +251 +42 +59 +367 +285 +84 +65 +62 +46 +53 +890 +277 +69 +78 +68 +50 +41 +43 +39 +55 +43 +40 +59 +40 +54 +71 +52 +42 +41 +68 +78 +67 +42 +279 +73 +70 +46 +74 +65 +48 +48 +60 +39 +51 +56 +86 +61 +67 +56 +62 +55 +55 +63 +49 +33 +326 +57 +94 +33 +86 +52 +66 +34 +58 +50 +61 +55 +48 +40 +62 +655 +56 +63 +63 +74 +50 +48 +63 +57 +58 +44 +59 +728 +36 +48 +46 +62 +52 +82 +36 +55 +57 +49 +60 +79 +51 +47 +55 +70 +62 +50 +55 +76 +63 +70 +57 +40 +68 +66 +59 +71 +67 +44 +61 +40 +71 +40 +44 +110 +42 +36 +40 +119 +52 +60 +68 +47 +32 +51 +51 +55 +52 +46 +49 +68 +73 +66 +56 +71 +47 +77 +77 +61 +55 +81 +53 +80 +59 +48 +60 +65 +37 +44 +53 +54 +44 +53 +70 +66 +62 +84 +49 +48 +53 +44 +59 +58 +46 +43 +43 +45 +62 +43 +51 +49 +49 +42 +51 +328 +60 +46 +34 +110 +56 +40 +32 +117 +332 +458 +404 +28 +282 +52 +45 +329 +347 +46 +374 +133 +332 +154 +58 +342 +281 +418 +34 +127 +125 +281 +313 +75 +285 +157 +47 +69 +60 +58 +51 +63 +73 +46 +73 +61 +72 +72 +49 +46 +44 +67 +78 +52 +31 +59 +72 +79 +59 +39 +63 +57 +44 +36 +36 +39 +42 +47 +54 +35 +43 +54 +58 +41 +32 +71 +50 +68 +70 +68 +61 +42 +42 +47 +39 +47 +58 +69 +33 +61 +51 +74 +78 +39 +66 +55 +57 +369 +51 +49 +42 +40 +35 +36 +56 +39 +41 +41 +46 +40 +187 +168 +45 +27 +48 +53 +51 +53 +566 +61 +51 +548 +72 +69 +47 +53 +80 +42 +45 +71 +49 +51 +43 +72 +43 +78 +54 +52 +61 +47 +68 +73 +76 +44 +46 +74 +50 +77 +72 +121 +48 +46 +45 +114 +165 +47 +50 +399 +223 +213 +213 +32 +226 +233 +213 +44 +233 +55 +59 +65 +68 +76 +74 +60 +52 +37 +76 +55 +66 +54 +48 +46 +35 +51 +63 +66 +44 +65 +44 +67 +60 +57 +73 +54 +71 +49 +45 +67 +60 +54 +70 +65 +36 +56 +52 +90 +57 +55 +60 +59 +42 +46 +38 +52 +40 +66 +78 +58 +52 +44 +42 +45 +54 +64 +76 +58 +43 +39 +49 +226 +46 +41 +39 +35 +33 +41 +49 +223 +33 +37 +228 +34 +46 +55 +39 +46 +40 +34 +51 +36 +55 +80 +55 +68 +52 +71 +69 +66 +69 +53 +52 +89 +70 +89 +71 +45 +86 +75 +58 +74 +56 +65 +125 +65 +52 +58 +75 +72 +64 +23 +85 +35 +76 +70 +48 +67 +64 +69 +62 +79 +51 +53 +52 +66 +60 +58 +29 +46 +63 +75 +41 +67 +69 +67 +64 +48 +64 +73 +66 +62 +39 +70 +50 +46 +37 +39 +38 +63 +36 +63 +56 +48 +49 +35 +48 +51 +29 +48 +48 +54 +37 +44 +50 +59 +39 +68 +331 +44 +51 +42 +55 +46 +51 +50 +45 +79 +43 +42 +34 +52 +48 +38 +46 +50 +39 +43 +43 +37 +47 +35 +59 +54 +62 +56 +58 +56 +31 +85 +43 +49 +47 +37 +30 +41 +34 +366 +51 +62 +60 +53 +42 +75 +50 +63 +77 +52 +53 +82 +75 +46 +43 +97 +57 +54 +58 +52 +47 +52 +48 +63 +388 +460 +48 +35 +396 +51 +54 +68 +38 +43 +29 +60 +359 +46 +56 +466 +27 +61 +456 +46 +210 +52 +39 +322 +120 +31 +296 +276 +141 +46 +47 +129 +251 +133 +43 +53 +253 +39 +125 +376 +46 +366 +90 +144 +116 +40 +326 +137 +323 +264 +134 +429 +34 +256 +242 +140 +365 +40 +56 +223 +56 +61 +246 +131 +37 +44 +41 +41 +31 +71 +30 +63 +83 +69 +47 +76 +50 +65 +77 +75 +59 +60 +67 +70 +46 +57 +78 +49 +70 +65 +47 +54 +84 +47 +40 +65 +514 +75 +70 +57 +33 +54 +313 +362 +363 +178 +269 +118 +30 +41 +45 +264 +239 +121 +48 +221 +232 +110 +302 +302 +37 +109 +277 +136 +151 +288 +229 +366 +238 +207 +299 +43 +51 +210 +108 +360 +41 +71 +51 +81 +48 +44 +51 +53 +43 +57 +51 +57 +30 +74 +51 +44 +46 +64 +80 +49 +58 +36 +58 +47 +48 +51 +45 +58 +56 +43 +43 +65 +66 +45 +55 +51 +48 +45 +53 +51 +53 +566 +61 +51 +548 +72 +69 +47 +769 +62 +38 +72 +56 +41 +33 +40 +77 +50 +38 +52 +35 +64 +62 +78 +42 +39 +55 +48 +59 +44 +59 +73 +42 +65 +66 +62 +58 +66 +31 +39 +35 +72 +50 +56 +71 +46 +52 +67 +87 +36 +39 +52 +62 +58 +72 +47 +57 +28 +51 +56 +46 +49 +69 +40 +310 +49 +64 +62 +292 +74 +60 +52 +49 +52 +57 +53 +277 +50 +43 +277 +61 +61 +71 +44 +53 +86 +37 +42 +87 +56 +46 +41 +67 +46 +68 +66 +63 +49 +65 +43 +67 +58 +68 +69 +63 +45 +99 +50 +60 +65 +57 +61 +45 +51 +73 +62 +81 +85 +71 +67 +78 +70 +49 +54 +75 +70 +44 +61 +69 +79 +64 +44 +77 +70 +121 +58 +35 +60 +54 +57 +43 +58 +58 +78 +56 +70 +59 +365 +41 +52 +55 +33 +46 +43 +201 +47 +58 +31 +43 +69 +73 +47 +66 +239 +69 +43 +59 +84 +49 +54 +48 +58 +55 +45 +57 +55 +55 +57 +65 +56 +54 +57 +52 +71 +59 +39 +42 +57 +40 +59 +44 +51 +39 +61 +76 +60 +45 +47 +44 +44 +29 +43 +38 +47 +55 +60 +37 +52 +85 +48 +41 +69 +80 +83 +103 +73 +101 +102 +71 +59 +42 +50 +47 +48 +66 +60 +68 +75 +55 +51 +45 +50 +70 +52 +45 +49 +53 +36 +30 +33 +33 +57 +75 +67 +62 +79 +49 +71 +51 +55 +56 +52 +65 +68 +48 +31 +46 +62 +53 +62 +51 +70 +37 +41 +33 +117 +61 +43 +67 +61 +57 +65 +53 +46 +68 +55 +77 +37 +51 +51 +34 +48 +41 +57 +43 +57 +39 +55 +53 +42 +67 +51 +51 +58 +56 +42 +52 +45 +62 +65 +78 +56 +45 +77 +36 +65 +49 +51 +53 +52 +41 +49 +76 +58 +61 +60 +71 +48 +39 +72 +68 +72 +61 +62 +59 +46 +41 +40 +66 +55 +57 +123 +62 +47 +27 +44 +65 +42 +60 +64 +48 +74 +50 +67 +65 +49 +50 +57 +53 +65 +64 +64 +59 +59 +46 +80 +38 +63 +46 +60 +48 +56 +41 +43 +71 +43 +50 +75 +43 +49 +60 +58 +580 +52 +67 +33 +60 +54 +67 +48 +45 +55 +51 +93 +46 +54 +38 +66 +66 +72 +58 +69 +69 +64 +92 +79 +65 +65 +58 +58 +37 +54 +61 +50 +58 +62 +53 +55 +63 +63 +333 +213 +39 +58 +71 +64 +47 +67 +64 +54 +64 +65 +59 +56 +52 +82 +49 +57 +95 +53 +54 +49 +58 +65 +48 +56 +74 +57 +49 +40 +70 +51 +89 +56 +314 +63 +346 +58 +30 +46 +341 +182 +49 +48 +372 +128 +338 +332 +93 +115 +213 +113 +59 +247 +50 +40 +48 +375 +316 +48 +109 +374 +27 +53 +447 +263 +347 +42 +255 +240 +334 +63 +205 +222 +41 +64 +319 +308 +83 +52 +35 +71 +54 +40 +46 +42 +34 +57 +32 +48 +31 +31 +31 +128 +37 +47 +51 +60 +64 +41 +58 +39 +56 +70 +61 +50 +48 +53 +74 +79 +42 +54 +76 +92 +32 +64 +61 +49 +49 +62 +42 +38 +65 +36 +55 +43 +34 +123 +34 +36 +336 +350 +32 +34 +59 +62 +70 +40 +47 +59 +71 +80 +65 +48 +50 +64 +58 +77 +59 +55 +35 +43 +47 +38 +57 +50 +51 +54 +29 +55 +51 +33 +62 +49 +52 +56 +48 +45 +58 +70 +51 +52 +65 +55 +35 +65 +51 +53 +47 +39 +61 +59 +84 +42 +58 +46 +48 +54 +68 +46 +42 +51 +46 +68 +57 +59 +59 +57 +59 +48 +59 +53 +49 +49 +42 +42 +54 +53 +40 +69 +56 +53 +53 +77 +56 +49 +54 +40 +56 +49 +56 +47 +26 +36 +41 +44 +58 +54 +59 +51 +44 +77 +56 +57 +67 +63 +90 +73 +52 +60 +88 +54 +63 +54 +55 +44 +72 +76 +56 +51 +58 +60 +62 +125 +46 +44 +58 +62 +75 +85 +71 +112 +58 +55 +60 +54 +62 +54 +71 +79 +59 +53 +56 +83 +62 +58 +63 +37 +57 +279 +67 +79 +652 +60 +73 +68 +70 +50 +82 +58 +33 +66 +46 +63 +85 +64 +75 +53 +39 +63 +44 +58 +35 +48 +68 +66 +42 +46 +62 +32 +42 +50 +66 +64 +72 +55 +65 +57 +58 +56 +62 +43 +64 +59 +49 +55 +49 +59 +46 +44 +46 +55 +65 +49 +74 +54 +68 +52 +64 +57 +51 +44 +102 +67 +55 +45 +39 +52 +33 +47 +68 +25 +44 +60 +53 +69 +94 +41 +32 +68 +58 +83 +71 +76 +49 +70 +59 +73 +51 +78 +39 +50 +63 +59 +43 +55 +59 +60 +45 +61 +75 +44 +98 +52 +45 +68 +102 +47 +51 +66 +59 +41 +95 +53 +76 +58 +72 +51 +42 +35 +43 +55 +61 +43 +58 +47 +50 +56 +79 +55 +84 +63 +40 +47 +47 +61 +49 +69 +821 +802 +64 +55 +59 +83 +27 +61 +810 +48 +50 +44 +57 +69 +59 +811 +70 +44 +58 +59 +56 +68 +44 +62 +73 +38 +68 +66 +41 +63 +58 +68 +34 +50 +43 +66 +74 +38 +61 +45 +56 +34 +44 +39 +275 +47 +41 +39 +281 +31 +50 +44 +53 +53 +40 +47 +39 +34 +70 +42 +64 +72 +60 +53 +49 +49 +53 +67 +67 +54 +42 +32 +52 +53 +44 +48 +78 +52 +55 +59 +50 +46 +79 +53 +72 +60 +70 +84 +35 +52 +61 +67 +78 +62 +64 +36 +48 +64 +54 +89 +65 +56 +37 +71 +60 +53 +55 +56 +77 +69 +53 +64 +53 +137 +42 +53 +44 +56 +47 +34 +38 +233 +245 +29 +48 +42 +42 +29 +66 +89 +66 +49 +63 +49 +38 +45 +41 +52 +60 +36 +67 +45 +59 +29 +56 +54 +62 +646 +58 +615 +80 +643 +77 +47 +57 +65 +54 +84 +609 +67 +61 +84 +58 +70 +58 +99 +50 +61 +71 +89 +62 +67 +72 +57 +69 +55 +72 +54 +60 +43 +47 +44 +43 +48 +47 +78 +50 +49 +65 +40 +45 +62 +40 +32 +79 +45 +53 +41 +49 +80 +49 +57 +42 +46 +38 +37 +55 +55 +47 +49 +51 +688 +672 +56 +63 +673 +73 +86 +49 +69 +822 +803 +61 +53 +63 +78 +27 +61 +811 +48 +51 +44 +57 +66 +59 +812 +69 +47 +57 +59 +53 +823 +46 +60 +47 +639 +157 +54 +38 +123 +169 +61 +35 +54 +62 +69 +70 +52 +73 +53 +42 +54 +56 +50 +44 +40 +69 +57 +45 +71 +75 +67 +50 +45 +50 +49 +43 +47 +65 +44 +48 +36 +62 +68 +361 +88 +68 +43 +65 +52 +75 +77 +67 +61 +43 +44 +43 +39 +58 +48 +54 +80 +76 +92 +63 +36 +59 +66 +54 +43 +43 +42 +31 +58 +74 +60 +56 +57 +48 +60 +48 +57 +56 +70 +60 +62 +60 +68 +75 +57 +57 +57 +51 +49 +60 +69 +58 +58 +58 +67 +64 +61 +62 +84 +67 +81 +37 +50 +71 +37 +51 +66 +60 +64 +57 +65 +58 +58 +30 +53 +58 +56 +60 +67 +67 +49 +49 +58 +58 +48 +50 +46 +43 +71 +50 +57 +57 +49 +65 +53 +45 +44 +49 +57 +30 +26 +47 +54 +38 +48 +54 +38 +49 +49 +41 +66 +76 +32 +47 +62 +37 +76 +72 +48 +57 +40 +74 +58 +42 +79 +77 +37 +64 +52 +58 +35 +42 +54 +42 +31 +35 +40 +47 +43 +53 +65 +71 +69 +55 +88 +75 +52 +80 +56 +53 +61 +37 +69 +58 +68 +47 +78 +64 +67 +63 +57 +45 +75 +67 +59 +67 +74 +169 +55 +54 +71 +69 +38 +40 +72 +54 +49 +41 +54 +56 +62 +56 +59 +52 +52 +38 +46 +55 +54 +55 +58 +49 +63 +46 +65 +65 +47 +49 +44 +35 +48 +53 +50 +74 +60 +59 +60 +44 +63 +83 +60 +47 +69 +61 +60 +85 +60 +55 +44 +66 +55 +65 +60 +50 +37 +58 +58 +69 +66 +68 +73 +68 +46 +45 +44 +40 +79 +55 +75 +72 +40 +84 +61 +47 +53 +80 +70 +56 +66 +71 +70 +64 +59 +75 +53 +61 +109 +65 +70 +61 +66 +79 +46 +56 +43 +35 +363 +56 +294 +42 +44 +254 +374 +63 +362 +63 +51 +66 +78 +58 +60 +58 +53 +60 +59 +51 +49 +423 +68 +426 +294 +43 +52 +54 +334 +39 +278 +35 +46 +39 +303 +441 +53 +405 +60 +128 +453 +441 +361 +440 +277 +64 +414 +383 +395 +53 +46 +308 +69 +56 +57 +41 +55 +67 +53 +49 +66 +51 +73 +65 +41 +49 +29 +85 +52 +36 +44 +62 +67 +67 +40 +58 +42 +50 +40 +49 +68 +47 +46 +43 +42 +45 +57 +66 +55 +54 +57 +37 +51 +39 +54 +80 +44 +55 +39 +53 +60 +36 +93 +38 +62 +55 +39 +51 +50 +56 +64 +70 +58 +44 +56 +63 +60 +63 +71 +61 +39 +82 +75 +52 +74 +69 +62 +73 +64 +52 +66 +57 +73 +70 +66 +723 +54 +70 +70 +58 +46 +65 +64 +58 +55 +58 +65 +38 +53 +59 +57 +56 +53 +59 +54 +57 +60 +57 +59 +52 +62 +47 +55 +52 +54 +37 +63 +598 +77 +48 +52 +52 +85 +54 +68 +73 +76 +80 +52 +43 +76 +90 +78 +54 +44 +54 +56 +76 +68 +80 +55 +47 +54 +73 +83 +65 +58 +66 +54 +67 +65 +72 +61 +65 +53 +40 +54 +65 +56 +48 +62 +60 +47 +56 +51 +54 +46 +55 +46 +52 +48 +66 +58 +32 +57 +61 +62 +49 +69 +93 +287 +71 +51 +35 +222 +46 +61 +90 +35 +36 +39 +453 +49 +716 +52 +57 +447 +41 +36 +45 +45 +61 +452 +52 +52 +42 +70 +269 +58 +47 +50 +57 +51 +50 +45 +55 +44 +51 +64 +82 +64 +79 +45 +72 +68 +47 +43 +73 +64 +49 +48 +52 +88 +60 +72 +46 +61 +48 +735 +35 +56 +56 +51 +735 +62 +59 +72 +52 +58 +44 +46 +58 +53 +37 +46 +42 +45 +64 +36 +601 +45 +57 +40 +38 +50 +33 +44 +38 +64 +86 +40 +67 +42 +49 +795 +777 +47 +64 +61 +65 +72 +58 +813 +51 +44 +55 +66 +49 +785 +54 +49 +49 +796 +797 +55 +56 +58 +68 +73 +60 +66 +57 +46 +61 +71 +79 +69 +43 +69 +58 +55 +62 +68 +55 +35 +50 +57 +69 +75 +45 +57 +31 +57 +63 +41 +63 +48 +54 +49 +240 +55 +39 +62 +46 +52 +32 +52 +61 +48 +41 +48 +44 +25 +36 +29 +101 +58 +44 +34 +33 +35 +44 +48 +33 +47 +36 +40 +40 +34 +44 +36 +52 +52 +46 +37 +49 +39 +61 +64 +64 +461 +60 +53 +54 +46 +69 +52 +64 +39 +49 +59 +58 +61 +59 +57 +97 +54 +48 +63 +72 +71 +67 +79 +74 +79 +89 +71 +53 +40 +36 +41 +73 +48 +75 +104 +41 +69 +65 +1007 +76 +91 +48 +57 +67 +85 +59 +38 +57 +45 +49 +53 +72 +70 +44 +58 +60 +57 +60 +54 +59 +61 +44 +86 +47 +67 +61 +60 +94 +749 +75 +54 +64 +51 +44 +54 +57 +59 +59 +59 +59 +60 +75 +72 +58 +57 +63 +57 +77 +61 +68 +55 +53 +65 +66 +57 +69 +68 +64 +89 +80 +65 +65 +50 +40 +56 +62 +68 +64 +48 +66 +45 +71 +70 +64 +90 +83 +71 +58 +84 +42 +74 +75 +74 +75 +51 +75 +67 +73 +77 +60 +51 +80 +71 +83 +79 +67 +85 +74 +66 +61 +27 +66 +66 +42 +65 +62 +65 +40 +78 +68 +54 +73 +61 +94 +52 +71 +76 +57 +69 +52 +73 +61 +69 +57 +46 +63 +57 +51 +56 +46 +89 +56 +73 +41 +63 +61 +45 +79 +44 +57 +76 +51 +83 +50 +73 +65 +50 +50 +61 +71 +49 +50 +58 +50 +65 +70 +69 +84 +62 +46 +50 +73 +62 +70 +51 +70 +39 +49 +41 +96 +43 +65 +587 +49 +64 +91 +42 +53 +513 +35 +50 +40 +40 +57 +68 +66 +83 +51 +70 +54 +50 +51 +55 +36 +51 +64 +41 +63 +65 +38 +55 +65 +68 +39 +36 +127 +72 +58 +49 +71 +50 +53 +261 +31 +44 +50 +30 +35 +56 +31 +38 +65 +49 +42 +38 +343 +30 +315 +46 +53 +40 +58 +238 +41 +36 +62 +54 +39 +38 +84 +35 +33 +35 +47 +92 +43 +52 +39 +85 +64 +73 +51 +70 +70 +61 +80 +61 +74 +48 +63 +53 +57 +124 +65 +66 +55 +67 +61 +48 +61 +38 +67 +61 +80 +50 +61 +59 +66 +46 +43 +62 +53 +44 +50 +59 +43 +67 +80 +58 +68 +39 +50 +43 +46 +47 +315 +39 +277 +54 +52 +72 +64 +88 +63 +72 +58 +60 +75 +62 +60 +73 +56 +44 +74 +78 +68 +83 +72 +58 +71 +50 +82 +65 +41 +48 +53 +53 +61 +60 +34 +61 +100 +54 +49 +82 +52 +68 +52 +73 +40 +58 +44 +69 +70 +51 +72 +67 +52 +54 +54 +1035 +47 +51 +52 +65 +34 +42 +47 +41 +45 +34 +48 +62 +69 +63 +69 +43 +56 +61 +56 +71 +53 +44 +57 +56 +56 +41 +44 +39 +56 +37 +63 +62 +42 +44 +63 +54 +57 +58 +71 +40 +53 +52 +40 +58 +58 +53 +47 +62 +43 +51 +41 +59 +39 +54 +45 +40 +67 +46 +54 +58 +55 +43 +50 +51 +59 +46 +63 +44 +54 +41 +49 +569 +53 +39 +40 +45 +39 +56 +40 +49 +376 +60 +40 +63 +81 +72 +54 +48 +48 +65 +67 +47 +75 +47 +52 +66 +47 +653 +64 +35 +52 +58 +50 +50 +54 +43 +70 +56 +70 +70 +58 +87 +37 +32 +58 +65 +64 +45 +65 +45 +52 +77 +44 +46 +44 +42 +38 +44 +78 +53 +62 +50 +38 +44 +34 +44 +35 +58 +54 +38 +31 +39 +57 +41 +61 +52 +43 +50 +38 +48 +40 +52 +45 +62 +51 +60 +49 +45 +56 +63 +43 +45 +46 +47 +66 +51 +35 +645 +56 +614 +78 +642 +75 +48 +57 +53 +66 +54 +87 +608 +64 +61 +87 +649 +70 +67 +41 +60 +60 +68 +49 +60 +57 +50 +64 +75 +48 +46 +62 +81 +48 +76 +100 +47 +50 +39 +49 +61 +76 +47 +68 +60 +43 +70 +61 +53 +45 +62 +52 +38 +35 +57 +35 +31 +430 +42 +37 +41 +36 +50 +37 +37 +59 +179 +56 +50 +139 +59 +172 +59 +50 +50 +61 +61 +42 +39 +38 +60 +46 +63 +62 +53 +92 +53 +52 +73 +34 +33 +77 +69 +58 +59 +87 +54 +98 +96 +61 +51 +93 +66 +54 +47 +56 +44 +41 +48 +53 +51 +70 +48 +59 +47 +35 +56 +61 +65 +35 +37 +44 +46 +45 +40 +35 +52 +53 +312 +29 +335 +40 +43 +334 +175 +59 +272 +56 +41 +301 +56 +288 +64 +62 +124 +228 +53 +257 +40 +36 +34 +305 +315 +48 +59 +267 +37 +306 +288 +335 +274 +274 +309 +64 +65 +248 +34 +323 +272 +304 +50 +49 +53 +54 +45 +30 +46 +34 +43 +58 +44 +62 +349 +397 +33 +385 +202 +42 +141 +323 +148 +311 +317 +59 +155 +39 +50 +41 +131 +54 +255 +57 +149 +41 +120 +403 +39 +51 +420 +40 +99 +149 +140 +56 +336 +131 +42 +359 +268 +143 +405 +142 +442 +49 +67 +52 +139 +396 +323 +355 +46 +326 +63 +64 +61 +45 +67 +45 +54 +41 +55 +45 +50 +64 +43 +65 +50 +46 +57 +50 +50 +50 +48 +59 +46 +65 +57 +84 +54 +38 +35 +54 +51 +43 +73 +62 +46 +69 +64 +44 +44 +53 +40 +52 +54 +47 +63 +45 +44 +46 +57 +50 +50 +59 +42 +70 +43 +64 +44 +62 +72 +57 +46 +62 +49 +67 +42 +46 +55 +71 +32 +54 +54 +46 +55 +35 +64 +53 +76 +47 +86 +64 +70 +78 +66 +65 +49 +47 +72 +77 +72 +50 +77 +50 +53 +74 +51 +53 +69 +55 +57 +69 +69 +75 +59 +47 +39 +64 +64 +77 +74 +57 +52 +44 +66 +59 +53 +60 +31 +72 +38 +38 +50 +53 +77 +62 +50 +47 +65 +53 +47 +59 +54 +41 +55 +49 +43 +72 +53 +34 +59 +58 +35 +41 +59 +44 +53 +35 +59 +44 +47 +44 +49 +43 +47 +41 +44 +55 +44 +42 +56 +42 +124 +51 +74 +41 +72 +63 +56 +83 +41 +71 +57 +55 +35 +48 +59 +55 +50 +59 +65 +35 +52 +51 +40 +27 +38 +79 +83 +44 +97 +57 +57 +48 +41 +60 +53 +45 +46 +53 +48 +49 +43 +76 +66 +63 +58 +56 +55 +122 +67 +49 +55 +48 +56 +71 +43 +68 +58 +48 +57 +60 +60 +41 +57 +53 +53 +36 +53 +51 +83 +75 +51 +63 +58 +40 +96 +140 +39 +139 +44 +50 +219 +49 +57 +29 +54 +968 +48 +65 +76 +63 +57 +63 +67 +63 +74 +46 +42 +57 +48 +100 +44 +48 +50 +75 +65 +45 +62 +44 +56 +57 +85 +61 +38 +74 +40 +46 +61 +74 +53 +66 +43 +47 +49 +47 +43 +50 +46 +64 +46 +52 +59 +51 +75 +43 +50 +84 +59 +75 +49 +42 +67 +84 +59 +83 +70 +75 +65 +55 +58 +69 +64 +73 +40 +46 +52 +62 +45 +60 +53 +52 +54 +40 +63 +61 +53 +55 +50 +47 +66 +66 +54 +46 +63 +62 +54 +70 +69 +62 +53 +55 +75 +65 +59 +57 +69 +40 +73 +56 +57 +75 +440 +42 +38 +55 +68 +68 +76 +74 +36 +46 +49 +65 +46 +54 +50 +45 +48 +59 +63 +60 +44 +41 +43 +44 +77 +38 +59 +46 +46 +45 +109 +396 +38 +109 +45 +49 +42 +50 +62 +35 +47 +55 +49 +81 +80 +75 +64 +45 +67 +58 +41 +69 +52 +71 +44 +117 +48 +64 +68 +77 +40 +42 +31 +48 +42 +34 +34 +52 +51 +71 +65 +52 +38 +68 +83 +72 +61 +54 +61 +44 +55 +44 +52 +54 +61 +59 +57 +55 +65 +55 +49 +63 +33 +62 +60 +65 +56 +63 +54 +46 +49 +43 +41 +79 +41 +50 +62 +78 +39 +55 +50 +29 +80 +28 +60 +53 +48 +67 +49 +55 +53 +44 +81 +62 +86 +41 +60 +75 +60 +62 +57 +59 +39 +58 +59 +45 +58 +65 +105 +72 +92 +32 +60 +57 +58 +39 +36 +46 +72 +51 +51 +63 +57 +50 +32 +63 +52 +76 +42 +65 +83 +44 +42 +79 +61 +42 +52 +75 +56 +79 +47 +70 +66 +65 +40 +41 +55 +50 +47 +54 +55 +63 +80 +57 +58 +76 +37 +198 +73 +75 +61 +37 +70 +61 +52 +59 +70 +58 +60 +81 +43 +54 +74 +66 +55 +86 +76 +45 +78 +59 +67 +64 +54 +59 +65 +58 +55 +87 +60 +74 +43 +47 +69 +74 +85 +81 +45 +70 +62 +80 +53 +50 +61 +59 +72 +324 +49 +48 +51 +47 +35 +57 +35 +33 +39 +37 +41 +43 +57 +40 +40 +62 +29 +68 +149 +50 +42 +60 +50 +50 +66 +49 +60 +61 +61 +43 +51 +71 +41 +56 +50 +48 +63 +54 +39 +49 +66 +48 +54 +34 +56 +38 +50 +37 +49 +34 +51 +49 +43 +41 +43 +232 +57 +53 +34 +50 +65 +41 +64 +63 +765 +54 +46 +51 +67 +29 +773 +72 +59 +65 +61 +773 +49 +75 +774 +48 +56 +71 +78 +67 +80 +78 +60 +69 +74 +52 +52 +77 +37 +168 +34 +65 +41 +147 +37 +56 +60 +39 +42 +68 +53 +67 +72 +45 +90 +58 +62 +65 +83 +82 +49 +90 +57 +44 +94 +62 +61 +60 +86 +40 +45 +72 +75 +78 +38 +81 +69 +79 +49 +70 +87 +54 +85 +57 +91 +59 +61 +64 +59 +78 +69 +81 +208 +64 +70 +206 +261 +49 +63 +1039 +68 +62 +61 +71 +50 +69 +250 +53 +295 +43 +46 +61 +44 +296 +68 +66 +62 +68 +64 +38 +70 +76 +245 +41 +85 +35 +69 +63 +96 +63 +44 +46 +51 +53 +40 +49 +49 +46 +50 +41 +34 +42 +50 +62 +55 +49 +39 +61 +42 +47 +43 +55 +77 +56 +64 +55 +41 +68 +33 +59 +47 +65 +63 +79 +76 +65 +39 +81 +66 +48 +64 +53 +59 +36 +40 +54 +39 +81 +57 +74 +37 +80 +60 +48 +43 +62 +49 +64 +63 +40 +58 +53 +63 +60 +63 +72 +68 +56 +58 +57 +79 +76 +45 +49 +39 +58 +57 +47 +43 +54 +46 +55 +45 +43 +60 +46 +65 +46 +65 +52 +732 +66 +51 +223 +53 +46 +53 +50 +76 +53 +43 +66 +63 +51 +36 +44 +47 +46 +68 +304 +315 +42 +314 +167 +279 +277 +55 +50 +299 +114 +50 +46 +208 +54 +259 +56 +49 +298 +308 +50 +66 +45 +53 +279 +47 +47 +301 +287 +324 +262 +317 +46 +62 +237 +303 +260 +30 +306 +52 +465 +319 +68 +55 +45 +48 +52 +58 +53 +61 +48 +64 +55 +43 +44 +43 +621 +42 +57 +49 +58 +53 +41 +63 +40 +40 +54 +44 +35 +50 +72 +56 +50 +46 +60 +67 +47 +72 +45 +61 +57 +55 +67 +52 +57 +62 +43 +55 +61 +38 +43 +48 +34 +34 +39 +36 +32 +48 +31 +38 +44 +45 +37 +62 +61 +67 +36 +45 +61 +355 +67 +75 +59 +43 +56 +67 +69 +68 +48 +61 +237 +78 +57 +38 +70 +70 +49 +48 +37 +50 +69 +47 +95 +246 +73 +64 +38 +50 +60 +66 +42 +51 +54 +54 +59 +56 +46 +72 +76 +48 +46 +61 +69 +49 +72 +46 +46 +66 +52 +48 +44 +57 +60 +65 +64 +75 +52 +73 +55 +40 +74 +60 +65 +72 +52 +39 +30 +52 +34 +35 +44 +48 +67 +65 +69 +59 +81 +50 +71 +61 +80 +87 +52 +64 +62 +81 +54 +74 +56 +76 +28 +88 +56 +52 +58 +64 +56 +54 +54 +54 +46 +35 +49 +33 +44 +33 +35 +162 +52 +73 +51 +27 +62 +54 +251 +65 +66 +95 +56 +82 +63 +53 +37 +63 +47 +32 +32 +39 +42 +58 +44 +53 +38 +57 +53 +46 +46 +37 +41 +52 +49 +39 +68 +52 +92 +26 +48 +44 +44 +38 +44 +39 +36 +34 +51 +59 +50 +55 +50 +60 +58 +47 +48 +44 +61 +62 +43 +31 +78 +57 +61 +59 +67 +50 +57 +57 +46 +51 +55 +55 +39 +77 +42 +69 +41 +39 +65 +43 +83 +86 +59 +41 +73 +155 +36 +52 +66 +88 +48 +63 +71 +38 +88 +59 +64 +59 +89 +54 +56 +67 +56 +52 +59 +193 +75 +55 +48 +52 +65 +66 +52 +60 +86 +64 +39 +85 +63 +49 +60 +69 +65 +63 +60 +68 +55 +93 +72 +51 +48 +67 +45 +76 +47 +50 +79 +57 +46 +54 +66 +79 +48 +49 +50 +67 +64 +74 +62 +84 +61 +43 +45 +50 +52 +62 +56 +66 +50 +71 +875 +64 +67 +67 +43 +72 +104 +34 +60 +71 +64 +66 +70 +36 +71 +75 +60 +100 +57 +48 +49 +87 +60 +73 +70 +83 +76 +47 +54 +46 +55 +42 +43 +72 +47 +68 +42 +69 +84 +38 +38 +54 +61 +46 +59 +51 +59 +30 +45 +46 +70 +61 +61 +61 +54 +75 +48 +55 +48 +44 +60 +42 +48 +56 +52 +45 +54 +55 +35 +45 +44 +55 +55 +35 +45 +46 +47 +41 +54 +36 +33 +30 +98 +44 +34 +54 +37 +40 +76 +52 +30 +34 +44 +47 +40 +26 +49 +53 +56 +39 +38 +54 +71 +46 +42 +58 +58 +42 +59 +59 +44 +60 +45 +58 +44 +58 +62 +48 +67 +47 +44 +64 +48 +62 +60 +55 +45 +53 +46 +54 +38 +57 +53 +37 +44 +36 +52 +48 +45 +50 +36 +40 +48 +58 +44 +48 +50 +55 +462 +97 +45 +81 +71 +61 +44 +76 +63 +37 +71 +56 +83 +66 +84 +44 +72 +57 +44 +37 +51 +40 +42 +40 +56 +31 +42 +40 +42 +43 +36 +50 +34 +44 +43 +53 +43 +43 +34 +40 +35 +41 +40 +56 +87 +51 +66 +59 +807 +44 +65 +49 +39 +85 +52 +79 +65 +61 +68 +78 +68 +55 +67 +63 +36 +48 +82 +72 +69 +58 +65 +48 +84 +45 +49 +77 +56 +51 +41 +50 +46 +47 +60 +76 +54 +49 +58 +70 +57 +46 +64 +60 +53 +82 +49 +49 +46 +45 +93 +67 +47 +51 +49 +49 +53 +44 +67 +54 +47 +37 +50 +43 +38 +63 +38 +65 +58 +46 +49 +38 +56 +62 +64 +55 +69 +63 +68 +76 +68 +66 +85 +46 +73 +70 +70 +55 +65 +75 +56 +40 +62 +57 +44 +56 +71 +70 +59 +66 +55 +59 +58 +55 +71 +60 +50 +61 +66 +55 +62 +41 +62 +52 +56 +52 +47 +60 +73 +52 +62 +46 +44 +59 +73 +61 +56 +59 +42 +62 +38 +58 +65 +59 +46 +60 +44 +40 +48 +57 +50 +43 +56 +42 +47 +85 +46 +46 +55 +54 +49 +73 +56 +37 +72 +28 +51 +69 +53 +48 +71 +78 +62 +56 +62 +66 +72 +71 +97 +60 +57 +63 +65 +53 +49 +53 +45 +53 +52 +37 +55 +32 +35 +59 +43 +39 +34 +40 +38 +59 +45 +39 +49 +39 +44 +36 +39 +81 +46 +77 +33 +65 +98 +54 +47 +82 +73 +60 +50 +74 +77 +73 +78 +57 +80 +63 +57 +51 +78 +81 +82 +45 +77 +81 +63 +79 +77 +45 +48 +93 +58 +92 +60 +66 +56 +42 +53 +43 +54 +47 +66 +36 +74 +79 +57 +71 +82 +78 +35 +59 +65 +60 +47 +79 +38 +46 +44 +905 +63 +66 +37 +44 +56 +62 +67 +66 +86 +56 +75 +43 +43 +38 +39 +66 +55 +44 +37 +58 +46 +52 +43 +41 +35 +68 +72 +57 +35 +53 +56 +35 +48 +55 +46 +71 +54 +70 +73 +52 +58 +51 +36 +40 +56 +42 +60 +103 +48 +56 +41 +145 +169 +65 +156 +39 +51 +40 +50 +45 +46 +29 +35 +47 +67 +48 +57 +48 +72 +51 +56 +56 +64 +67 +57 +48 +70 +46 +137 +44 +42 +39 +42 +49 +62 +39 +318 +49 +42 +43 +28 +40 +48 +61 +52 +56 +36 +53 +29 +38 +47 +57 +46 +57 +126 +51 +45 +40 +60 +65 +35 +40 +50 +64 +78 +64 +36 +53 +38 +52 +73 +60 +148 +36 +54 +37 +38 +58 +57 +47 +55 +47 +46 +44 +48 +34 +46 +30 +55 +48 +338 +53 +359 +33 +38 +40 +349 +193 +334 +110 +41 +299 +288 +101 +206 +119 +238 +49 +109 +329 +318 +94 +52 +336 +59 +66 +333 +233 +369 +242 +228 +300 +53 +196 +46 +215 +332 +297 +54 +339 +303 +310 +308 +49 +43 +45 +58 +43 +52 +43 +49 +60 +77 +68 +61 +787 +65 +52 +49 +51 +58 +29 +782 +70 +60 +58 +60 +777 +49 +73 +778 +53 +55 +69 +68 +81 +69 +63 +56 +68 +774 +54 +62 +45 +51 +49 +53 +47 +48 +50 +56 +59 +82 +44 +46 +66 +70 +38 +38 +72 +38 +55 +63 +91 +47 +74 +79 +38 +41 +66 +38 +49 +36 +78 +40 +52 +33 +48 +50 +87 +55 +67 +53 +52 +49 +42 +39 +53 +49 +73 +66 +49 +63 +290 +85 +777 +68 +71 +282 +60 +68 +783 +69 +55 +78 +55 +56 +37 +50 +43 +68 +48 +37 +35 +50 +60 +50 +37 +50 +199 +45 +31 +60 +51 +83 +66 +57 +67 +58 +55 +54 +39 +50 +39 +32 +71 +51 +37 +61 +69 +53 +81 +64 +36 +34 +57 +42 +64 +57 +67 +59 +39 +59 +64 +70 +408 +66 +45 +60 +66 +59 +89 +37 +47 +149 +57 +149 +60 +58 +56 +78 +37 +57 +49 +66 +46 +52 +98 +70 +67 +53 +51 +69 +58 +62 +58 +54 +42 +63 +38 +72 +51 +46 +51 +41 +69 +66 +42 +57 +39 +57 +49 +55 +58 +288 +47 +297 +300 +179 +67 +442 +125 +529 +65 +400 +61 +174 +40 +67 +31 +226 +49 +343 +61 +310 +53 +54 +441 +345 +250 +299 +42 +231 +223 +47 +303 +31 +47 +187 +228 +39 +277 +247 +336 +31 +272 +287 +263 +52 +43 +296 +45 +60 +40 +59 +67 +56 +107 +50 +44 +40 +48 +44 +54 +75 +65 +51 +37 +50 +75 +29 +62 +82 +80 +74 +58 +55 +53 +87 +49 +57 +55 +54 +53 +63 +48 +41 +51 +52 +62 +75 +78 +59 +59 +78 +86 +70 +79 +67 +75 +61 +48 +34 +54 +44 +52 +53 +44 +46 +82 +43 +60 +52 +71 +810 +48 +90 +70 +56 +50 +810 +63 +559 +60 +49 +48 +59 +39 +61 +58 +38 +53 +53 +50 +55 +84 +49 +45 +44 +55 +63 +52 +58 +55 +56 +53 +53 +65 +52 +44 +279 +25 +52 +45 +85 +91 +28 +83 +52 +53 +57 +57 +54 +705 +33 +62 +262 +56 +37 +74 +46 +55 +56 +45 +50 +59 +68 +60 +60 +58 +63 +58 +32 +52 +59 +48 +53 +51 +65 +62 +54 +67 +47 +50 +54 +65 +64 +53 +53 +582 +61 +42 +48 +54 +65 +65 +45 +47 +51 +53 +32 +45 +40 +42 +40 +46 +56 +53 +61 +60 +49 +57 +56 +50 +50 +35 +38 +63 +53 +42 +44 +66 +55 +31 +255 +49 +41 +53 +42 +38 +44 +57 +52 +74 +40 +43 +158 +89 +67 +52 +40 +44 +43 +82 +50 +59 +420 +43 +89 +58 +60 +52 +64 +45 +59 +29 +61 +65 +43 +60 +75 +54 +66 +47 +78 +52 +56 +45 +45 +46 +57 +57 +60 +79 +82 +89 +107 +65 +49 +59 +45 +74 +89 +83 +78 +85 +60 +65 +61 +76 +50 +83 +71 +72 +71 +60 +73 +45 +48 +85 +77 +82 +50 +89 +44 +71 +96 +51 +69 +85 +76 +90 +64 +75 +78 +58 +73 +85 +67 +96 +60 +66 +74 +81 +67 +79 +88 +98 +69 +69 +88 +48 +92 +75 +61 +62 +62 +48 +47 +84 +66 +33 +52 +81 +53 +53 +52 +34 +52 +74 +58 +44 +53 +56 +57 +53 +45 +57 +73 +73 +49 +48 +72 +63 +53 +582 +46 +48 +44 +62 +67 +63 +48 +66 +55 +47 +31 +49 +45 +68 +52 +70 +61 +62 +626 +66 +64 +55 +69 +63 +68 +76 +68 +66 +85 +46 +73 +70 +70 +55 +65 +75 +56 +47 +78 +80 +34 +68 +58 +71 +78 +46 +58 +45 +38 +99 +38 +73 +60 +50 +54 +72 +57 +70 +74 +40 +43 +43 +53 +49 +47 +41 +54 +506 +49 +47 +54 +71 +54 +64 +51 +65 +54 +57 +33 +44 +48 +53 +44 +45 +52 +35 +38 +44 +64 +44 +26 +55 +463 +478 +41 +54 +45 +52 +36 +29 +28 +32 +38 +36 +368 +52 +517 +29 +44 +36 +45 +50 +39 +41 +36 +30 +42 +49 +49 +39 +49 +74 +50 +61 +67 +62 +56 +47 +59 +46 +68 +46 +61 +58 +45 +64 +75 +63 +56 +53 +54 +52 +46 +32 +44 +49 +49 +55 +58 +58 +45 +65 +79 +54 +75 +58 +55 +53 +60 +48 +72 +62 +57 +57 +53 +45 +40 +55 +52 +51 +51 +45 +49 +45 +44 +39 +40 +46 +48 +46 +42 +45 +44 +35 +51 +97 +92 +53 +38 +48 +60 +49 +69 +37 +54 +73 +48 +81 +50 +73 +64 +51 +59 +56 +47 +40 +376 +33 +40 +308 +53 +53 +322 +47 +34 +72 +50 +57 +59 +43 +41 +52 +47 +53 +59 +54 +40 +53 +48 +58 +50 +60 +59 +61 +61 +43 +42 +56 +41 +59 +51 +47 +49 +42 +71 +40 +47 +50 +48 +46 +54 +69 +42 +63 +36 +65 +62 +30 +47 +46 +34 +42 +50 +52 +476 +42 +489 +40 +66 +49 +50 +48 +54 +77 +60 +85 +94 +76 +66 +74 +50 +74 +95 +56 +38 +47 +59 +73 +82 +66 +58 +57 +48 +75 +66 +47 +33 +63 +64 +42 +80 +54 +72 +68 +72 +83 +71 +51 +71 +49 +65 +61 +55 +55 +72 +61 +59 +59 +54 +96 +61 +75 +81 +63 +79 +37 +313 +54 +65 +60 +68 +72 +42 +74 +49 +68 +66 +59 +28 +55 +55 +66 +89 +67 +61 +42 +55 +36 +66 +62 +55 +87 +75 +56 +49 +63 +54 +104 +54 +64 +62 +61 +60 +81 +36 +64 +56 +50 +90 +56 +44 +38 +48 +67 +43 +51 +45 +63 +53 +49 +48 +67 +47 +39 +61 +40 +36 +27 +42 +76 +73 +63 +59 +54 +47 +50 +41 +65 +62 +50 +68 +48 +41 +58 +58 +38 +31 +47 +38 +60 +270 +52 +38 +47 +30 +53 +74 +71 +72 +48 +59 +186 +59 +63 +72 +43 +29 +40 +40 +67 +35 +30 +38 +53 +40 +40 +35 +38 +31 +45 +40 +39 +42 +43 +49 +47 +56 +44 +58 +52 +44 +52 +49 +55 +56 +43 +44 +87 +77 +54 +53 +80 +53 +42 +64 +52 +42 +65 +69 +54 +60 +51 +62 +33 +75 +44 +43 +70 +62 +65 +47 +55 +83 +58 +57 +83 +44 +51 +50 +48 +86 +71 +41 +65 +86 +40 +971 +72 +65 +69 +74 +57 +56 +58 +63 +39 +50 +62 +55 +70 +78 +67 +82 +58 +72 +70 +56 +48 +51 +82 +56 +46 +75 +51 +74 +57 +71 +65 +46 +82 +47 +53 +72 +76 +61 +64 +65 +64 +51 +77 +47 +46 +47 +67 +63 +66 +46 +56 +45 +69 +49 +65 +48 +65 +55 +45 +54 +44 +47 +77 +45 +54 +79 +49 +51 +52 +59 +56 +70 +53 +48 +65 +45 +40 +79 +62 +56 +48 +80 +47 +46 +64 +37 +56 +76 +62 +63 +65 +26 +39 +31 +37 +27 +40 +46 +38 +44 +48 +32 +43 +67 +54 +53 +55 +50 +41 +41 +71 +52 +49 +54 +43 +42 +41 +41 +64 +48 +65 +42 +57 +50 +41 +45 +29 +49 +45 +60 +53 +56 +58 +55 +56 +41 +71 +46 +57 +59 +38 +68 +72 +82 +71 +80 +77 +82 +51 +45 +59 +55 +57 +65 +71 +67 +50 +57 +41 +54 +57 +54 +45 +64 +56 +82 +76 +50 +59 +70 +80 +67 +80 +46 +39 +70 +39 +54 +46 +64 +42 +59 +39 +52 +58 +46 +56 +48 +42 +53 +61 +45 +56 +59 +65 +42 +61 +70 +53 +63 +71 +53 +48 +54 +51 +67 +58 +53 +46 +68 +79 +74 +50 +54 +70 +63 +57 +40 +74 +43 +45 +70 +80 +62 +58 +52 +43 +71 +45 +41 +52 +516 +49 +49 +58 +514 +40 +77 +42 +69 +41 +39 +65 +43 +83 +86 +59 +41 +73 +155 +36 +52 +66 +88 +48 +965 +99 +67 +56 +47 +61 +74 +40 +49 +43 +65 +66 +66 +43 +58 +67 +77 +59 +68 +55 +36 +66 +82 +60 +44 +67 +62 +75 +40 +56 +66 +69 +45 +59 +50 +67 +39 +73 +64 +106 +61 +67 +233 +50 +233 +51 +50 +39 +41 +48 +34 +50 +45 +77 +58 +45 +53 +70 +36 +51 +49 +71 +51 +47 +47 +28 +56 +57 +47 +101 +42 +67 +51 +37 +62 +48 +75 +70 +79 +83 +76 +50 +62 +71 +55 +48 +52 +52 +71 +365 +346 +40 +53 +363 +363 +280 +52 +40 +49 +53 +44 +60 +57 +58 +36 +418 +50 +45 +55 +49 +58 +47 +43 +54 +40 +41 +44 +52 +46 +59 +46 +54 +45 +68 +59 +47 +79 +69 +74 +87 +42 +60 +55 +79 +32 +32 +82 +44 +42 +82 +61 +82 +44 +55 +45 +55 +43 +68 +63 +61 +52 +55 +54 +60 +63 +66 +49 +67 +52 +48 +58 +67 +50 +67 +56 +49 +50 +43 +49 +36 +35 +50 +43 +43 +67 +66 +45 +55 +52 +48 +45 +56 +47 +53 +51 +34 +93 +66 +66 +58 +66 +66 +56 +43 +49 +48 +53 +50 +42 +63 +60 +76 +50 +52 +61 +56 +53 +81 +32 +50 +44 +46 +33 +44 +35 +46 +42 +37 +44 +38 +32 +40 +35 +37 +33 +41 +37 +63 +34 +63 +38 +44 +44 +247 +67 +51 +38 +47 +240 +49 +38 +47 +191 +46 +60 +62 +34 +41 +62 +58 +67 +64 +41 +42 +81 +42 +47 +93 +42 +93 +57 +45 +59 +63 +45 +64 +69 +47 +46 +42 +57 +57 +61 +46 +46 +68 +75 +51 +57 +73 +43 +62 +60 +79 +43 +37 +70 +57 +74 +62 +68 +67 +70 +46 +51 +59 +63 +68 +63 +61 +49 +49 +32 +44 +61 +55 +60 +51 +56 +64 +69 +64 +79 +96 +68 +73 +47 +62 +63 +43 +43 +64 +66 +45 +55 +51 +48 +45 +54 +46 +53 +51 +45 +35 +39 +40 +40 +36 +44 +45 +36 +39 +48 +64 +63 +68 +83 +91 +54 +60 +89 +61 +59 +72 +72 +43 +71 +75 +68 +57 +60 +66 +64 +77 +80 +52 +78 +68 +73 +80 +76 +58 +51 +78 +87 +43 +70 +68 +50 +51 +74 +57 +59 +74 +77 +65 +79 +75 +89 +58 +71 +67 +53 +54 +89 +87 +60 +87 +71 +75 +85 +53 +45 +76 +60 +78 +43 +44 +52 +52 +66 +54 +62 +38 +56 +35 +44 +48 +48 +44 +63 +38 +38 +41 +53 +57 +45 +66 +54 +50 +66 +62 +51 +49 +43 +53 +67 +50 +41 +51 +84 +46 +42 +58 +73 +49 +44 +46 +352 +33 +41 +35 +47 +56 +34 +78 +66 +82 +55 +51 +45 +62 +47 +47 +60 +39 +76 +50 +49 +71 +44 +48 +56 +44 +48 +46 +48 +44 +43 +62 +43 +40 +65 +64 +80 +65 +56 +76 +57 +78 +58 +129 +56 +45 +67 +55 +555 +57 +68 +46 +62 +54 +45 +61 +66 +64 +67 +63 +48 +57 +50 +65 +45 +40 +60 +61 +77 +83 +66 +53 +64 +48 +61 +57 +57 +46 +57 +70 +72 +70 +42 +71 +36 +49 +45 +66 +49 +46 +44 +52 +59 +43 +64 +56 +55 +45 +67 +53 +33 +56 +65 +64 +84 +52 +30 +57 +41 +69 +50 +51 +43 +65 +34 +61 +33 +56 +40 +55 +76 +60 +58 +59 +96 +39 +223 +52 +40 +62 +47 +45 +45 +51 +49 +35 +59 +65 +72 +43 +49 +73 +34 +51 +48 +52 +42 +49 +51 +40 +45 +45 +51 +42 +42 +52 +42 +55 +57 +69 +40 +59 +58 +70 +50 +28 +45 +32 +62 +62 +71 +50 +74 +36 +54 +93 +65 +48 +61 +50 +70 +65 +43 +70 +50 +57 +52 +59 +62 +65 +56 +67 +29 +69 +29 +73 +67 +48 +55 +54 +62 +263 +46 +67 +49 +67 +428 +43 +62 +65 +73 +49 +58 +66 +74 +58 +99 +44 +92 +48 +40 +79 +56 +67 +60 +55 +78 +52 +63 +81 +54 +66 +59 +70 +58 +57 +61 +62 +63 +69 +65 +77 +58 +64 +62 +55 +58 +44 +72 +57 +54 +48 +77 +62 +77 +73 +59 +45 +35 +73 +48 +59 +53 +58 +44 +63 +62 +64 +76 +86 +49 +60 +31 +65 +57 +35 +67 +40 +62 +50 +41 +56 +55 +34 +52 +239 +51 +40 +41 +652 +48 +60 +37 +52 +47 +56 +39 +54 +47 +52 +56 +44 +45 +33 +55 +52 +135 +58 +38 +59 +47 +34 +138 +75 +46 +33 +58 +71 +76 +61 +32 +72 +78 +69 +58 +43 +55 +58 +46 +54 +49 +48 +53 +81 +48 +46 +55 +49 +60 +51 +54 +80 +80 +52 +59 +53 +53 +55 +60 +44 +60 +62 +57 +60 +42 +70 +59 +54 +57 +57 +59 +43 +42 +45 +34 +48 +44 +39 +36 +42 +43 +33 +44 +40 +52 +34 +47 +33 +53 +42 +36 +38 +37 +36 +59 +40 +79 +52 +48 +44 +82 +52 +68 +90 +55 +57 +49 +42 +59 +43 +49 +689 +68 +67 +50 +65 +64 +42 +40 +50 +62 +62 +52 +48 +31 +30 +44 +41 +492 +60 +33 +53 +58 +53 +44 +74 +57 +51 +39 +50 +60 +61 +46 +65 +49 +64 +49 +48 +68 +58 +64 +57 +66 +57 +46 +59 +54 +38 +77 +78 +57 +59 +60 +42 +63 +68 +71 +89 +85 +52 +61 +84 +57 +72 +84 +66 +75 +68 +30 +76 +68 +79 +79 +32 +44 +33 +34 +33 +38 +42 +52 +37 +38 +25 +31 +32 +38 +36 +45 +45 +59 +56 +46 +57 +70 +46 +81 +57 +71 +63 +84 +47 +49 +86 +34 +45 +51 +56 +37 +51 +69 +51 +46 +37 +47 +68 +61 +52 +43 +42 +347 +54 +35 +32 +53 +48 +37 +60 +616 +55 +71 +35 +51 +59 +87 +870 +73 +508 +39 +60 +79 +91 +51 +32 +66 +39 +51 +37 +78 +61 +70 +58 +51 +28 +66 +55 +37 +42 +56 +42 +55 +71 +42 +41 +49 +46 +39 +66 +49 +51 +40 +49 +46 +45 +49 +71 +68 +49 +85 +53 +57 +54 +64 +61 +53 +74 +42 +64 +54 +64 +46 +64 +62 +48 +49 +48 +45 +67 +56 +43 +43 +51 +58 +40 +88 +50 +67 +528 +82 +88 +38 +53 +79 +47 +76 +37 +59 +82 +44 +50 +512 +40 +739 +69 +57 +61 +45 +56 +65 +38 +70 +71 +52 +47 +59 +60 +60 +66 +57 +67 +35 +66 +65 +514 +41 +169 +68 +63 +71 +104 +58 +42 +42 +53 +46 +46 +168 +51 +55 +190 +73 +65 +51 +63 +64 +43 +50 +48 +47 +97 +166 +70 +99 +55 +41 +47 +42 +56 +38 +39 +79 +51 +67 +82 +42 +48 +64 +71 +67 +74 +56 +36 +64 +58 +46 +47 +58 +70 +73 +41 +56 +56 +62 +68 +69 +67 +53 +57 +55 +39 +67 +69 +59 +38 +61 +89 +69 +56 +57 +88 +59 +86 +35 +87 +59 +60 +48 +69 +53 +86 +67 +66 +47 +91 +68 +62 +76 +68 +57 +76 +66 +53 +62 +66 +98 +78 +51 +43 +34 +51 +43 +32 +54 +48 +42 +27 +48 +62 +35 +70 +66 +51 +53 +47 +32 +147 +44 +59 +51 +59 +52 +45 +42 +51 +51 +47 +53 +66 +58 +42 +458 +47 +456 +320 +51 +44 +375 +301 +48 +342 +464 +45 +445 +133 +512 +469 +384 +449 +278 +118 +45 +444 +395 +431 +45 +41 +338 +44 +510 +48 +47 +48 +69 +66 +74 +64 +78 +62 +76 +59 +52 +59 +71 +43 +72 +55 +48 +48 +69 +63 +68 +62 +64 +72 +126 +28 +39 +45 +86 +42 +58 +61 +52 +36 +41 +52 +57 +62 +64 +82 +53 +62 +70 +74 +55 +63 +73 +74 +34 +46 +34 +444 +46 +47 +50 +42 +45 +32 +40 +54 +55 +47 +55 +44 +46 +52 +41 +41 +65 +54 +57 +52 +54 +58 +40 +38 +42 +61 +49 +51 +28 +59 +64 +52 +69 +58 +49 +38 +42 +53 +61 +49 +53 +34 +44 +93 +69 +61 +52 +57 +35 +65 +52 +74 +74 +59 +214 +231 +219 +39 +228 +35 +244 +229 +32 +43 +245 +50 +293 +47 +345 +52 +39 +45 +239 +246 +51 +246 +58 +245 +332 +233 +343 +323 +29 +256 +40 +39 +301 +317 +237 +220 +261 +257 +256 +240 +206 +232 +72 +58 +73 +66 +62 +78 +47 +70 +54 +52 +62 +42 +50 +64 +73 +63 +78 +70 +49 +70 +38 +72 +69 +70 +59 +61 +45 +61 +88 +61 +56 +70 +83 +45 +56 +55 +54 +47 +56 +51 +65 +83 +51 +53 +69 +74 +48 +51 +84 +46 +58 +35 +46 +75 +49 +76 +86 +60 +46 +47 +83 +34 +65 +50 +58 +44 +69 +59 +36 +70 +41 +45 +61 +67 +54 +67 +43 +53 +53 +57 +58 +45 +53 +40 +76 +43 +72 +75 +43 +81 +68 +61 +31 +60 +77 +75 +66 +49 +62 +73 +60 +76 +46 +45 +49 +47 +40 +68 +56 +87 +59 +57 +810 +40 +47 +47 +64 +61 +57 +37 +43 +58 +62 +69 +38 +46 +56 +51 +38 +58 +51 +39 +38 +184 +88 +46 +45 +41 +58 +37 +40 +34 +47 +53 +67 +54 +34 +33 +34 +29 +46 +29 +45 +35 +43 +30 +42 +53 +50 +63 +53 +62 +67 +68 +67 +35 +59 +49 +68 +56 +59 +62 +78 +57 +48 +66 +47 +66 +59 +61 +67 +41 +60 +80 +54 +62 +39 +52 +55 +40 +64 +51 +67 +69 +50 +563 +67 +35 +57 +45 +39 +56 +57 +66 +66 +67 +69 +61 +62 +59 +65 +48 +73 +56 +67 +62 +54 +74 +65 +69 +38 +52 +67 +57 +64 +60 +60 +35 +80 +60 +81 +74 +42 +60 +54 +62 +62 +57 +59 +57 +62 +57 +55 +46 +61 +52 +46 +73 +55 +52 +52 +44 +56 +49 +72 +63 +64 +53 +54 +62 +51 +48 +56 +48 +65 +37 +59 +61 +50 +57 +64 +59 +83 +53 +54 +43 +58 +51 +58 +53 +57 +48 +46 +40 +58 +73 +50 +51 +65 +52 +70 +68 +61 +78 +82 +75 +68 +67 +73 +78 +57 +54 +70 +79 +65 +59 +69 +62 +59 +86 +68 +48 +109 +65 +70 +58 +62 +98 +85 +44 +64 +86 +74 +46 +73 +77 +86 +90 +68 +46 +70 +46 +52 +72 +63 +75 +75 +36 +62 +57 +80 +36 +40 +61 +52 +69 +56 +75 +38 +51 +67 +41 +61 +60 +67 +41 +65 +44 +37 +55 +77 +77 +68 +48 +65 +55 +38 +77 +36 +52 +58 +53 +62 +45 +88 +42 +50 +72 +71 +46 +41 +46 +41 +81 +59 +84 +58 +53 +67 +52 +53 +73 +65 +75 +74 +43 +69 +56 +33 +65 +60 +78 +62 +77 +57 +35 +70 +78 +63 +52 +48 +63 +66 +69 +74 +55 +57 +59 +37 +63 +42 +54 +51 +75 +56 +79 +60 +58 +42 +55 +55 +71 +68 +62 +99 +59 +66 +60 +54 +47 +89 +59 +56 +37 +62 +315 +45 +50 +72 +127 +51 +104 +113 +47 +35 +48 +114 +63 +81 +43 +40 +35 +55 +59 +44 +48 +55 +52 +86 +96 +42 +46 +68 +63 +53 +92 +54 +52 +76 +35 +33 +77 +71 +58 +44 +44 +39 +56 +52 +60 +56 +43 +57 +37 +56 +53 +47 +62 +44 +47 +40 +63 +60 +65 +55 +72 +68 +46 +49 +80 +37 +60 +42 +65 +63 +76 +51 +56 +46 +75 +44 +43 +35 +53 +362 +56 +55 +293 +42 +43 +249 +373 +65 +361 +372 +50 +25 +34 +44 +33 +39 +33 +28 +39 +44 +37 +31 +75 +36 +118 +58 +56 +200 +124 +116 +373 +50 +147 +152 +128 +66 +156 +54 +59 +68 +45 +63 +68 +65 +75 +58 +66 +28 +69 +82 +40 +48 +79 +51 +70 +61 +42 +59 +47 +56 +69 +67 +71 +63 +64 +66 +79 +59 +390 +63 +70 +68 +85 +51 +73 +50 +73 +75 +53 +79 +51 +192 +48 +46 +49 +71 +76 +80 +48 +60 +76 +57 +66 +55 +63 +50 +45 +41 +45 +37 +53 +65 +50 +42 +49 +43 +44 +44 +50 +59 +51 +46 +57 +59 +72 +41 +51 +77 +35 +43 +40 +56 +52 +51 +60 +73 +48 +67 +55 +36 +57 +62 +60 +64 +66 +58 +52 +65 +76 +57 +65 +51 +51 +71 +46 +41 +88 +82 +45 +63 +36 +66 +67 +54 +62 +61 +73 +72 +43 +61 +62 +45 +47 +43 +49 +46 +54 +77 +44 +48 +72 +43 +75 +50 +50 +44 +86 +36 +45 +89 +77 +49 +57 +63 +67 +58 +71 +54 +73 +39 +75 +72 +62 +63 +54 +63 +79 +67 +52 +60 +39 +65 +63 +57 +60 +57 +62 +60 +51 +37 +70 +48 +71 +49 +46 +43 +635 +50 +55 +56 +70 +48 +53 +69 +76 +47 +62 +77 +53 +63 +54 +82 +74 +60 +48 +91 +61 +58 +64 +47 +75 +87 +51 +87 +74 +57 +91 +80 +69 +57 +46 +79 +72 +47 +37 +35 +45 +41 +42 +40 +48 +91 +68 +40 +48 +56 +87 +40 +56 +74 +47 +44 +49 +65 +69 +47 +63 +40 +69 +42 +77 +39 +60 +72 +71 +54 +74 +41 +34 +64 +65 +41 +304 +66 +61 +60 +289 +60 +63 +36 +63 +61 +34 +52 +66 +62 +52 +55 +55 +62 +34 +308 +75 +63 +55 +41 +40 +66 +64 +52 +53 +40 +72 +83 +49 +53 +70 +95 +82 +52 +40 +44 +65 +69 +74 +53 +38 +82 +66 +65 +59 +40 +65 +48 +42 +61 +50 +46 +66 +73 +70 +77 +76 +58 +60 +50 +47 +53 +55 +43 +38 +59 +42 +68 +46 +45 +41 +52 +34 +45 +38 +34 +39 +40 +33 +48 +41 +50 +52 +66 +39 +41 +35 +55 +57 +39 +36 +35 +51 +63 +44 +44 +34 +46 +62 +45 +51 +48 +41 +57 +48 +196 +46 +38 +47 +68 +57 +45 +42 +55 +53 +66 +71 +44 +40 +42 +45 +54 +73 +46 +365 +43 +37 +53 +139 +362 +251 +49 +39 +256 +32 +220 +50 +64 +115 +46 +267 +361 +44 +327 +87 +112 +406 +44 +52 +353 +335 +380 +221 +49 +32 +381 +362 +63 +95 +362 +44 +38 +100 +249 +106 +389 +41 +48 +49 +413 +45 +45 +38 +65 +63 +58 +56 +48 +47 +54 +40 +60 +59 +41 +54 +55 +49 +47 +54 +39 +53 +51 +36 +49 +49 +41 +73 +47 +53 +36 +379 +75 +53 +57 +41 +74 +51 +54 +72 +39 +62 +60 +66 +59 +47 +66 +48 +58 +40 +45 +69 +69 +46 +42 +65 +51 +52 +38 +63 +67 +61 +63 +104 +40 +94 +47 +45 +59 +89 +77 +69 +56 +52 +49 +61 +64 +43 +59 +49 +79 +78 +48 +61 +52 +56 +656 +55 +615 +84 +643 +70 +42 +56 +70 +53 +83 +611 +58 +62 +77 +650 +649 +58 +65 +95 +37 +64 +79 +64 +50 +75 +66 +182 +61 +867 +53 +58 +61 +93 +222 +54 +69 +55 +49 +55 +66 +41 +67 +42 +50 +67 +50 +55 +44 +58 +61 +42 +32 +53 +42 +48 +66 +41 +55 +52 +57 +54 +35 +66 +48 +55 +36 +48 +54 +55 +47 +50 +54 +36 +47 +34 +46 +45 +38 +53 +45 +45 +42 +51 +38 +40 +34 +43 +69 +61 +53 +56 +43 +57 +59 +53 +31 +41 +38 +56 +64 +55 +56 +55 +43 +59 +62 +61 +67 +50 +50 +40 +68 +43 +45 +42 +69 +38 +76 +36 +86 +57 +66 +41 +57 +50 +58 +43 +62 +71 +34 +66 +55 +39 +46 +38 +70 +66 +76 +53 +52 +47 +35 +65 +86 +44 +63 +62 +70 +63 +54 +60 +45 +57 +63 +103 +55 +45 +78 +58 +57 +74 +60 +64 +77 +53 +56 +46 +49 +49 +56 +72 +67 +48 +42 +244 +59 +51 +67 +51 +427 +36 +35 +49 +49 +39 +47 +69 +45 +52 +57 +45 +53 +39 +332 +46 +382 +26 +371 +220 +50 +41 +138 +354 +341 +338 +63 +51 +260 +48 +283 +126 +56 +398 +41 +448 +51 +43 +363 +60 +371 +313 +393 +288 +274 +56 +485 +49 +46 +237 +47 +60 +284 +380 +298 +352 +60 +349 +455 +346 +38 +49 +48 +63 +325 +324 +281 +56 +46 +40 +41 +75 +66 +41 +51 +64 +92 +41 +49 +61 +46 +94 +72 +47 +57 +65 +69 +71 +54 +74 +35 +61 +59 +68 +66 +40 +62 +35 +52 +71 +56 +57 +43 +63 +74 +63 +52 +69 +55 +41 +37 +44 +114 +38 +43 +39 +39 +35 +58 +62 +43 +37 +60 +58 +56 +91 +40 +51 +61 +53 +61 +84 +63 +65 +83 +63 +69 +55 +52 +80 +49 +55 +54 +72 +49 +38 +48 +58 +70 +55 +44 +53 +54 +49 +49 +64 +55 +71 +70 +50 +51 +47 +39 +960 +54 +69 +62 +54 +69 +65 +38 +62 +66 +46 +42 +67 +84 +81 +62 +52 +46 +43 +60 +64 +63 +56 +74 +79 +72 +45 +38 +67 +49 +50 +54 +130 +58 +45 +48 +49 +38 +44 +67 +51 +41 +48 +44 +43 +46 +58 +37 +50 +53 +54 +56 +48 +49 +44 +56 +39 +40 +53 +56 +39 +54 +39 +62 +39 +37 +42 +82 +95 +43 +67 +57 +30 +63 +45 +56 +73 +93 +45 +64 +73 +33 +105 +51 +46 +50 +520 +47 +66 +45 +85 +49 +66 +63 +42 +69 +50 +78 +47 +40 +54 +45 +51 +55 +96 +47 +69 +99 +71 +64 +59 +64 +64 +34 +49 +64 +60 +59 +70 +71 +66 +52 +48 +52 +66 +52 +66 +50 +84 +52 +51 +68 +52 +52 +45 +57 +40 +43 +219 +55 +44 +56 +54 +48 +48 +58 +33 +50 +62 +36 +70 +67 +46 +70 +60 +50 +30 +72 +73 +72 +60 +54 +56 +49 +40 +54 +49 +56 +43 +47 +64 +54 +73 +50 +61 +59 +72 +67 +67 +64 +66 +53 +64 +75 +49 +61 +64 +65 +31 +33 +56 +61 +49 +67 +67 +74 +57 +59 +67 +71 +86 +58 +51 +76 +35 +99 +32 +66 +69 +37 +94 +61 +67 +68 +63 +63 +46 +38 +63 +57 +58 +53 +63 +47 +42 +49 +42 +58 +51 +45 +54 +37 +67 +86 +54 +42 +33 +52 +42 +43 +64 +40 +42 +44 +68 +39 +45 +70 +606 +51 +62 +42 +45 +39 +71 +45 +44 +36 +54 +44 +44 +35 +53 +56 +84 +40 +40 +43 +67 +45 +47 +71 +59 +33 +83 +69 +61 +788 +65 +55 +48 +53 +58 +29 +773 +73 +59 +55 +58 +768 +55 +70 +769 +50 +51 +72 +72 +64 +78 +72 +59 +58 +55 +60 +66 +775 +52 +787 +53 +42 +38 +58 +34 +44 +62 +65 +54 +44 +61 +36 +44 +59 +65 +45 +56 +38 +53 +44 +82 +45 +48 +57 +44 +42 +96 +61 +46 +48 +37 +32 +35 +37 +36 +39 +41 +46 +37 +51 +41 +44 +67 +51 +47 +39 +41 +37 +34 +70 +44 +47 +41 +45 +43 +48 +36 +67 +34 +54 +51 +53 +33 +44 +66 +51 +51 +50 +63 +55 +52 +64 +47 +37 +91 +44 +58 +46 +48 +56 +61 +56 +54 +42 +47 +54 +41 +47 +47 +62 +57 +37 +67 +42 +58 +68 +60 +42 +71 +53 +62 +62 +54 +46 +45 +37 +67 +50 +42 +52 +29 +62 +69 +54 +50 +50 +49 +51 +51 +47 +54 +44 +58 +46 +56 +55 +55 +58 +60 +71 +51 +54 +55 +51 +47 +60 +66 +58 +558 +45 +44 +53 +57 +40 +36 +33 +30 +39 +43 +41 +45 +45 +44 +30 +33 +31 +53 +29 +49 +43 +47 +46 +44 +62 +54 +50 +62 +66 +38 +48 +60 +53 +63 +55 +50 +171 +57 +59 +60 +53 +63 +59 +49 +50 +171 +56 +44 +77 +74 +61 +83 +73 +58 +81 +64 +49 +79 +65 +53 +64 +81 +67 +42 +44 +57 +93 +67 +44 +258 +49 +89 +41 +70 +70 +43 +72 +79 +43 +70 +72 +57 +64 +53 +68 +42 +72 +52 +70 +71 +61 +60 +82 +47 +41 +44 +76 +44 +55 +68 +61 +70 +53 +72 +53 +54 +70 +58 +83 +66 +45 +42 +41 +40 +41 +48 +43 +43 +56 +40 +60 +46 +44 +66 +57 +73 +79 +46 +46 +52 +53 +91 +62 +43 +67 +55 +52 +43 +44 +52 +63 +46 +83 +63 +49 +48 +48 +56 +45 +40 +81 +82 +54 +50 +38 +280 +28 +35 +274 +39 +53 +55 +54 +55 +57 +271 +29 +68 +620 +67 +49 +45 +28 +72 +35 +74 +66 +50 +40 +79 +82 +73 +74 +56 +87 +68 +45 +48 +70 +89 +55 +49 +59 +65 +84 +79 +61 +71 +40 +71 +67 +87 +59 +76 +96 +89 +64 +60 +55 +39 +43 +45 +59 +44 +51 +43 +49 +59 +47 +62 +31 +38 +42 +32 +30 +38 +90 +30 +32 +40 +52 +36 +42 +277 +50 +46 +45 +43 +38 +73 +56 +46 +35 +27 +43 +44 +46 +63 +28 +52 +55 +52 +32 +43 +73 +74 +31 +45 +73 +57 +40 +72 +60 +53 +54 +60 +63 +64 +81 +45 +58 +66 +60 +55 +43 +73 +43 +74 +65 +41 +44 +70 +64 +70 +134 +60 +68 +69 +51 +66 +69 +95 +46 +70 +59 +43 +56 +40 +33 +62 +45 +55 +62 +55 +51 +53 +51 +44 +43 +51 +36 +74 +48 +74 +32 +59 +56 +64 +48 +53 +35 +53 +73 +48 +50 +46 +103 +113 +84 +79 +92 +49 +63 +71 +59 +93 +68 +79 +43 +106 +98 +47 +65 +63 +60 +52 +57 +54 +79 +99 +57 +75 +100 +74 +73 +41 +72 +81 +60 +48 +83 +51 +70 +78 +89 +32 +89 +77 +42 +47 +54 +57 +59 +59 +64 +69 +34 +56 +66 +29 +34 +36 +50 +50 +52 +48 +242 +43 +32 +50 +47 +64 +54 +413 +38 +53 +55 +54 +667 +47 +49 +46 +41 +63 +69 +52 +51 +49 +52 +49 +41 +68 +52 +93 +43 +69 +79 +62 +69 +67 +50 +49 +72 +41 +70 +62 +61 +54 +84 +77 +62 +68 +46 +55 +83 +66 +63 +70 +76 +46 +84 +51 +63 +72 +53 +67 +56 +65 +64 +66 +68 +46 +37 +38 +39 +37 +38 +55 +48 +34 +47 +51 +77 +46 +52 +70 +50 +66 +52 +74 +70 +48 +61 +68 +49 +38 +89 +58 +57 +65 +69 +80 +88 +54 +52 +68 +81 +60 +55 +36 +82 +68 +48 +55 +84 +41 +55 +49 +62 +43 +37 +58 +74 +59 +61 +70 +53 +66 +65 +42 +44 +68 +64 +76 +41 +55 +83 +58 +66 +50 +58 +83 +39 +51 +48 +46 +55 +62 +55 +97 +59 +50 +53 +58 +56 +70 +57 +71 +81 +59 +64 +82 +38 +45 +59 +72 +62 +51 +49 +58 +79 +64 +73 +75 +47 +46 +83 +48 +61 +68 +54 +52 +53 +61 +64 +65 +66 +55 +52 +63 +54 +57 +83 +61 +61 +47 +45 +70 +40 +52 +55 +61 +41 +56 +51 +63 +78 +43 +56 +56 +60 +59 +59 +63 +35 +34 +57 +43 +34 +49 +47 +35 +34 +32 +34 +49 +35 +57 +33 +56 +60 +79 +61 +57 +48 +96 +59 +82 +78 +52 +53 +84 +60 +83 +35 +62 +75 +64 +72 +64 +73 +97 +46 +48 +64 +49 +74 +60 +81 +56 +64 +62 +79 +58 +59 +56 +47 +29 +45 +72 +58 +47 +36 +58 +37 +60 +48 +53 +66 +48 +65 +84 +43 +53 +58 +60 +61 +58 +60 +51 +75 +43 +50 +84 +59 +75 +50 +60 +41 +74 +50 +38 +53 +208 +45 +63 +76 +211 +72 +67 +65 +63 +67 +71 +51 +55 +49 +45 +67 +55 +59 +70 +65 +62 +65 +43 +77 +44 +59 +54 +44 +86 +48 +53 +60 +115 +53 +58 +45 +45 +38 +40 +49 +54 +31 +43 +26 +50 +63 +46 +46 +372 +346 +352 +64 +45 +59 +58 +58 +40 +50 +37 +50 +65 +64 +45 +64 +48 +54 +69 +51 +59 +57 +47 +85 +78 +80 +56 +57 +70 +70 +62 +268 +46 +36 +47 +41 +615 +72 +56 +59 +62 +59 +71 +45 +46 +65 +424 +65 +72 +71 +64 +41 +75 +83 +83 +62 +75 +51 +63 +54 +35 +45 +49 +386 +38 +41 +53 +51 +60 +68 +51 +45 +82 +75 +46 +49 +53 +63 +50 +49 +53 +61 +60 +52 +54 +301 +55 +64 +71 +57 +48 +85 +41 +85 +40 +26 +46 +42 +48 +320 +37 +48 +52 +78 +35 +40 +64 +37 +67 +51 +45 +62 +41 +61 +50 +48 +57 +92 +43 +49 +44 +50 +53 +47 +46 +52 +54 +68 +80 +75 +60 +69 +75 +35 +56 +53 +41 +48 +50 +55 +58 +63 +53 +39 +43 +54 +77 +35 +53 +48 +74 +54 +70 +51 +41 +60 +47 +41 +58 +57 +73 +71 +76 +63 +49 +51 +72 +62 +57 +70 +73 +57 +41 +66 +70 +55 +70 +47 +43 +35 +52 +361 +53 +53 +298 +42 +43 +254 +372 +65 +360 +371 +44 +370 +62 +56 +54 +60 +49 +42 +52 +41 +38 +64 +64 +62 +30 +34 +36 +32 +115 +50 +47 +38 +54 +61 +54 +53 +52 +39 +47 +41 +640 +60 +68 +48 +58 +54 +44 +62 +59 +68 +69 +59 +50 +48 +51 +50 +35 +44 +41 +54 +51 +58 +55 +50 +53 +46 +45 +43 +59 +43 +45 +52 +62 +58 +85 +66 +44 +61 +58 +37 +66 +63 +30 +63 +53 +88 +61 +66 +44 +63 +49 +71 +64 +42 +49 +74 +54 +56 +40 +63 +69 +42 +57 +71 +46 +46 +52 +40 +44 +59 +59 +54 +66 +44 +38 +63 +52 +52 +36 +32 +62 +45 +44 +60 +60 +80 +42 +58 +53 +72 +76 +67 +54 +364 +71 +50 +53 +63 +79 +70 +70 +74 +45 +32 +32 +61 +34 +62 +56 +60 +64 +46 +63 +51 +46 +49 +31 +43 +55 +52 +64 +46 +37 +91 +44 +51 +69 +58 +35 +45 +68 +55 +63 +45 +42 +37 +38 +290 +65 +57 +33 +42 +61 +54 +46 +48 +79 +68 +33 +32 +55 +57 +79 +30 +71 +37 +46 +44 +64 +58 +38 +77 +72 +52 +64 +65 +55 +61 +66 +62 +69 +51 +56 +79 +76 +52 +30 +58 +56 +75 +58 +54 +42 +57 +63 +51 +63 +42 +53 +51 +52 +47 +57 +45 +59 +65 +52 +36 +62 +71 +25 +57 +64 +40 +37 +56 +73 +43 +56 +68 +59 +69 +57 +73 +68 +50 +46 +55 +44 +43 +35 +51 +356 +53 +52 +293 +42 +43 +249 +367 +65 +355 +366 +44 +370 +370 +62 +59 +56 +70 +72 +46 +61 +69 +54 +51 +61 +35 +54 +50 +80 +294 +51 +69 +54 +56 +59 +63 +290 +45 +52 +65 +40 +60 +63 +34 +58 +51 +63 +43 +59 +50 +289 +355 +46 +78 +50 +44 +384 +35 +59 +48 +59 +67 +74 +56 +45 +72 +44 +44 +60 +53 +53 +71 +62 +55 +36 +69 +60 +62 +62 +67 +31 +59 +45 +42 +49 +48 +37 +43 +56 +47 +39 +43 +54 +43 +58 +43 +54 +68 +73 +49 +48 +56 +75 +54 +52 +57 +63 +75 +75 +66 +52 +61 +69 +56 +69 +66 +75 +44 +56 +41 +47 +58 +50 +77 +44 +57 +53 +43 +47 +57 +58 +41 +45 +41 +407 +43 +44 +56 +41 +298 +53 +55 +39 +37 +35 +42 +48 +43 +36 +52 +56 +64 +55 +69 +63 +58 +76 +68 +66 +83 +46 +73 +70 +70 +55 +75 +56 +78 +80 +46 +97 +53 +67 +66 +45 +96 +64 +39 +45 +59 +60 +68 +64 +84 +59 +82 +50 +79 +61 +57 +83 +46 +50 +53 +54 +75 +54 +46 +52 +53 +62 +61 +60 +65 +60 +63 +47 +89 +65 +74 +43 +56 +56 +72 +56 +79 +54 +55 +40 +46 +56 +44 +54 +53 +49 +48 +52 +44 +55 +68 +62 +65 +44 +42 +156 +71 +34 +65 +49 +83 +54 +77 +66 +51 +90 +44 +57 +65 +59 +62 +57 +50 +64 +71 +63 +49 +51 +71 +36 +56 +44 +48 +56 +50 +62 +56 +54 +48 +51 +39 +70 +30 +61 +61 +75 +55 +51 +65 +57 +58 +57 +43 +60 +58 +94 +65 +69 +37 +55 +47 +94 +56 +36 +41 +71 +863 +58 +62 +62 +42 +47 +62 +67 +67 +48 +84 +39 +68 +34 +49 +63 +57 +42 +46 +48 +886 +51 +59 +73 +92 +77 +44 +74 +42 +62 +56 +56 +59 +62 +57 +62 +47 +56 +60 +43 +62 +50 +58 +65 +56 +57 +62 +74 +55 +63 +56 +59 +64 +78 +42 +63 +79 +52 +56 +47 +89 +57 +33 +64 +61 +59 +42 +29 +58 +71 +58 +51 +47 +68 +73 +68 +76 +34 +49 +47 +44 +54 +40 +65 +75 +47 +56 +30 +61 +60 +74 +67 +34 +63 +49 +42 +54 +68 +56 +41 +67 +49 +54 +76 +67 +76 +71 +51 +76 +62 +44 +62 +52 +65 +50 +56 +66 +51 +55 +66 +70 +67 +55 +60 +55 +66 +66 +36 +52 +46 +74 +63 +44 +50 +70 +35 +62 +41 +55 +36 +90 +69 +50 +44 +57 +78 +68 +76 +66 +77 +48 +68 +41 +61 +57 +46 +38 +55 +48 +53 +41 +62 +60 +55 +63 +51 +57 +41 +53 +194 +43 +71 +53 +66 +65 +36 +60 +50 +70 +40 +65 +43 +67 +47 +56 +41 +65 +44 +51 +65 +84 +64 +68 +279 +41 +41 +41 +42 +57 +66 +46 +61 +66 +59 +44 +44 +45 +61 +68 +86 +56 +53 +52 +54 +72 +72 +82 +41 +133 +58 +62 +48 +39 +74 +73 +48 +64 +67 +46 +68 +68 +47 +77 +76 +1036 +67 +48 +57 +45 +72 +37 +66 +40 +50 +64 +58 +60 +78 +49 +51 +52 +56 +44 +45 +59 +68 +55 +43 +79 +52 +51 +688 +718 +53 +69 +719 +68 +75 +88 +46 +46 +44 +68 +671 +49 +51 +53 +46 +41 +52 +25 +56 +46 +89 +86 +86 +52 +37 +51 +60 +55 +72 +56 +59 +50 +66 +63 +49 +57 +43 +60 +50 +47 +67 +71 +55 +52 +59 +78 +66 +47 +63 +42 +43 +67 +45 +64 +73 +64 +78 +47 +54 +42 +38 +39 +44 +51 +38 +62 +71 +56 +41 +54 +45 +38 +58 +81 +50 +60 +49 +68 +50 +58 +65 +63 +62 +38 +72 +49 +44 +67 +44 +67 +82 +41 +42 +43 +75 +52 +50 +49 +58 +63 +54 +53 +51 +52 +61 +33 +44 +48 +40 +78 +50 +60 +51 +57 +62 +42 +70 +44 +247 +51 +43 +61 +55 +552 +63 +481 +64 +51 +56 +51 +56 +441 +58 +66 +56 +31 +46 +57 +50 +61 +55 +74 +44 +59 +51 +49 +43 +57 +54 +47 +65 +61 +60 +53 +43 +52 +55 +71 +60 +54 +39 +38 +172 +37 +60 +92 +66 +96 +47 +71 +65 +173 +44 +48 +53 +42 +50 +66 +66 +47 +29 +45 +74 +58 +45 +36 +58 +37 +60 +45 +52 +66 +45 +65 +84 +43 +53 +58 +60 +61 +79 +45 +41 +87 +75 +40 +66 +62 +33 +50 +50 +47 +32 +33 +33 +38 +49 +37 +37 +42 +33 +43 +51 +36 +45 +71 +75 +64 +60 +47 +48 +59 +68 +49 +55 +52 +61 +32 +44 +52 +68 +59 +52 +76 +56 +48 +47 +45 +44 +58 +80 +63 +51 +53 +67 +88 +52 +47 +37 +57 +685 +715 +55 +68 +716 +79 +73 +48 +48 +79 +668 +53 +57 +57 +53 +41 +63 +714 +66 +50 +91 +102 +75 +52 +61 +47 +65 +53 +51 +78 +53 +57 +45 +51 +47 +50 +46 +68 +54 +55 +44 +63 +94 +49 +48 +47 +105 +68 +55 +43 +91 +47 +49 +45 +58 +64 +39 +171 +57 +39 +41 +58 +41 +37 +50 +41 +56 +36 +51 +42 +54 +61 +45 +45 +46 +44 +61 +49 +78 +53 +64 +57 +65 +32 +96 +68 +42 +40 +57 +63 +40 +52 +66 +67 +53 +55 +50 +48 +46 +57 +67 +40 +48 +62 +53 +53 +52 +53 +65 +54 +43 +40 +39 +42 +62 +31 +36 +48 +45 +35 +48 +71 +165 +58 +55 +193 +54 +157 +60 +45 +47 +45 +48 +106 +40 +46 +53 +47 +53 +65 +59 +538 +46 +50 +42 +45 +48 +45 +195 +45 +126 +44 +51 +51 +84 +67 +44 +61 +51 +50 +54 +91 +72 +61 +69 +75 +77 +61 +58 +50 +65 +74 +40 +49 +43 +68 +50 +47 +40 +45 +47 +61 +50 +41 +60 +40 +47 +53 +46 +48 +43 +39 +40 +85 +48 +38 +45 +35 +42 +45 +41 +40 +53 +69 +34 +101 +38 +37 +38 +54 +39 +59 +52 +88 +495 +77 +40 +49 +40 +66 +34 +38 +39 +41 +495 +262 +64 +72 +46 +145 +262 +39 +46 +42 +43 +39 +46 +38 +39 +39 +72 +43 +61 +70 +72 +87 +71 +82 +72 +60 +97 +59 +82 +50 +51 +69 +71 +612 +435 +76 +62 +51 +49 +62 +53 +61 +53 +47 +65 +44 +46 +38 +53 +49 +42 +52 +51 +49 +60 +56 +47 +57 +42 +37 +39 +95 +41 +47 +40 +41 +38 +42 +45 +38 +41 +40 +116 +52 +43 +34 +38 +36 +40 +516 +36 +32 +77 +50 +33 +112 +45 +92 +129 +112 +40 +109 +192 +53 +40 +105 +44 +109 +122 +92 +49 +200 +39 +112 +114 +141 +275 +156 +112 +34 +112 +138 +146 +120 +39 +142 +166 +112 +242 +112 +47 +49 +49 +51 +62 +64 +54 +58 +62 +51 +63 +43 +44 +46 +45 +52 +48 +52 +49 +60 +54 +46 +38 +63 +60 +47 +59 +36 +58 +60 +76 +43 +59 +49 +70 +63 +38 +46 +47 +82 +53 +63 +64 +45 +38 +54 +71 +83 +67 +64 +48 +71 +67 +66 +53 +68 +80 +60 +81 +58 +65 +69 +34 +54 +54 +50 +62 +54 +75 +47 +45 +65 +50 +69 +66 +67 +73 +63 +47 +61 +43 +75 +58 +38 +53 +62 +50 +84 +56 +55 +51 +45 +65 +53 +48 +62 +43 +54 +73 +56 +63 +71 +98 +55 +67 +79 +63 +39 +38 +66 +69 +67 +66 +80 +47 +39 +50 +62 +72 +39 +57 +63 +62 +65 +61 +34 +48 +65 +65 +53 +52 +61 +49 +62 +67 +64 +55 +79 +69 +52 +64 +52 +76 +71 +60 +56 +53 +73 +37 +46 +45 +48 +42 +66 +66 +68 +43 +59 +57 +56 +67 +66 +54 +65 +48 +65 +63 +72 +57 +52 +54 +55 +54 +57 +54 +48 +69 +46 +75 +52 +41 +56 +53 +59 +73 +66 +52 +66 +39 +46 +49 +41 +53 +41 +49 +38 +50 +52 +44 +50 +57 +56 +46 +35 +65 +54 +40 +45 +50 +67 +58 +52 +108 +46 +41 +53 +51 +56 +62 +57 +58 +41 +53 +59 +60 +53 +59 +61 +76 +53 +41 +57 +37 +80 +65 +61 +49 +35 +60 +63 +78 +49 +62 +63 +62 +50 +48 +56 +47 +79 +61 +44 +51 +68 +79 +39 +49 +50 +31 +54 +38 +38 +32 +31 +52 +29 +74 +61 +76 +82 +71 +51 +55 +50 +64 +51 +46 +69 +58 +66 +51 +60 +54 +71 +76 +67 +53 +38 +71 +95 +85 +39 +114 +74 +85 +65 +81 +60 +59 +48 +42 +54 +49 +57 +49 +57 +49 +54 +39 +55 +49 +70 +57 +61 +70 +67 +46 +50 +49 +110 +120 +70 +40 +48 +110 +37 +507 +184 +54 +91 +106 +118 +114 +99 +36 +37 +115 +109 +73 +130 +123 +47 +51 +91 +35 +186 +62 +39 +39 +33 +33 +186 +189 +37 +189 +46 +37 +43 +41 +62 +59 +37 +42 +193 +58 +49 +79 +55 +52 +84 +44 +40 +56 +67 +62 +59 +52 +37 +38 +58 +56 +63 +60 +69 +83 +63 +64 +67 +66 +59 +64 +51 +54 +60 +75 +74 +73 +79 +63 +59 +109 +60 +38 +52 +50 +45 +50 +40 +36 +36 +38 +38 +33 +77 +34 +47 +34 +41 +38 +29 +49 +76 +37 +45 +37 +34 +36 +42 +56 +36 +36 +42 +50 +33 +63 +43 +52 +49 +46 +76 +41 +43 +43 +58 +80 +40 +36 +42 +94 +34 +41 +31 +50 +83 +51 +72 +75 +40 +67 +59 +58 +68 +58 +54 +34 +72 +51 +40 +58 +80 +49 +59 +61 +52 +52 +54 +39 +62 +70 +52 +45 +52 +51 +53 +67 +52 +57 +44 +67 +61 +62 +42 +31 +55 +42 +39 +42 +42 +33 +36 +44 +32 +36 +27 +43 +53 +45 +49 +41 +54 +58 +47 +37 +46 +53 +47 +38 +40 +40 +58 +39 +54 +28 +33 +101 +42 +62 +50 +37 +62 +48 +69 +70 +49 +79 +83 +76 +50 +62 +71 +56 +74 +64 +41 +53 +41 +48 +72 +56 +45 +42 +43 +50 +36 +350 +62 +34 +39 +343 +38 +80 +50 +64 +84 +81 +61 +70 +54 +62 +66 +60 +34 +38 +52 +42 +57 +63 +47 +46 +47 +38 +38 +40 +39 +35 +42 +65 +49 +63 +49 +51 +77 +50 +53 +64 +51 +78 +82 +33 +71 +71 +59 +48 +59 +50 +82 +51 +51 +70 +71 +77 +67 +64 +54 +51 +59 +62 +42 +68 +51 +54 +78 +56 +82 +64 +55 +91 +46 +60 +81 +71 +76 +48 +53 +56 +80 +58 +62 +60 +75 +85 +66 +51 +86 +63 +69 +76 +81 +33 +86 +76 +48 +55 +67 +63 +50 +67 +89 +50 +74 +53 +50 +37 +39 +47 +33 +38 +37 +42 +35 +40 +51 +63 +56 +48 +73 +58 +70 +75 +50 +828 +67 +62 +58 +53 +34 +59 +41 +52 +84 +42 +49 +70 +41 +70 +35 +41 +62 +54 +25 +53 +45 +89 +86 +82 +52 +50 +37 +48 +49 +76 +62 +61 +51 +46 +37 +69 +67 +69 +71 +61 +68 +64 +177 +59 +54 +44 +70 +55 +64 +68 +76 +223 +70 +53 +60 +67 +43 +55 +53 +42 +70 +66 +68 +43 +56 +55 +42 +60 +64 +63 +47 +38 +38 +63 +60 +83 +56 +64 +55 +57 +43 +52 +53 +41 +52 +90 +41 +54 +52 +50 +73 +49 +54 +50 +57 +83 +53 +63 +63 +54 +53 +54 +59 +64 +46 +54 +70 +60 +55 +51 +56 +53 +50 +56 +42 +68 +58 +46 +55 +59 +50 +57 +33 +52 +54 +74 +65 +55 +43 +54 +67 +64 +47 +45 +52 +79 +79 +68 +81 +72 +29 +63 +39 +32 +30 +28 +34 +38 +39 +46 +44 +375 +369 +48 +374 +46 +42 +52 +365 +63 +49 +45 +230 +66 +49 +376 +374 +41 +45 +80 +61 +45 +75 +66 +63 +61 +52 +83 +41 +80 +56 +72 +69 +62 +48 +69 +68 +78 +59 +58 +64 +43 +69 +71 +64 +77 +71 +56 +72 +57 +58 +59 +47 +33 +62 +42 +52 +60 +72 +40 +84 +73 +62 +48 +49 +64 +59 +45 +41 +56 +54 +74 +50 +43 +59 +37 +55 +45 +39 +48 +50 +48 +41 +62 +57 +57 +40 +46 +41 +46 +58 +62 +287 +57 +65 +52 +50 +49 +70 +48 +46 +45 +57 +50 +61 +61 +41 +131 +28 +57 +55 +60 +75 +50 +76 +64 +102 +42 +50 +37 +33 +58 +46 +58 +34 +35 +47 +42 +53 +56 +40 +753 +63 +54 +67 +49 +58 +62 +47 +62 +48 +37 +62 +66 +54 +47 +49 +41 +40 +40 +34 +41 +63 +83 +43 +47 +42 +417 +42 +43 +66 +37 +60 +64 +71 +65 +50 +47 +45 +39 +49 +34 +44 +60 +39 +57 +70 +65 +52 +43 +68 +44 +59 +56 +66 +65 +51 +43 +66 +70 +41 +37 +32 +58 +32 +33 +31 +35 +41 +63 +53 +77 +43 +49 +47 +65 +67 +51 +59 +53 +71 +62 +65 +94 +53 +58 +57 +83 +62 +85 +74 +85 +50 +62 +34 +61 +53 +38 +66 +57 +84 +62 +61 +61 +85 +69 +85 +74 +64 +59 +64 +81 +54 +517 +59 +60 +74 +55 +65 +50 +72 +64 +77 +66 +65 +55 +42 +40 +72 +52 +55 +70 +71 +42 +49 +70 +66 +60 +88 +56 +68 +92 +80 +66 +53 +52 +41 +35 +49 +50 +55 +64 +62 +82 +63 +76 +68 +62 +69 +56 +56 +74 +54 +47 +69 +52 +71 +59 +48 +65 +57 +82 +50 +68 +53 +51 +63 +82 +76 +68 +55 +64 +63 +58 +60 +46 +46 +56 +44 +54 +57 +78 +63 +65 +71 +65 +62 +49 +55 +48 +54 +52 +57 +42 +39 +40 +57 +75 +56 +48 +42 +73 +40 +71 +79 +54 +56 +69 +40 +51 +89 +73 +60 +51 +64 +57 +39 +65 +50 +63 +48 +42 +66 +65 +35 +42 +37 +45 +53 +44 +62 +80 +40 +53 +49 +56 +56 +51 +58 +57 +64 +77 +62 +70 +69 +57 +56 +64 +69 +49 +69 +76 +61 +42 +79 +48 +55 +76 +59 +74 +55 +55 +64 +58 +80 +55 +97 +83 +75 +65 +46 +54 +88 +37 +99 +86 +60 +60 +55 +60 +74 +77 +78 +45 +48 +52 +73 +57 +55 +66 +294 +38 +71 +84 +64 +64 +90 +70 +51 +38 +62 +57 +77 +52 +49 +78 +65 +69 +57 +69 +58 +37 +54 +71 +49 +65 +75 +75 +55 +56 +52 +40 +34 +73 +36 +49 +35 +76 +37 +36 +93 +51 +64 +37 +50 +56 +54 +51 +39 +60 +65 +33 +72 +39 +39 +38 +72 +61 +77 +57 +80 +59 +47 +39 +35 +68 +95 +43 +74 +1002 +61 +45 +40 +69 +65 +69 +49 +52 +59 +67 +51 +64 +71 +50 +66 +47 +50 +75 +81 +53 +71 +80 +75 +36 +51 +78 +51 +43 +378 +55 +43 +41 +31 +40 +50 +37 +44 +37 +61 +35 +38 +41 +55 +36 +40 +58 +41 +51 +55 +69 +54 +35 +39 +63 +37 +82 +609 +60 +60 +67 +52 +50 +54 +622 +55 +589 +49 +54 +76 +36 +49 +44 +33 +41 +33 +50 +613 +54 +62 +43 +49 +67 +58 +48 +40 +51 +96 +56 +61 +49 +59 +41 +61 +36 +40 +35 +57 +45 +57 +51 +49 +52 +35 +48 +58 +49 +33 +51 +48 +82 +55 +70 +54 +61 +64 +54 +80 +61 +48 +68 +58 +48 +57 +66 +54 +76 +69 +51 +56 +55 +43 +63 +343 +38 +396 +61 +388 +183 +48 +307 +130 +290 +57 +301 +141 +42 +48 +141 +34 +210 +128 +230 +124 +347 +42 +330 +107 +125 +118 +313 +94 +29 +299 +26 +242 +54 +121 +379 +238 +226 +138 +344 +213 +45 +228 +39 +397 +301 +304 +31 +293 +364 +52 +38 +276 +334 +285 +42 +46 +49 +222 +353 +38 +49 +68 +67 +50 +46 +54 +55 +66 +49 +59 +47 +58 +47 +56 +74 +57 +66 +47 +56 +75 +55 +67 +61 +50 +181 +52 +60 +52 +74 +69 +208 +382 +60 +228 +60 +53 +51 +47 +628 +86 +64 +51 +324 +53 +52 +52 +34 +78 +324 +67 +64 +66 +411 +47 +57 +45 +43 +229 +60 +63 +76 +47 +64 +74 +55 +63 +68 +61 +59 +35 +54 +58 +38 +64 +66 +57 +50 +65 +71 +46 +81 +51 +60 +89 +75 +81 +76 +65 +48 +51 +81 +82 +56 +41 +78 +83 +66 +58 +60 +76 +68 +74 +40 +58 +52 +38 +57 +61 +84 +95 +61 +50 +58 +54 +79 +39 +76 +46 +48 +53 +40 +55 +45 +35 +42 +38 +53 +57 +54 +54 +89 +61 +70 +62 +75 +62 +54 +65 +42 +62 +67 +65 +64 +67 +45 +66 +91 +54 +61 +99 +76 +61 +45 +53 +64 +40 +65 +59 +58 +42 +60 +60 +55 +72 +65 +65 +44 +65 +58 +58 +65 +56 +45 +57 +67 +52 +54 +65 +52 +54 +61 +44 +71 +57 +62 +57 +61 +45 +40 +57 +52 +44 +54 +65 +63 +61 +63 +39 +73 +60 +64 +53 +38 +39 +49 +48 +61 +64 +47 +52 +57 +47 +66 +74 +47 +41 +48 +43 +74 +64 +37 +61 +225 +54 +53 +50 +57 +207 +52 +43 +40 +215 +50 +47 +215 +31 +61 +49 +62 +50 +55 +58 +43 +57 +63 +44 +59 +50 +40 +46 +34 +40 +53 +58 +38 +53 +70 +47 +37 +38 +42 +37 +42 +31 +47 +36 +72 +41 +42 +34 +77 +82 +67 +44 +65 +75 +29 +57 +43 +76 +86 +57 +62 +37 +62 +74 +45 +71 +69 +85 +78 +69 +51 +59 +60 +61 +43 +43 +49 +53 +38 +57 +86 +44 +48 +46 +42 +46 +85 +54 +44 +49 +60 +47 +48 +66 +65 +56 +67 +88 +60 +52 +69 +77 +42 +47 +41 +78 +306 +62 +45 +309 +404 +61 +360 +58 +61 +265 +323 +343 +50 +355 +306 +314 +265 +71 +448 +110 +104 +272 +288 +53 +265 +451 +58 +292 +52 +49 +48 +59 +310 +48 +252 +57 +38 +115 +48 +54 +60 +64 +41 +57 +39 +56 +70 +60 +53 +46 +50 +81 +78 +42 +55 +78 +46 +87 +52 +66 +55 +73 +45 +52 +64 +69 +52 +37 +61 +84 +37 +45 +47 +58 +40 +47 +50 +69 +56 +58 +58 +49 +53 +66 +41 +38 +69 +54 +42 +52 +47 +67 +53 +48 +51 +40 +49 +42 +53 +46 +52 +58 +59 +69 +44 +55 +43 +38 +42 +45 +50 +57 +52 +44 +45 +41 +48 +46 +424 +261 +47 +46 +40 +51 +46 +79 +53 +39 +418 +409 +47 +43 +432 +52 +52 +392 +49 +43 +41 +84 +38 +37 +57 +54 +62 +58 +37 +53 +50 +57 +84 +72 +61 +54 +61 +64 +49 +49 +56 +53 +51 +53 +56 +67 +51 +58 +71 +44 +36 +45 +34 +54 +46 +56 +74 +52 +49 +359 +52 +64 +373 +36 +362 +216 +317 +52 +295 +53 +295 +100 +49 +47 +47 +49 +217 +36 +245 +46 +342 +321 +45 +320 +351 +256 +39 +385 +246 +229 +307 +52 +206 +43 +238 +350 +293 +62 +333 +47 +315 +322 +325 +48 +490 +298 +209 +335 +48 +32 +49 +45 +321 +80 +72 +82 +75 +78 +44 +75 +69 +75 +38 +73 +52 +59 +59 +56 +69 +51 +72 +65 +42 +74 +34 +60 +71 +49 +63 +64 +42 +52 +55 +43 +47 +51 +60 +46 +44 +44 +40 +42 +67 +49 +45 +44 +46 +65 +65 +54 +74 +74 +77 +65 +58 +71 +52 +50 +61 +62 +43 +43 +44 +64 +57 +41 +58 +46 +40 +34 +50 +45 +53 +70 +67 +34 +38 +46 +48 +45 +31 +68 +88 +63 +62 +242 +57 +70 +43 +68 +76 +42 +54 +51 +48 +59 +69 +45 +49 +46 +245 +45 +73 +72 +44 +82 +60 +38 +57 +71 +37 +48 +61 +55 +42 +52 +40 +46 +63 +50 +59 +43 +68 +47 +66 +230 +77 +64 +59 +37 +73 +46 +74 +65 +79 +66 +46 +79 +72 +71 +64 +90 +62 +69 +74 +65 +41 +95 +70 +73 +65 +66 +64 +50 +67 +66 +53 +74 +61 +63 +68 +58 +71 +54 +50 +52 +69 +63 +97 +46 +46 +66 +62 +51 +50 +66 +53 +74 +49 +45 +42 +65 +51 +88 +51 +41 +55 +48 +66 +53 +47 +48 +48 +58 +67 +56 +49 +60 +76 +51 +69 +85 +76 +63 +69 +57 +72 +75 +73 +59 +55 +60 +38 +61 +63 +44 +57 +63 +45 +59 +59 +49 +53 +47 +59 +43 +47 +55 +44 +50 +70 +43 +46 +43 +52 +43 +61 +70 +69 +34 +33 +48 +51 +93 +54 +35 +55 +56 +60 +56 +55 +63 +62 +71 +60 +47 +70 +71 +66 +81 +64 +78 +64 +65 +86 +68 +52 +43 +85 +46 +54 +66 +60 +58 +70 +59 +69 +41 +41 +67 +56 +68 +70 +60 +42 +69 +65 +231 +64 +62 +69 +67 +53 +72 +98 +44 +53 +47 +62 +59 +52 +75 +46 +40 +46 +57 +51 +71 +45 +71 +47 +52 +52 +61 +46 +65 +50 +59 +71 +58 +32 +50 +51 +39 +47 +69 +51 +48 +30 +38 +39 +57 +47 +44 +53 +52 +36 +51 +219 +44 +54 +32 +45 +37 +49 +52 +40 +39 +46 +47 +59 +70 +60 +42 +42 +39 +52 +64 +62 +56 +98 +100 +56 +55 +39 +58 +68 +55 +46 +74 +44 +68 +48 +55 +101 +37 +58 +55 +45 +88 +52 +45 +43 +60 +51 +60 +66 +79 +50 +67 +50 +61 +44 +47 +47 +47 +44 +65 +61 +90 +47 +43 +49 +45 +47 +61 +45 +59 +69 +42 +49 +63 +36 +49 +43 +53 +66 +50 +44 +35 +46 +43 +46 +42 +46 +43 +46 +43 +46 +35 +34 +62 +57 +39 +31 +74 +33 +64 +69 +63 +63 +48 +65 +68 +51 +46 +52 +65 +54 +61 +64 +58 +68 +64 +60 +73 +61 +70 +50 +64 +77 +75 +67 +85 +42 +68 +57 +55 +60 +40 +74 +67 +62 +54 +56 +58 +53 +68 +68 +50 +79 +36 +43 +253 +46 +45 +35 +60 +32 +39 +59 +55 +51 +44 +36 +43 +50 +47 +136 +41 +52 +125 +37 +138 +55 +55 +44 +139 +44 +134 +50 +144 +73 +127 +142 +43 +126 +39 +44 +50 +45 +37 +48 +48 +43 +38 +55 +66 +47 +58 +59 +57 +39 +41 +35 +48 +40 +48 +60 +75 +44 +49 +45 +48 +43 +61 +43 +59 +38 +47 +61 +141 +59 +141 +34 +60 +37 +61 +45 +124 +63 +36 +72 +44 +59 +115 +44 +35 +57 +164 +132 +131 +125 +49 +63 +133 +181 +41 +42 +47 +57 +132 +71 +126 +109 +134 +113 +123 +149 +61 +48 +97 +55 +123 +137 +36 +127 +49 +44 +42 +53 +122 +52 +43 +154 +40 +53 +44 +51 +30 +38 +61 +30 +46 +156 +60 +118 +48 +64 +66 +88 +71 +68 +50 +36 +76 +59 +55 +38 +49 +76 +49 +56 +47 +67 +62 +52 +750 +59 +60 +113 +37 +50 +42 +75 +89 +64 +38 +48 +80 +57 +62 +61 +72 +76 +56 +57 +52 +66 +48 +40 +74 +41 +49 +51 +58 +75 +45 +50 +52 +43 +46 +50 +60 +68 +52 +61 +68 +45 +39 +36 +43 +54 +304 +49 +51 +316 +32 +102 +123 +211 +42 +44 +154 +44 +48 +36 +41 +50 +51 +58 +35 +157 +214 +48 +235 +173 +42 +51 +35 +43 +61 +43 +54 +48 +70 +59 +73 +61 +58 +69 +48 +53 +53 +51 +44 +51 +53 +52 +63 +59 +83 +66 +75 +48 +50 +57 +66 +69 +66 +65 +76 +63 +71 +66 +72 +101 +47 +47 +69 +61 +59 +55 +69 +60 +72 +65 +83 +98 +79 +70 +46 +72 +72 +63 +53 +84 +72 +63 +70 +57 +67 +48 +66 +55 +63 +58 +44 +51 +31 +51 +48 +49 +78 +41 +47 +59 +45 +40 +43 +51 +59 +36 +54 +50 +57 +64 +75 +239 +68 +252 +42 +243 +223 +65 +41 +246 +242 +43 +257 +44 +372 +45 +59 +459 +260 +261 +45 +39 +148 +251 +52 +446 +277 +447 +411 +270 +409 +436 +269 +229 +294 +274 +148 +225 +239 +47 +58 +351 +292 +62 +52 +45 +242 +245 +46 +53 +53 +36 +50 +54 +58 +56 +48 +46 +57 +54 +32 +32 +51 +58 +32 +43 +48 +36 +67 +51 +43 +36 +46 +43 +51 +55 +56 +65 +46 +77 +46 +33 +38 +41 +40 +33 +41 +41 +40 +32 +32 +32 +35 +35 +45 +42 +43 +43 +42 +46 +58 +88 +35 +76 +83 +44 +366 +67 +76 +85 +70 +45 +82 +62 +73 +96 +43 +61 +90 +79 +72 +62 +78 +74 +96 +63 +77 +49 +47 +93 +57 +71 +66 +59 +59 +72 +87 +55 +103 +52 +45 +60 +84 +93 +88 +64 +51 +44 +42 +46 +76 +85 +89 +64 +84 +75 +85 +45 +54 +89 +62 +77 +99 +93 +70 +80 +61 +79 +71 +70 +49 +43 +68 +69 +59 +59 +50 +51 +78 +67 +78 +62 +89 +93 +89 +81 +32 +28 +70 +51 +73 +63 +52 +88 +59 +67 +49 +78 +71 +89 +48 +42 +47 +55 +49 +66 +42 +29 +47 +44 +51 +38 +47 +51 +44 +42 +56 +51 +30 +35 +46 +44 +64 +56 +59 +56 +63 +56 +62 +65 +40 +170 +58 +88 +60 +40 +29 +38 +69 +64 +75 +63 +50 +77 +64 +61 +54 +55 +45 +48 +60 +75 +58 +62 +65 +59 +47 +49 +65 +43 +63 +57 +58 +33 +60 +70 +91 +61 +63 +52 +47 +64 +51 +77 +66 +50 +51 +49 +67 +65 +63 +43 +76 +62 +84 +59 +55 +52 +58 +57 +44 +66 +41 +43 +45 +56 +41 +56 +63 +49 +42 +43 +48 +49 +46 +56 +43 +39 +59 +56 +55 +44 +40 +48 +49 +48 +36 +50 +41 +44 +54 +51 +62 +48 +56 +54 +62 +52 +70 +47 +53 +46 +55 +39 +58 +33 +71 +71 +47 +49 +45 +55 +65 +44 +46 +50 +46 +61 +58 +69 +46 +48 +87 +78 +78 +37 +52 +37 +41 +57 +60 +50 +351 +53 +346 +65 +49 +338 +338 +263 +55 +56 +37 +59 +42 +639 +66 +34 +45 +51 +73 +49 +156 +69 +27 +62 +64 +46 +66 +60 +52 +70 +93 +57 +49 +78 +74 +61 +63 +80 +163 +63 +163 +243 +83 +69 +49 +52 +59 +57 +57 +53 +60 +46 +58 +56 +52 +57 +71 +53 +45 +64 +36 +51 +52 +62 +60 +57 +71 +41 +61 +52 +78 +40 +65 +42 +56 +37 +69 +62 +60 +64 +70 +51 +57 +58 +67 +35 +62 +54 +68 +314 +77 +137 +58 +61 +138 +156 +342 +43 +277 +48 +43 +216 +41 +128 +268 +349 +316 +79 +120 +365 +145 +330 +265 +380 +67 +373 +283 +77 +113 +377 +63 +116 +56 +141 +50 +354 +137 +51 +43 +362 +353 +60 +45 +70 +44 +135 +60 +44 +41 +86 +64 +42 +58 +47 +42 +50 +54 +57 +46 +57 +62 +60 +49 +64 +42 +56 +60 +87 +62 +61 +59 +58 +49 +76 +82 +64 +40 +53 +62 +48 +42 +43 +72 +49 +63 +71 +48 +68 +64 +62 +91 +54 +48 +56 +52 +51 +46 +70 +48 +68 +45 +38 +55 +57 +57 +63 +67 +48 +69 +49 +34 +43 +82 +73 +40 +70 +70 +67 +46 +68 +62 +28 +39 +42 +50 +78 +57 +41 +40 +57 +121 +52 +45 +59 +39 +55 +74 +59 +75 +55 +55 +64 +58 +34 +76 +55 +97 +83 +75 +65 +46 +54 +84 +37 +99 +86 +60 +60 +55 +56 +74 +73 +78 +45 +48 +52 +73 +57 +55 +66 +297 +38 +70 +87 +65 +67 +86 +70 +51 +817 +68 +78 +73 +72 +41 +66 +73 +58 +48 +338 +51 +38 +47 +49 +36 +52 +69 +46 +55 +62 +43 +58 +52 +43 +57 +42 +49 +69 +43 +51 +40 +50 +47 +35 +67 +52 +59 +54 +42 +42 +37 +63 +53 +51 +49 +36 +59 +82 +74 +72 +63 +35 +59 +61 +72 +84 +87 +85 +56 +56 +53 +41 +66 +45 +48 +73 +48 +68 +71 +505 +61 +79 +59 +78 +71 +44 +59 +47 +44 +62 +70 +67 +43 +76 +181 +80 +90 +65 +51 +62 +67 +67 +71 +61 +73 +64 +68 +85 +68 +66 +54 +73 +41 +55 +47 +69 +68 +72 +57 +64 +58 +58 +53 +55 +41 +46 +46 +434 +248 +48 +53 +43 +36 +54 +53 +62 +59 +41 +493 +56 +62 +47 +61 +74 +62 +31 +44 +54 +60 +34 +67 +47 +37 +48 +72 +57 +52 +59 +48 +45 +60 +61 +74 +44 +54 +58 +89 +42 +53 +53 +47 +37 +42 +34 +42 +40 +56 +74 +42 +61 +89 +76 +41 +58 +34 +41 +43 +32 +34 +52 +30 +33 +64 +59 +63 +53 +59 +66 +46 +69 +56 +50 +48 +36 +30 +60 +65 +66 +68 +47 +52 +59 +52 +56 +65 +35 +35 +35 +44 +35 +35 +33 +35 +35 +67 +33 +35 +39 +36 +33 +44 +60 +42 +36 +30 +54 +47 +54 +30 +30 +36 +46 +44 +37 +47 +49 +76 +56 +71 +57 +76 +56 +65 +52 +60 +47 +62 +70 +47 +58 +66 +92 +82 +81 +47 +45 +78 +60 +72 +67 +47 +66 +91 +51 +64 +61 +82 +43 +90 +48 +31 +39 +36 +331 +428 +168 +48 +63 +73 +49 +68 +53 +69 +54 +34 +61 +81 +68 +39 +84 +68 +51 +68 +55 +70 +42 +42 +58 +63 +62 +43 +413 +54 +63 +628 +343 +49 +347 +304 +342 +63 +514 +419 +133 +451 +151 +510 +371 +380 +311 +371 +395 +54 +354 +45 +152 +45 +54 +54 +346 +50 +61 +426 +146 +45 +51 +456 +34 +366 +142 +51 +60 +99 +48 +50 +317 +348 +35 +41 +64 +52 +60 +55 +54 +65 +56 +63 +52 +68 +51 +56 +61 +58 +37 +49 +50 +63 +53 +54 +38 +45 +60 +76 +47 +42 +53 +60 +77 +56 +62 +55 +60 +73 +61 +31 +44 +54 +60 +34 +66 +324 +38 +368 +373 +202 +55 +342 +125 +303 +308 +133 +231 +117 +47 +251 +358 +352 +106 +355 +343 +275 +369 +254 +39 +243 +348 +38 +204 +250 +114 +368 +301 +353 +314 +374 +297 +45 +311 +303 +236 +362 +41 +49 +309 +97 +324 +42 +148 +251 +53 +36 +42 +50 +69 +41 +46 +47 +49 +33 +55 +59 +46 +49 +54 +58 +57 +49 +57 +41 +48 +53 +87 +47 +75 +43 +43 +54 +66 +72 +78 +47 +52 +58 +72 +51 +45 +51 +74 +71 +49 +74 +56 +54 +46 +45 +57 +71 +63 +60 +47 +60 +39 +67 +58 +62 +59 +70 +87 +70 +43 +72 +64 +64 +70 +60 +51 +69 +57 +72 +38 +69 +57 +37 +37 +35 +39 +54 +45 +54 +61 +37 +677 +46 +54 +84 +49 +272 +46 +53 +53 +61 +60 +54 +66 +56 +56 +55 +57 +55 +704 +35 +64 +265 +56 +37 +74 +46 +54 +56 +45 +50 +58 +68 +59 +60 +58 +63 +58 +714 +78 +65 +54 +68 +308 +79 +41 +60 +72 +60 +67 +65 +55 +54 +54 +44 +60 +729 +37 +51 +725 +59 +63 +61 +67 +57 +57 +52 +66 +83 +58 +91 +60 +33 +83 +84 +53 +37 +42 +64 +23 +48 +56 +67 +42 +83 +37 +64 +72 +58 +60 +61 +62 +56 +64 +64 +54 +56 +59 +62 +55 +55 +159 +193 +70 +135 +57 +69 +55 +60 +156 +50 +69 +155 +62 +43 +62 +36 +57 +37 +41 +64 +158 +61 +37 +63 +46 +66 +51 +36 +56 +67 +43 +50 +45 +52 +37 +148 +30 +113 +36 +45 +46 +125 +36 +34 +36 +37 +38 +34 +43 +42 +41 +43 +38 +47 +36 +42 +36 +66 +56 +67 +279 +47 +57 +74 +78 +57 +58 +56 +285 +44 +236 +75 +61 +73 +284 +47 +58 +67 +50 +53 +80 +80 +48 +54 +59 +56 +56 +58 +63 +294 +90 +782 +69 +71 +286 +63 +67 +788 +62 +51 +56 +74 +989 +88 +74 +56 +56 +69 +45 +74 +65 +71 +51 +50 +43 +63 +57 +38 +58 +36 +72 +50 +59 +40 +55 +56 +43 +53 +40 +53 +38 +29 +38 +60 +58 +40 +47 +38 +65 +38 +38 +61 +49 +40 +57 +47 +75 +59 +63 +62 +33 +47 +60 +48 +52 +43 +51 +43 +51 +35 +43 +35 +45 +51 +42 +41 +55 +44 +51 +57 +71 +81 +74 +68 +67 +50 +58 +54 +42 +55 +50 +64 +55 +78 +69 +85 +46 +33 +53 +52 +51 +42 +51 +64 +58 +51 +51 +44 +58 +69 +82 +45 +67 +59 +73 +73 +55 +39 +77 +46 +68 +64 +68 +60 +46 +62 +42 +54 +61 +36 +64 +45 +63 +55 +66 +42 +85 +50 +49 +65 +82 +86 +70 +69 +56 +83 +57 +62 +51 +60 +63 +58 +65 +39 +83 +44 +57 +51 +72 +51 +69 +40 +58 +55 +81 +50 +60 +31 +50 +66 +66 +47 +62 +56 +44 +45 +46 +32 +68 +39 +72 +46 +61 +54 +67 +52 +55 +48 +51 +59 +59 +62 +36 +49 +101 +42 +63 +51 +37 +62 +48 +69 +70 +79 +83 +76 +50 +62 +71 +56 +69 +64 +63 +72 +83 +69 +55 +123 +74 +51 +90 +30 +54 +54 +50 +57 +55 +52 +62 +50 +44 +64 +55 +76 +56 +72 +62 +51 +41 +25 +37 +56 +74 +73 +40 +63 +44 +32 +38 +37 +72 +160 +64 +41 +60 +38 +44 +160 +43 +129 +217 +131 +45 +52 +62 +48 +37 +57 +158 +48 +53 +57 +49 +75 +80 +43 +48 +73 +44 +36 +82 +74 +63 +76 +75 +54 +73 +65 +63 +59 +50 +61 +50 +80 +56 +53 +64 +41 +34 +44 +41 +49 +44 +39 +34 +39 +34 +31 +41 +45 +45 +41 +41 +56 +40 +41 +41 +50 +56 +56 +42 +33 +48 +44 +52 +47 +36 +47 +58 +45 +59 +54 +41 +50 +40 +55 +41 +34 +46 +36 +50 +48 +36 +39 +44 +99 +43 +73 +56 +64 +60 +70 +57 +54 +45 +30 +63 +44 +40 +32 +32 +29 +34 +34 +40 +55 +53 +37 +66 +63 +51 +49 +40 +55 +57 +56 +59 +55 +65 +42 +55 +45 +42 +55 +70 +52 +59 +37 +67 +38 +41 +36 +39 +61 +51 +45 +50 +27 +60 +54 +68 +68 +55 +75 +54 +48 +47 +47 +47 +60 +58 +57 +47 +60 +51 +41 +58 +73 +47 +71 +50 +54 +38 +493 +44 +40 +56 +45 +42 +32 +59 +36 +54 +45 +44 +43 +44 +39 +36 +33 +35 +33 +43 +46 +83 +35 +79 +56 +54 +67 +34 +54 +42 +52 +87 +63 +49 +47 +70 +82 +52 +50 +77 +68 +47 +77 +38 +295 +69 +51 +289 +41 +50 +69 +58 +59 +50 +286 +27 +629 +41 +41 +26 +628 +85 +34 +54 +362 +55 +53 +35 +59 +81 +45 +92 +59 +28 +37 +68 +53 +73 +74 +75 +61 +62 +58 +43 +61 +37 +37 +35 +37 +75 +49 +51 +42 +53 +39 +74 +46 +40 +53 +46 +39 +39 +40 +57 +33 +49 +58 +51 +83 +68 +68 +58 +83 +68 +62 +48 +60 +64 +50 +54 +62 +59 +52 +46 +72 +46 +39 +58 +63 +61 +36 +59 +66 +45 +62 +46 +45 +75 +38 +41 +51 +104 +57 +47 +41 +32 +34 +43 +58 +42 +45 +54 +56 +36 +47 +41 +36 +46 +61 +38 +34 +56 +34 +58 +56 +62 +50 +53 +43 +49 +73 +56 +63 +40 +45 +57 +32 +62 +58 +57 +66 +68 +39 +58 +52 +53 +41 +47 +52 +41 +47 +54 +49 +65 +63 +58 +61 +62 +52 +54 +40 +75 +51 +72 +63 +70 +80 +43 +80 +76 +60 +35 +71 +76 +50 +44 +72 +51 +36 +35 +47 +44 +47 +45 +80 +77 +78 +41 +73 +67 +84 +63 +59 +78 +65 +79 +44 +59 +45 +58 +47 +290 +58 +45 +59 +63 +78 +52 +150 +298 +70 +230 +60 +86 +61 +58 +47 +67 +45 +52 +72 +52 +75 +37 +35 +34 +65 +62 +32 +40 +41 +63 +40 +35 +49 +48 +52 +64 +35 +39 +57 +34 +55 +41 +33 +61 +60 +54 +42 +57 +53 +48 +49 +37 +49 +42 +47 +45 +67 +54 +78 +44 +47 +60 +46 +61 +52 +56 +44 +64 +49 +60 +53 +54 +65 +66 +50 +54 +49 +59 +65 +65 +54 +54 +64 +65 +61 +72 +41 +70 +52 +68 +64 +54 +55 +53 +62 +59 +74 +89 +54 +71 +64 +44 +43 +66 +66 +90 +44 +75 +61 +24 +62 +51 +44 +57 +57 +56 +33 +62 +49 +46 +42 +61 +48 +65 +52 +66 +51 +46 +63 +33 +82 +64 +53 +67 +66 +60 +60 +48 +45 +75 +37 +51 +53 +34 +54 +39 +39 +55 +60 +46 +45 +63 +46 +54 +246 +50 +57 +55 +57 +34 +35 +214 +54 +65 +268 +41 +67 +59 +67 +85 +50 +61 +64 +40 +60 +67 +49 +49 +41 +57 +40 +38 +39 +59 +31 +36 +52 +56 +42 +57 +35 +42 +38 +47 +47 +53 +46 +50 +43 +38 +38 +43 +48 +53 +50 +53 +40 +62 +46 +43 +48 +41 +53 +43 +28 +54 +53 +58 +43 +67 +44 +44 +57 +51 +62 +40 +61 +70 +44 +39 +37 +41 +46 +62 +68 +87 +71 +50 +55 +48 +68 +44 +68 +71 +46 +33 +72 +63 +64 +50 +59 +48 +33 +78 +50 +50 +73 +45 +68 +62 +48 +50 +63 +396 +437 +45 +404 +53 +63 +402 +39 +50 +409 +46 +122 +48 +44 +44 +67 +39 +61 +50 +33 +82 +55 +82 +69 +54 +78 +75 +54 +40 +56 +94 +53 +55 +59 +47 +55 +55 +77 +47 +66 +42 +29 +66 +72 +64 +64 +65 +66 +75 +39 +55 +55 +79 +61 +59 +60 +69 +55 +75 +76 +45 +70 +82 +76 +43 +63 +74 +62 +77 +65 +76 +73 +62 +69 +48 +53 +58 +66 +39 +36 +30 +39 +40 +42 +36 +39 +55 +41 +70 +38 +69 +40 +70 +29 +48 +44 +55 +50 +63 +36 +76 +57 +62 +65 +77 +62 +67 +57 +54 +63 +52 +51 +58 +51 +58 +62 +51 +44 +56 +59 +68 +60 +60 +49 +57 +58 +46 +54 +97 +58 +49 +38 +53 +60 +52 +46 +49 +49 +53 +58 +66 +54 +58 +50 +51 +58 +49 +49 +49 +53 +50 +57 +74 +45 +47 +47 +49 +64 +43 +62 +64 +47 +53 +50 +66 +33 +62 +75 +45 +49 +55 +73 +47 +51 +57 +69 +69 +47 +79 +56 +42 +43 +53 +48 +45 +47 +38 +47 +54 +55 +40 +45 +49 +46 +76 +42 +56 +50 +60 +53 +73 +58 +43 +48 +60 +58 +47 +51 +43 +60 +73 +43 +45 +57 +40 +38 +66 +37 +54 +55 +58 +52 +41 +45 +41 +50 +71 +49 +38 +37 +43 +48 +56 +40 +53 +45 +57 +52 +65 +34 +73 +74 +40 +70 +52 +70 +38 +47 +52 +59 +143 +59 +55 +52 +43 +58 +76 +61 +55 +65 +63 +44 +70 +42 +46 +90 +41 +45 +64 +34 +46 +53 +51 +66 +66 +50 +47 +45 +55 +54 +48 +48 +70 +61 +91 +60 +51 +38 +52 +47 +62 +64 +143 +83 +57 +55 +45 +57 +58 +51 +66 +67 +63 +70 +50 +50 +48 +71 +47 +48 +79 +67 +48 +64 +76 +42 +70 +58 +78 +37 +66 +42 +101 +64 +53 +51 +48 +562 +62 +47 +540 +67 +71 +47 +761 +56 +767 +273 +69 +355 +71 +53 +52 +215 +330 +68 +95 +37 +33 +42 +39 +40 +29 +38 +43 +41 +34 +43 +47 +30 +40 +40 +40 +49 +49 +40 +40 +33 +37 +44 +50 +34 +49 +31 +49 +27 +71 +42 +32 +34 +41 +49 +36 +44 +40 +46 +33 +49 +37 +51 +27 +35 +73 +30 +39 +49 +58 +55 +58 +70 +45 +31 +42 +50 +40 +77 +59 +32 +65 +71 +60 +54 +46 +64 +43 +63 +45 +45 +48 +60 +55 +35 +56 +46 +65 +50 +64 +56 +46 +39 +50 +60 +56 +42 +68 +79 +56 +68 +61 +54 +56 +58 +53 +52 +56 +49 +64 +60 +47 +49 +45 +66 +70 +30 +66 +32 +39 +51 +59 +53 +56 +76 +41 +63 +58 +68 +75 +63 +83 +73 +43 +72 +45 +69 +61 +62 +52 +57 +76 +71 +72 +44 +83 +60 +51 +49 +67 +56 +55 +36 +64 +46 +37 +54 +35 +45 +41 +39 +45 +37 +41 +49 +41 +53 +50 +65 +62 +61 +67 +50 +60 +65 +67 +62 +41 +54 +77 +57 +56 +70 +55 +61 +61 +47 +70 +75 +68 +38 +46 +36 +40 +43 +54 +49 +53 +49 +32 +48 +42 +392 +48 +49 +38 +48 +51 +55 +54 +57 +50 +45 +61 +96 +42 +948 +65 +45 +42 +41 +79 +50 +50 +71 +67 +158 +52 +57 +41 +40 +48 +62 +76 +71 +35 +69 +52 +53 +65 +63 +58 +49 +62 +37 +55 +64 +41 +80 +52 +53 +69 +87 +62 +62 +49 +62 +57 +74 +62 +34 +67 +31 +69 +59 +47 +44 +44 +50 +61 +39 +63 +61 +45 +57 +77 +65 +45 +53 +49 +93 +59 +54 +61 +47 +51 +73 +68 +49 +56 +84 +45 +67 +57 +69 +68 +64 +65 +51 +70 +44 +39 +61 +49 +48 +76 +61 +53 +73 +45 +64 +65 +53 +53 +64 +62 +42 +69 +54 +62 +58 +52 +50 +56 +31 +60 +54 +47 +73 +42 +71 +54 +48 +61 +35 +65 +38 +60 +38 +57 +32 +67 +49 +49 +35 +56 +72 +50 +58 +54 +44 +53 +56 +61 +58 +390 +42 +48 +42 +59 +39 +45 +43 +37 +44 +51 +42 +35 +32 +52 +59 +48 +54 +65 +62 +54 +70 +55 +48 +54 +65 +57 +59 +59 +601 +61 +40 +48 +55 +65 +65 +50 +46 +53 +577 +49 +48 +49 +57 +49 +72 +40 +62 +59 +48 +52 +51 +71 +54 +46 +60 +55 +61 +71 +56 +56 +167 +46 +61 +78 +55 +53 +56 +31 +62 +57 +29 +55 +71 +93 +30 +46 +51 +61 +45 +31 +48 +62 +62 +63 +63 +55 +43 +77 +45 +51 +70 +57 +73 +40 +66 +67 +42 +59 +74 +75 +58 +57 +99 +70 +84 +69 +68 +55 +55 +72 +65 +78 +75 +70 +66 +84 +54 +97 +47 +38 +64 +80 +41 +50 +35 +57 +56 +79 +51 +70 +46 +49 +52 +55 +77 +70 +49 +63 +58 +60 +65 +68 +68 +45 +55 +77 +66 +65 +59 +56 +60 +59 +74 +70 +70 +66 +69 +63 +64 +65 +64 +44 +49 +74 +50 +60 +59 +111 +87 +56 +72 +73 +73 +51 +54 +48 +60 +71 +70 +79 +57 +58 +59 +49 +67 +91 +69 +43 +58 +72 +77 +46 +57 +39 +63 +87 +60 +57 +43 +44 +60 +64 +57 +46 +68 +48 +57 +54 +62 +72 +68 +38 +75 +67 +48 +73 +62 +72 +81 +62 +51 +51 +71 +50 +50 +62 +54 +65 +65 +56 +52 +50 +68 +43 +58 +67 +59 +62 +75 +45 +68 +62 +54 +58 +107 +81 +69 +72 +58 +700 +78 +46 +58 +53 +69 +66 +72 +41 +57 +48 +286 +55 +728 +476 +52 +114 +128 +57 +311 +35 +61 +62 +44 +43 +68 +59 +71 +32 +65 +56 +73 +269 +290 +55 +50 +50 +78 +51 +83 +82 +80 +64 +51 +65 +66 +65 +70 +86 +61 +85 +56 +47 +84 +72 +71 +88 +52 +51 +41 +66 +46 +57 +49 +47 +59 +58 +66 +49 +52 +52 +59 +74 +57 +79 +75 +78 +60 +101 +53 +46 +67 +51 +58 +82 +49 +52 +58 +46 +47 +36 +299 +70 +32 +56 +293 +41 +52 +70 +58 +62 +53 +290 +26 +629 +47 +45 +25 +63 +625 +81 +31 +50 +362 +713 +64 +266 +50 +64 +122 +54 +49 +131 +294 +297 +243 +38 +496 +41 +240 +46 +47 +278 +277 +103 +286 +43 +285 +246 +50 +259 +239 +242 +241 +135 +265 +49 +115 +272 +113 +111 +112 +279 +52 +63 +124 +127 +98 +304 +239 +41 +260 +145 +298 +96 +51 +69 +48 +59 +81 +69 +61 +71 +35 +53 +50 +68 +54 +50 +55 +58 +64 +71 +54 +48 +55 +58 +50 +71 +49 +62 +40 +56 +64 +59 +41 +68 +63 +65 +63 +68 +191 +61 +47 +59 +57 +55 +49 +70 +52 +73 +309 +338 +329 +66 +122 +485 +33 +235 +77 +134 +663 +50 +43 +34 +44 +42 +40 +50 +48 +334 +333 +124 +53 +333 +325 +241 +60 +280 +289 +113 +42 +120 +112 +282 +294 +275 +48 +60 +57 +334 +133 +113 +305 +119 +54 +344 +70 +38 +267 +46 +58 +109 +47 +128 +323 +273 +344 +117 +75 +48 +55 +48 +61 +242 +61 +51 +88 +65 +71 +51 +75 +54 +45 +39 +60 +66 +40 +55 +46 +48 +57 +66 +39 +52 +55 +56 +67 +68 +55 +45 +60 +53 +64 +56 +47 +72 +63 +52 +63 +48 +67 +49 +58 +56 +68 +69 +57 +44 +41 +65 +85 +68 +56 +47 +43 +49 +52 +68 +72 +46 +37 +254 +35 +47 +41 +112 +88 +32 +51 +31 +383 +52 +36 +25 +327 +36 +38 +61 +51 +65 +33 +79 +34 +50 +332 +27 +50 +37 +43 +53 +210 +45 +64 +72 +211 +662 +35 +63 +74 +77 +62 +62 +45 +39 +62 +49 +53 +81 +49 +38 +66 +40 +77 +72 +66 +30 +44 +74 +43 +34 +44 +81 +56 +70 +86 +47 +47 +63 +51 +56 +71 +55 +40 +78 +36 +46 +67 +57 +57 +44 +56 +54 +50 +65 +74 +70 +60 +41 +43 +47 +69 +53 +38 +60 +45 +79 +63 +74 +72 +42 +54 +53 +50 +56 +71 +62 +65 +65 +56 +50 +76 +53 +68 +49 +53 +77 +54 +37 +60 +78 +48 +38 +46 +63 +35 +45 +54 +43 +57 +36 +68 +51 +59 +44 +59 +88 +60 +56 +58 +46 +45 +45 +52 +46 +61 +44 +54 +57 +50 +60 +69 +200 +50 +167 +47 +158 +83 +124 +40 +268 +65 +50 +44 +193 +50 +63 +107 +61 +54 +62 +275 +35 +59 +44 +62 +46 +58 +78 +75 +75 +64 +65 +53 +53 +62 +39 +60 +66 +51 +64 +50 +37 +59 +87 +60 +65 +53 +52 +44 +68 +68 +66 +43 +54 +41 +54 +53 +47 +61 +63 +63 +74 +64 +88 +45 +53 +93 +58 +62 +60 +42 +33 +46 +37 +29 +43 +44 +61 +42 +43 +43 +43 +36 +49 +47 +33 +39 +43 +35 +55 +51 +58 +60 +71 +71 +63 +50 +48 +52 +51 +51 +44 +44 +56 +76 +59 +38 +49 +53 +57 +75 +62 +39 +45 +49 +59 +73 +60 +51 +59 +71 +69 +40 +59 +69 +73 +63 +55 +44 +46 +52 +63 +49 +45 +47 +55 +46 +68 +54 +40 +63 +50 +60 +30 +47 +50 +63 +45 +47 +54 +45 +67 +42 +50 +34 +31 +486 +194 +62 +67 +59 +65 +65 +67 +70 +58 +183 +50 +79 +90 +184 +65 +49 +52 +59 +44 +70 +62 +50 +41 +245 +56 +181 +49 +123 +62 +44 +42 +45 +55 +51 +48 +53 +52 +43 +46 +42 +53 +74 +67 +42 +35 +39 +59 +53 +42 +41 +48 +66 +45 +49 +52 +55 +45 +42 +42 +56 +43 +54 +51 +34 +48 +70 +42 +39 +45 +60 +52 +332 +45 +45 +51 +44 +55 +57 +48 +39 +49 +43 +63 +64 +48 +32 +54 +34 +38 +43 +38 +66 +44 +65 +46 +43 +66 +31 +53 +47 +66 +54 +33 +298 +53 +324 +29 +325 +194 +31 +542 +59 +435 +41 +426 +194 +236 +52 +358 +323 +51 +49 +534 +59 +364 +267 +320 +39 +241 +221 +56 +333 +53 +190 +52 +225 +38 +305 +258 +358 +271 +317 +276 +54 +39 +316 +443 +243 +348 +52 +45 +41 +296 +312 +244 +62 +51 +343 +41 +232 +63 +260 +51 +41 +48 +69 +42 +284 +54 +63 +79 +53 +58 +50 +46 +67 +48 +57 +72 +53 +80 +54 +61 +50 +63 +58 +254 +57 +55 +65 +63 +68 +54 +44 +41 +54 +43 +74 +42 +65 +34 +138 +54 +48 +34 +46 +33 +54 +49 +64 +156 +56 +52 +41 +42 +61 +62 +301 +38 +66 +63 +67 +51 +52 +32 +34 +60 +43 +49 +49 +47 +53 +361 +47 +67 +63 +37 +47 +57 +53 +50 +79 +84 +66 +76 +42 +63 +55 +30 +28 +37 +28 +38 +40 +28 +39 +35 +60 +32 +56 +55 +110 +41 +32 +52 +47 +41 +32 +52 +37 +60 +49 +54 +66 +53 +77 +73 +45 +42 +49 +35 +64 +64 +48 +50 +60 +40 +55 +50 +46 +53 +54 +50 +66 +36 +67 +56 +57 +59 +51 +75 +58 +40 +43 +61 +63 +55 +30 +55 +31 +35 +38 +43 +35 +32 +51 +57 +51 +369 +482 +31 +470 +199 +40 +328 +126 +29 +33 +319 +54 +306 +133 +47 +30 +44 +144 +244 +47 +237 +48 +119 +432 +47 +361 +86 +157 +115 +45 +334 +130 +358 +260 +158 +435 +249 +223 +137 +376 +46 +47 +229 +46 +64 +242 +118 +456 +352 +50 +345 +326 +388 +313 +47 +360 +298 +54 +223 +35 +379 +45 +108 +47 +33 +411 +379 +121 +248 +46 +142 +51 +364 +32 +130 +325 +58 +66 +63 +43 +50 +49 +43 +63 +51 +43 +59 +63 +70 +51 +68 +59 +91 +63 +41 +94 +54 +59 +47 +49 +78 +62 +45 +63 +56 +60 +57 +59 +49 +67 +62 +62 +74 +66 +56 +58 +88 +49 +63 +69 +59 +62 +62 +60 +301 +42 +64 +46 +51 +60 +65 +59 +51 +34 +35 +57 +40 +51 +51 +54 +361 +50 +69 +61 +36 +42 +59 +51 +53 +548 +54 +69 +37 +46 +36 +43 +59 +53 +72 +65 +62 +41 +76 +55 +40 +68 +46 +56 +62 +52 +62 +42 +53 +48 +89 +61 +54 +244 +264 +80 +54 +58 +244 +87 +61 +52 +244 +54 +57 +268 +43 +40 +59 +48 +82 +33 +50 +64 +64 +91 +65 +88 +47 +39 +62 +68 +68 +71 +59 +39 +66 +71 +66 +61 +38 +49 +63 +51 +59 +45 +64 +40 +57 +70 +51 +69 +70 +69 +62 +66 +54 +63 +78 +64 +42 +48 +70 +72 +62 +48 +87 +81 +59 +74 +74 +41 +45 +48 +71 +71 +57 +55 +64 +51 +75 +54 +38 +53 +51 +47 +62 +59 +51 +47 +78 +58 +68 +46 +79 +90 +53 +48 +39 +31 +42 +36 +31 +35 +46 +39 +41 +44 +61 +47 +51 +33 +62 +47 +40 +65 +69 +83 +54 +62 +52 +69 +34 +50 +55 +74 +47 +77 +83 +55 +64 +45 +38 +59 +43 +73 +99 +64 +58 +68 +54 +39 +42 +67 +85 +43 +52 +34 +57 +40 +56 +57 +87 +62 +52 +57 +56 +71 +71 +33 +196 +58 +54 +53 +57 +51 +60 +59 +55 +58 +39 +33 +52 +62 +55 +65 +81 +78 +73 +71 +53 +70 +65 +43 +62 +64 +63 +44 +57 +58 +63 +44 +39 +57 +69 +57 +61 +79 +35 +72 +44 +688 +58 +840 +82 +383 +77 +57 +61 +572 +66 +58 +65 +64 +65 +85 +42 +61 +56 +89 +58 +63 +39 +66 +47 +53 +60 +57 +42 +30 +80 +50 +43 +45 +62 +50 +44 +46 +38 +48 +69 +45 +59 +52 +40 +56 +45 +40 +46 +53 +66 +54 +51 +57 +43 +63 +43 +50 +60 +50 +77 +83 +56 +77 +75 +36 +72 +45 +44 +83 +36 +41 +983 +66 +79 +40 +51 +50 +67 +66 +60 +60 +87 +38 +77 +39 +35 +74 +40 +54 +45 +895 +63 +52 +78 +42 +67 +42 +70 +863 +84 +85 +71 +67 +50 +40 +42 +48 +42 +81 +53 +65 +73 +378 +55 +141 +56 +134 +141 +79 +355 +233 +46 +294 +48 +256 +130 +285 +52 +371 +341 +112 +139 +419 +145 +363 +68 +326 +485 +224 +27 +128 +55 +57 +42 +463 +49 +339 +39 +55 +122 +460 +59 +114 +269 +48 +132 +396 +57 +147 +49 +70 +415 +46 +46 +378 +52 +115 +108 +36 +123 +249 +386 +364 +52 +52 +245 +285 +56 +135 +426 +68 +53 +49 +64 +36 +62 +71 +74 +63 +84 +57 +57 +50 +44 +42 +45 +28 +40 +41 +45 +40 +36 +32 +51 +42 +46 +40 +43 +37 +53 +56 +35 +55 +39 +62 +47 +53 +46 +52 +36 +60 +48 +37 +61 +56 +50 +39 +43 +40 +68 +53 +41 +67 +48 +699 +50 +445 +43 +51 +55 +53 +43 +704 +48 +39 +709 +35 +53 +47 +449 +61 +38 +66 +70 +50 +71 +34 +46 +43 +39 +52 +246 +38 +50 +64 +30 +53 +43 +49 +35 +45 +59 +67 +42 +59 +46 +64 +45 +73 +1060 +33 +56 +58 +55 +50 +52 +1061 +1062 +67 +69 +68 +58 +41 +93 +75 +72 +50 +56 +72 +44 +64 +59 +54 +67 +89 +43 +65 +33 +64 +48 +67 +60 +35 +35 +45 +54 +65 +75 +61 +66 +38 +42 +809 +66 +824 +59 +60 +187 +66 +62 +87 +189 +78 +81 +49 +68 +81 +68 +57 +63 +43 +86 +52 +57 +51 +44 +60 +46 +53 +69 +73 +68 +50 +62 +47 +57 +60 +55 +74 +52 +62 +73 +41 +42 +69 +52 +49 +56 +41 +63 +39 +54 +42 +59 +56 +63 +41 +114 +82 +67 +73 +49 +44 +47 +58 +67 +57 +24 +49 +83 +57 +70 +79 +58 +61 +57 +80 +43 +42 +51 +65 +72 +48 +51 +82 +59 +78 +43 +186 +47 +59 +37 +83 +103 +73 +80 +57 +42 +81 +68 +58 +54 +61 +45 +43 +50 +36 +35 +47 +47 +50 +57 +76 +67 +43 +51 +44 +63 +65 +55 +50 +49 +41 +71 +71 +50 +57 +62 +51 +65 +68 +51 +52 +44 +47 +43 +48 +47 +45 +67 +27 +53 +42 +43 +48 +40 +31 +27 +69 +46 +58 +31 +54 +51 +42 +66 +26 +46 +58 +33 +38 +58 +96 +67 +63 +91 +86 +63 +98 +98 +94 +75 +39 +41 +43 +55 +75 +60 +52 +57 +63 +77 +59 +84 +44 +33 +60 +91 +65 +33 +82 +49 +59 +94 +61 +39 +58 +62 +48 +61 +73 +63 +27 +51 +54 +51 +79 +97 +39 +39 +62 +43 +39 +61 +72 +42 +67 +83 +60 +58 +37 +62 +43 +47 +58 +42 +33 +38 +37 +31 +53 +69 +56 +80 +52 +54 +62 +60 +61 +48 +69 +54 +46 +68 +60 +48 +59 +71 +72 +51 +54 +63 +53 +85 +40 +67 +61 +49 +69 +46 +70 +65 +73 +49 +71 +62 +61 +119 +69 +120 +119 +79 +70 +59 +51 +41 +48 +74 +78 +81 +83 +65 +68 +61 +55 +68 +91 +44 +48 +58 +44 +64 +56 +61 +51 +43 +51 +40 +40 +69 +43 +50 +48 +403 +46 +54 +54 +50 +48 +38 +250 +55 +48 +121 +54 +46 +31 +55 +41 +53 +38 +37 +28 +38 +40 +69 +38 +47 +43 +51 +28 +73 +34 +67 +39 +47 +37 +47 +38 +57 +59 +64 +66 +56 +65 +50 +86 +58 +36 +58 +60 +87 +66 +57 +68 +64 +61 +62 +71 +68 +58 +58 +55 +55 +53 +64 +63 +72 +43 +78 +64 +72 +56 +59 +63 +68 +63 +53 +71 +41 +45 +58 +45 +43 +65 +49 +44 +47 +55 +37 +45 +41 +45 +48 +35 +50 +58 +46 +44 +45 +33 +56 +49 +49 +38 +45 +45 +52 +29 +65 +44 +42 +58 +63 +87 +50 +69 +74 +70 +66 +45 +55 +79 +62 +57 +55 +53 +35 +54 +53 +55 +68 +64 +46 +50 +55 +57 +67 +72 +58 +53 +81 +73 +37 +69 +74 +77 +80 +77 +54 +56 +72 +52 +79 +48 +49 +54 +51 +53 +51 +50 +60 +46 +50 +60 +58 +49 +66 +41 +74 +54 +46 +48 +49 +45 +70 +73 +40 +75 +60 +64 +78 +61 +53 +63 +25 +57 +63 +72 +35 +50 +50 +38 +51 +53 +68 +70 +89 +59 +64 +51 +71 +73 +76 +58 +71 +29 +63 +72 +53 +37 +65 +49 +70 +64 +70 +63 +33 +36 +52 +78 +58 +73 +44 +73 +63 +69 +516 +56 +46 +61 +33 +53 +65 +35 +44 +40 +33 +43 +37 +38 +38 +64 +36 +36 +44 +39 +457 +388 +145 +39 +463 +35 +54 +397 +46 +409 +383 +41 +139 +51 +51 +117 +142 +43 +149 +527 +39 +55 +213 +217 +217 +48 +41 +30 +38 +216 +227 +217 +47 +32 +37 +65 +223 +400 +154 +37 +38 +41 +48 +52 +65 +65 +53 +48 +61 +39 +41 +33 +36 +32 +32 +59 +41 +48 +41 +46 +38 +55 +51 +28 +46 +46 +35 +32 +44 +63 +32 +29 +38 +31 +33 +61 +30 +51 +44 +50 +40 +56 +62 +68 +64 +48 +66 +45 +71 +70 +64 +90 +42 +51 +65 +39 +43 +78 +41 +63 +54 +49 +47 +47 +72 +80 +41 +67 +33 +52 +65 +78 +53 +67 +52 +49 +57 +64 +56 +58 +37 +60 +73 +71 +37 +53 +238 +68 +72 +73 +52 +43 +38 +80 +46 +39 +40 +52 +46 +47 +52 +73 +56 +28 +49 +45 +45 +48 +39 +55 +45 +36 +47 +43 +34 +42 +56 +40 +63 +71 +94 +60 +77 +88 +41 +60 +63 +60 +55 +68 +60 +51 +45 +47 +38 +65 +81 +67 +61 +67 +48 +72 +64 +55 +45 +55 +68 +64 +64 +48 +68 +43 +89 +87 +67 +77 +60 +76 +49 +51 +61 +44 +55 +46 +42 +49 +50 +62 +62 +42 +51 +43 +62 +44 +55 +44 +39 +89 +49 +55 +58 +58 +37 +58 +61 +54 +58 +62 +53 +55 +63 +44 +50 +64 +35 +53 +60 +62 +50 +51 +57 +54 +36 +80 +58 +38 +60 +54 +53 +61 +45 +58 +49 +62 +71 +41 +67 +73 +42 +52 +38 +56 +52 +48 +54 +44 +40 +39 +31 +44 +39 +37 +39 +44 +71 +61 +68 +99 +39 +56 +56 +67 +67 +35 +71 +57 +43 +46 +53 +57 +64 +46 +62 +73 +33 +54 +56 +59 +51 +67 +79 +61 +31 +56 +36 +51 +45 +81 +61 +29 +62 +39 +43 +54 +60 +54 +96 +68 +65 +48 +39 +49 +61 +50 +45 +58 +71 +58 +66 +61 +53 +66 +75 +81 +61 +54 +52 +57 +75 +66 +55 +70 +67 +59 +67 +62 +52 +917 +73 +46 +39 +38 +57 +61 +60 +65 +73 +91 +46 +59 +58 +68 +67 +85 +67 +60 +45 +48 +46 +88 +58 +67 +42 +85 +86 +69 +89 +64 +62 +68 +89 +63 +78 +44 +46 +51 +62 +43 +63 +50 +77 +31 +48 +51 +61 +61 +53 +56 +41 +71 +48 +59 +39 +47 +60 +66 +42 +61 +71 +50 +49 +57 +240 +56 +47 +60 +46 +45 +40 +53 +51 +58 +42 +48 +53 +40 +44 +52 +51 +58 +43 +43 +40 +36 +26 +36 +51 +45 +46 +42 +45 +60 +655 +45 +43 +45 +45 +54 +49 +64 +42 +57 +32 +42 +36 +41 +25 +29 +44 +35 +47 +39 +40 +44 +42 +44 +52 +50 +42 +34 +38 +33 +44 +55 +40 +38 +42 +190 +42 +52 +42 +35 +200 +39 +54 +50 +69 +42 +42 +41 +188 +65 +45 +58 +154 +49 +59 +55 +200 +62 +66 +59 +49 +42 +59 +48 +55 +48 +48 +59 +59 +88 +38 +37 +59 +41 +43 +40 +60 +38 +43 +48 +34 +68 +92 +74 +39 +43 +79 +53 +59 +81 +70 +88 +54 +68 +59 +51 +57 +88 +53 +35 +46 +39 +37 +31 +52 +75 +45 +55 +81 +47 +48 +53 +48 +69 +36 +48 +50 +62 +55 +73 +48 +50 +69 +72 +54 +48 +38 +64 +77 +60 +86 +47 +56 +58 +68 +72 +45 +52 +369 +45 +38 +66 +373 +52 +44 +50 +34 +46 +74 +67 +56 +64 +49 +82 +67 +61 +36 +64 +52 +57 +70 +36 +57 +70 +62 +45 +61 +67 +92 +90 +55 +39 +84 +86 +43 +34 +68 +62 +45 +66 +60 +36 +71 +43 +41 +54 +58 +46 +40 +56 +42 +58 +49 +69 +73 +65 +73 +41 +41 +92 +59 +45 +52 +86 +60 +70 +52 +48 +53 +58 +75 +41 +49 +63 +43 +58 +63 +67 +60 +46 +50 +72 +59 +62 +53 +61 +58 +51 +41 +43 +59 +58 +55 +53 +54 +56 +58 +53 +54 +41 +44 +52 +47 +62 +74 +77 +61 +54 +62 +55 +62 +65 +29 +63 +39 +56 +75 +55 +57 +69 +52 +41 +55 +45 +47 +80 +47 +55 +49 +48 +56 +56 +45 +44 +61 +57 +46 +57 +44 +63 +44 +52 +50 +70 +57 +53 +48 +39 +55 +53 +61 +46 +50 +44 +57 +74 +49 +51 +49 +46 +76 +62 +71 +46 +69 +53 +37 +59 +53 +38 +69 +48 +64 +53 +70 +54 +40 +63 +40 +63 +72 +59 +47 +50 +40 +63 +67 +51 +68 +57 +60 +46 +59 +38 +54 +40 +44 +49 +43 +53 +50 +55 +58 +58 +55 +48 +63 +52 +77 +994 +67 +67 +72 +64 +60 +63 +72 +67 +92 +44 +63 +52 +53 +51 +78 +74 +64 +66 +55 +64 +74 +82 +310 +34 +299 +42 +64 +52 +71 +265 +33 +65 +448 +280 +50 +50 +318 +310 +310 +310 +265 +272 +260 +283 +286 +43 +62 +293 +115 +124 +292 +61 +116 +313 +256 +48 +37 +300 +60 +311 +37 +50 +450 +285 +258 +61 +51 +72 +57 +58 +55 +32 +61 +62 +59 +41 +60 +88 +44 +57 +85 +49 +62 +56 +39 +57 +71 +36 +42 +33 +62 +64 +44 +51 +42 +59 +60 +53 +49 +81 +61 +63 +65 +71 +46 +55 +67 +77 +50 +67 +64 +42 +45 +68 +45 +56 +65 +42 +71 +55 +283 +37 +320 +420 +60 +126 +52 +133 +346 +54 +257 +128 +308 +123 +50 +302 +296 +282 +306 +118 +272 +52 +237 +57 +345 +117 +241 +289 +31 +255 +56 +76 +440 +53 +113 +62 +53 +114 +301 +59 +121 +38 +31 +74 +30 +30 +48 +371 +217 +328 +40 +249 +313 +244 +57 +302 +71 +208 +67 +57 +54 +42 +236 +448 +241 +70 +49 +66 +71 +52 +468 +49 +329 +64 +45 +326 +48 +68 +70 +66 +68 +60 +435 +43 +45 +65 +239 +54 +47 +66 +42 +45 +41 +51 +61 +74 +61 +427 +54 +44 +40 +80 +66 +50 +37 +493 +44 +40 +56 +43 +42 +32 +55 +36 +54 +44 +44 +43 +44 +39 +36 +33 +35 +33 +547 +42 +40 +79 +87 +58 +41 +46 +46 +44 +44 +57 +66 +64 +61 +71 +68 +47 +77 +54 +62 +49 +56 +58 +69 +70 +69 +50 +59 +67 +77 +62 +43 +46 +42 +53 +39 +54 +87 +46 +48 +48 +43 +85 +482 +46 +46 +43 +55 +51 +58 +71 +46 +59 +63 +61 +59 +82 +55 +48 +68 +60 +71 +50 +58 +53 +50 +59 +65 +54 +64 +63 +68 +75 +37 +53 +57 +46 +68 +38 +298 +39 +58 +50 +62 +49 +55 +39 +57 +57 +72 +61 +39 +55 +56 +39 +39 +41 +74 +48 +54 +40 +54 +69 +51 +47 +54 +132 +43 +30 +42 +39 +42 +41 +38 +28 +70 +53 +42 +36 +52 +47 +56 +80 +53 +66 +58 +47 +66 +54 +48 +50 +51 +70 +36 +61 +50 +50 +87 +56 +59 +51 +37 +57 +37 +57 +50 +35 +56 +47 +51 +37 +44 +27 +46 +134 +65 +71 +69 +46 +73 +44 +91 +33 +134 +43 +52 +52 +43 +56 +55 +42 +60 +64 +63 +47 +37 +38 +63 +60 +75 +55 +64 +55 +55 +43 +52 +53 +41 +52 +82 +41 +54 +52 +50 +73 +49 +52 +59 +35 +48 +68 +821 +800 +64 +49 +62 +79 +27 +63 +808 +48 +53 +45 +55 +60 +57 +809 +67 +45 +58 +54 +57 +53 +820 +821 +55 +794 +81 +63 +64 +62 +58 +62 +68 +63 +92 +73 +46 +41 +67 +66 +93 +53 +59 +78 From c1c96d27e8660f5e5a11503515289f25dc76c158 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 13:44:38 -0600 Subject: [PATCH 02/47] Fix kernel length bug --- kernel.cpp | 6 ++---- 1 file changed, 2 insertions(+), 4 deletions(-) diff --git a/kernel.cpp b/kernel.cpp index fe6b757..0e57d79 100644 --- a/kernel.cpp +++ b/kernel.cpp @@ -652,17 +652,15 @@ gpu_bsw::sequence_aa_kernel(char* seqA_array, char* seqB_array, unsigned* prefix // the shorter of the two strings is stored in thread registers if(lengthSeqA < lengthSeqB) { - if(thread_Id < lengthSeqA){ + if(thread_Id < lengthSeqA) myColumnChar = seqA[thread_Id]; // read only once longer_seq = seqB; } - } else { - if(thread_Id < lengthSeqB){ + if(thread_Id < lengthSeqB) myColumnChar = seqB[thread_Id]; longer_seq = seqA; - } } __syncthreads(); // this is required here so that complete sequence has been copied to shared memory From a55371eaba6ce76a1cc08f551bcfcf2b6d50e76e Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 14:52:40 -0600 Subject: [PATCH 03/47] Align kernels to show analogous structure --- kernel.cpp | 1387 ++++++++++++++++++++++++++-------------------------- kernel.hpp | 82 +++- 2 files changed, 764 insertions(+), 705 deletions(-) diff --git a/kernel.cpp b/kernel.cpp index 0e57d79..814fd50 100644 --- a/kernel.cpp +++ b/kernel.cpp @@ -1,20 +1,18 @@ #include __inline__ __device__ short -gpu_bsw::warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, unsigned lengthSeqB) +gpu_bsw::warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) { - int warpSize = 32; - short myMax = 0; + constexpr int warpSize = 32; + short myMax = val; short newInd = 0; short newInd2 = 0; short ind = myIndex; short ind2 = myIndex2; - myMax = val; unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x // unsigned newmask; for(int offset = warpSize / 2; offset > 0; offset /= 2) { - int tempVal = __shfl_down_sync(mask, val, offset); val = max(val,tempVal); newInd = __shfl_down_sync(mask, ind, offset); @@ -45,9 +43,9 @@ gpu_bsw::warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIn } __inline__ __device__ short -gpu_bsw::warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, unsigned lengthSeqB) +gpu_bsw::warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) { - int warpSize = 32; + constexpr int warpSize = 32; short myMax = 0; short newInd = 0; short newInd2 = 0; @@ -90,14 +88,14 @@ gpu_bsw::warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, un __device__ short gpu_bsw::blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) { - int laneId = threadIdx.x % 32; - int warpId = threadIdx.x / 32; + const int laneId = threadIdx.x % 32; + const int warpId = threadIdx.x / 32; __shared__ short locTots[32]; __shared__ short locInds[32]; __shared__ short locInds2[32]; - short myInd = myIndex; - short myInd2 = myIndex2; - myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); + short myInd = myIndex; + short myInd2 = myIndex2; + myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); if(laneId == 0) @@ -137,14 +135,14 @@ gpu_bsw::blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, shor __device__ short gpu_bsw::blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) { - int laneId = threadIdx.x % 32; - int warpId = threadIdx.x / 32; + const int laneId = threadIdx.x % 32; + const int warpId = threadIdx.x / 32; __shared__ short locTots[32]; __shared__ short locInds[32]; __shared__ short locInds2[32]; - short myInd = myIndex; - short myInd2 = myIndex2; - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + short myInd = myIndex; + short myInd2 = myIndex2; + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); if(laneId == 0) @@ -184,7 +182,7 @@ gpu_bsw::blockShuffleReduce_with_index(short myVal, short& myIndex, short& myInd __device__ __host__ short - gpu_bsw::findMaxFour(short first, short second, short third, short fourth) +gpu_bsw::findMaxFour(const short first, const short second, const short third, const short fourth) { short maxScore = 0; @@ -196,417 +194,446 @@ __device__ __host__ short } __global__ void -gpu_bsw::sequence_dna_kernel(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short matchScore, short misMatchScore, short startGap, short extendGap) -{ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - - unsigned lengthSeqA; - unsigned lengthSeqB; - // local pointers - char* seqA; - char* seqB; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - char* longer_seq; - -// setting up block local sequences and their lengths. - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - // what is the max length and what is the min length - unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; +gpu_bsw::sequence_dna_kernel( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short matchScore, + const short misMatchScore, + const short startGap, + const short extendGap +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; -// shared memory space for storing longer of the two strings + unsigned lengthSeqA; + unsigned lengthSeqB; + // local pointers + char* seqA; + char* seqB; + char* longer_seq; - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; - char myColumnChar; - // the shorter of the two strings is stored in thread registers - if(lengthSeqA < lengthSeqB) - { - if(thread_Id < lengthSeqA) - myColumnChar = seqA[thread_Id]; // read only once - longer_seq = seqB; - } - else - { - if(thread_Id < lengthSeqB) - myColumnChar = seqB[thread_Id]; - longer_seq = seqA; - } + // setting up block local sequences and their lengths. + if(block_Id == 0) + { + lengthSeqA = prefix_lengthA[0]; + lengthSeqB = prefix_lengthB[0]; + seqA = seqA_array; + seqB = seqB_array; + } + else + { + lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; + lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory + // what is the max length and what is the min length + unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; + unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + // shared memory space for storing longer of the two strings + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; + char myColumnChar; + // the shorter of the two strings is stored in thread registers + if(lengthSeqA < lengthSeqB) + { + if(thread_Id < lengthSeqA) + myColumnChar = seqA[thread_Id]; // read only once + longer_seq = seqB; + } + else + { + if(thread_Id < lengthSeqB) + myColumnChar = seqB[thread_Id]; + longer_seq = seqA; + } - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; + __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; - __syncthreads(); // to make sure all shmem allocations have been initialized + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; - for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) - { // iterate for the number of anti-diagonals + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; + __syncthreads(); // to make sure all shmem allocations have been initialized - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; + for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) + { // iterate for the number of anti-diagonals - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; + is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + + _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; + _curr_H = 0; + + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; + + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; + + if(laneId == 31) + { // if you are the last thread in your warp then spill your values to shmem + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } + if(diag >= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } + __syncthreads(); // this is needed so that all the shmem writes are completed. - if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + short eVal=0, heVal = 0; + + if(diag >= maxSize) // when the previous thread has phased out, get value from shmem + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } - __syncthreads(); // this is needed so that all the shmem writes are completed. + if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0, heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H = 0; + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - short diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); // why do I need this? commenting it out breaks it + short diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; } - __syncthreads(); + __syncthreads(); // why do I need this? commenting it out breaks it + } + __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - if(thread_Id == 0) + if(thread_Id == 0) + { + if(lengthSeqA < lengthSeqB) { - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; } + else + { + seqA_align_end[block_Id] = thread_max_i; + seqB_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + } } + __global__ void -gpu_bsw::sequence_dna_reverse(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short matchScore, short misMatchScore, short startGap, short extendGap){ - - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - // local pointers - char* seqA; - char* seqB; - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - char* longer_seq; +gpu_bsw::sequence_dna_reverse( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short matchScore, + const short misMatchScore, + const short startGap, + const short extendGap +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; + // local pointers + char* seqA; + char* seqB; + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; + char* longer_seq; // setting up block local sequences and their lengths. - if(block_Id == 0) - { - seqA = seqA_array; - seqB = seqB_array; - } - else - { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - + if(block_Id == 0) + { + seqA = seqA_array; + seqB = seqB_array; + } + else + { + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } - int newlengthSeqA = seqA_align_end[block_Id]; - int newlengthSeqB = seqB_align_end[block_Id]; + int newlengthSeqA = seqA_align_end[block_Id]; + int newlengthSeqB = seqB_align_end[block_Id]; - unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; - unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; - char myColumnChar; + unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; + unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; + char myColumnChar; - is_valid = &is_valid_array[0]; //reset is_valid array for second iter - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes + is_valid = &is_valid_array[0]; //reset is_valid array for second iter + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); + __syncthreads(); // this is required because shmem writes //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before + if(newlengthSeqA < newlengthSeqB) + { + if(thread_Id < newlengthSeqA) + { + myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once + longer_seq = seqB; + } + } + else + { + if(thread_Id < newlengthSeqB) + { + myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; + longer_seq = seqA; + } + } - if(newlengthSeqA < newlengthSeqB) - { - if(thread_Id < newlengthSeqA) - { - myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once - longer_seq = seqB; - } - } - else - { - if(thread_Id < newlengthSeqB) - { - myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; - longer_seq = seqA; - } - } + __syncthreads(); // this is required because sequence has been re-written in shmem + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - __syncthreads(); // this is required because sequence has been re-written in shmem + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; + __syncthreads(); // this is required because shmem has been updated + for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) + { + is_valid = is_valid - (diag < minSize || diag >= maxSize); - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; + _temp_Val = _prev_H; + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; + _curr_H = 0; + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; - __syncthreads(); // this is required because shmem has been updated - for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) - { - is_valid = is_valid - (diag < minSize || diag >= maxSize); + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; + if(laneId == 31) + { + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } - _curr_H = 0; + if(diag>= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } + __syncthreads(); - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; + short eVal=0; + short heVal = 0; - if(laneId == 31) - { - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } + if(diag >= maxSize) + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + } - if(diag>= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } + if(diag >= maxSize) + { + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } - __syncthreads(); + if(warpId == 0 && laneId == 0) + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H =0; - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - - short eVal=0; - short heVal = 0; - if(diag >= maxSize) - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - } - - if(diag >= maxSize) - { - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - - if(warpId == 0 && laneId == 0) - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H =0; - - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); - } - __syncthreads(); + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } - thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - if(thread_Id == 0) - { - if(newlengthSeqA < newlengthSeqB) - { - seqB_align_begin[block_Id] = (thread_max_i); - seqA_align_begin[block_Id] = (thread_max_j); - } - else - { - seqA_align_begin[block_Id] = (thread_max_i); - seqB_align_begin[block_Id] = (thread_max_j); - } - } - __syncthreads(); + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + short diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } + __syncthreads(); + } + __syncthreads(); + + thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + if(thread_Id == 0) + { + if(newlengthSeqA < newlengthSeqB) + { + seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB + seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA + } + else + { + seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA + seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB + } + } + __syncthreads(); } + + + __global__ void -gpu_bsw::sequence_aa_kernel(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short startGap, short extendGap, short* scoring_matrix, short* encoding_matrix) -{ +gpu_bsw::sequence_aa_kernel( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +){ int block_Id = blockIdx.x; int thread_Id = threadIdx.x; short laneId = threadIdx.x%32; @@ -622,26 +649,27 @@ gpu_bsw::sequence_aa_kernel(char* seqA_array, char* seqB_array, unsigned* prefix extern __shared__ char is_valid_array[]; char* is_valid = &is_valid_array[0]; -// setting up block local sequences and their lengths. + // setting up block local sequences and their lengths. if(block_Id == 0) { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; + lengthSeqA = prefix_lengthA[0]; + lengthSeqB = prefix_lengthB[0]; + seqA = seqA_array; + seqB = seqB_array; } else { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; + lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; + lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; } + // what is the max length and what is the min length unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; -// shared memory space for storing longer of the two strings + // shared memory space for storing longer of the two strings memset(is_valid, 0, minSize); is_valid += minSize; memset(is_valid, 1, minSize); @@ -670,390 +698,377 @@ gpu_bsw::sequence_aa_kernel(char* seqA_array, char* seqB_array, unsigned* prefix short thread_max_i = 0; // to maintain the DP coordinate i for the longer string short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string -//initializing registers for storing diagonal values for three recent most diagonals (separate tables for -//H, E and F) + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) short _curr_H = 0, _curr_F = 0, _curr_E = 0; short _prev_H = 0, _prev_F = 0, _prev_E = 0; short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; short _temp_Val = 0; - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; - __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 - __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; + __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 + __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; - int max_threads = blockDim.x; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ + int max_threads = blockDim.x; + for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; - } + } + for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ + sh_aa_encoding[p] = encoding_matrix[p]; + } __syncthreads(); // to make sure all shmem allocations have been initialized for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) { // iterate for the number of anti-diagonals - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; + is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + + _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; + _curr_H = 0; + + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; + + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; + + if(laneId == 31) + { // if you are the last thread in your warp then spill your values to shmem + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; + if(diag >= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; + __syncthreads(); // this is needed so that all the shmem writes are completed. + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + short eVal=0, heVal = 0; + + if(diag >= maxSize) // when the previous thread has phased out, get value from shmem + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; + if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined + { + eVal = 0; + heVal = 0; } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H = 0; if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; } - - __syncthreads(); // this is needed so that all the shmem writes are completed. - - if(is_valid[thread_Id] && thread_Id < minSize) + else { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - - short eVal=0, heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } - short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix + short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short diag_score = final_prev_prev_H + add_score; + short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } + short diag_score = final_prev_prev_H + add_score; + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } __syncthreads(); // why do I need this? commenting it out breaks it - } __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, - minSize); // thread 0 will have the correct values - - - + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values if(thread_Id == 0) { - - - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; + if(lengthSeqA < lengthSeqB) + { + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; } - else - { + else + { seqA_align_end[block_Id] = thread_max_i; seqB_align_end[block_Id] = thread_max_j; top_scores[block_Id] = thread_max; - } - + } } } + + __global__ void -gpu_bsw::sequence_aa_reverse(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short startGap, short extendGap, short* scoring_matrix, short* encoding_matrix){ - - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - // local pointers - char* seqA; - char* seqB; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - char* longer_seq; +gpu_bsw::sequence_aa_reverse( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; + // local pointers + char* seqA; + char* seqB; + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; + char* longer_seq; // setting up block local sequences and their lengths. - if(block_Id == 0) - { - seqA = seqA_array; - seqB = seqB_array; - } - else - { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - int newlengthSeqA = seqA_align_end[block_Id]; - int newlengthSeqB = seqB_align_end[block_Id]; - unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; - unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; - char myColumnChar; - is_valid = &is_valid_array[0]; //reset is_valid array for second iter - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes + if(block_Id == 0) + { + seqA = seqA_array; + seqB = seqB_array; + } + else + { + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } - //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before + int newlengthSeqA = seqA_align_end[block_Id]; + int newlengthSeqB = seqB_align_end[block_Id]; - if(newlengthSeqA < newlengthSeqB) - { - if(thread_Id < newlengthSeqA) - { - myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once - longer_seq = seqB; - } - } - else - { - if(thread_Id < newlengthSeqB) - { - myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; - longer_seq = seqA; - } - } + unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; + unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; + char myColumnChar; + is_valid = &is_valid_array[0]; //reset is_valid array for second iter + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); + __syncthreads(); // this is required because shmem writes - __syncthreads(); // this is required because sequence has been re-written in shmem + //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before + if(newlengthSeqA < newlengthSeqB) + { + if(thread_Id < newlengthSeqA) + { + myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once + longer_seq = seqB; + } + } + else + { + if(thread_Id < newlengthSeqB) + { + myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; + longer_seq = seqA; + } + } - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + __syncthreads(); // this is required because sequence has been re-written in shmem - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; - __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 - __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; - int max_threads = blockDim.x; + __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 + __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ - sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; - } + int max_threads = blockDim.x; + for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ + sh_aa_scoring[p] = scoring_matrix[p]; + } + for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ + sh_aa_encoding[p] = encoding_matrix[p]; + } - __syncthreads(); // this is required because shmem has been updated - for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) - { - is_valid = is_valid - (diag < minSize || diag >= maxSize); + __syncthreads(); // this is required because shmem has been updated + for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) + { + is_valid = is_valid - (diag < minSize || diag >= maxSize); - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; + _temp_Val = _prev_H; + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; - _curr_H = 0; + _curr_H = 0; + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; + if(laneId == 31) + { + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } - if(laneId == 31) - { - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } + if(diag>= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } - if(diag>= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } + __syncthreads(); - __syncthreads(); + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - if(is_valid[thread_Id] && thread_Id < minSize) - { + short eVal=0; + short heVal = 0; - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - - - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - - short eVal=0; - short heVal = 0; - - if(diag >= maxSize) - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - } - - if(diag >= maxSize) - { - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H =0; - - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - - short diag_score = final_prev_prev_H + add_score; - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i ;//i;// begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; + if(diag >= maxSize) + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + } - } - __syncthreads(); + if(diag >= maxSize) + { + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } - } - __syncthreads(); + if(warpId == 0 && laneId == 0) + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H =0; + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; + short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, - minSize); // thread 0 will have the correct values - if(thread_Id == 0) - { - if(newlengthSeqA < newlengthSeqB) - { - seqB_align_begin[block_Id] = /*newlengthSeqB - */(thread_max_i); - seqA_align_begin[block_Id] = /*newlengthSeqA */ (thread_max_j); - } - else - { - seqA_align_begin[block_Id] = /*newlengthSeqA - */(thread_max_i); - seqB_align_begin[block_Id] = /*newlengthSeqB -*/ (thread_max_j); - } - } - __syncthreads(); + short diag_score = final_prev_prev_H + add_score; + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } + __syncthreads(); + } + __syncthreads(); + thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + if(thread_Id == 0) + { + if(newlengthSeqA < newlengthSeqB) + { + seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB + seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA + } + else + { + seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA + seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB + } + } + __syncthreads(); } \ No newline at end of file diff --git a/kernel.hpp b/kernel.hpp index 6c06b19..783b8f9 100644 --- a/kernel.hpp +++ b/kernel.hpp @@ -28,34 +28,78 @@ __device__ short blockShuffleReduce(short val, unsigned lengthSeqB); __device__ __host__ short - findMax(short array[], int length, int* ind); +findMax(short array[], int length, int* ind); __device__ __host__ short - findMaxFour(short first, short second, short third, short fourth); - -__device__ void -traceBack(short current_i, short current_j, short* seqA_align_begin, - short* seqB_align_begin, const char* seqA, const char* seqB, short* I_i, - short* I_j, unsigned lengthSeqB, unsigned lengthSeqA, unsigned int* diagOffset); +findMaxFour(short first, short second, short third, short fourth); __global__ void -sequence_dna_kernel(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short matchScore, short misMatchScore, short startGap, short extendGap); +sequence_dna_kernel( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short matchScore, + const short misMatchScore, + const short startGap, + const short extendGap +); __global__ void -sequence_dna_reverse(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short matchScore, short misMatchScore, short startGap, short extendGap); +sequence_dna_reverse( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short matchScore, + const short misMatchScore, + const short startGap, + const short extendGap +); __global__ void -sequence_aa_kernel(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short startGap, short extendGap, short* scoring_matrix, short* encoding_matrix); +sequence_aa_kernel( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +); __global__ void -sequence_aa_reverse(char* seqA_array, char* seqB_array, unsigned* prefix_lengthA, - unsigned* prefix_lengthB, short* seqA_align_begin, short* seqA_align_end, - short* seqB_align_begin, short* seqB_align_end, short* top_scores, short startGap, short extendGap, short* scoring_matrix, short* encoding_matrix); +sequence_aa_reverse( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +); + } #endif From ca60dd94f0b025f290d68c477741a9aebc958a12 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 09:05:00 -0600 Subject: [PATCH 04/47] Fix driver spacing to reveal analogies between kernels --- driver.cpp | 387 +++++++++++++++++++++++++++-------------------------- 1 file changed, 195 insertions(+), 192 deletions(-) diff --git a/driver.cpp b/driver.cpp index b5eabff..c37ac10 100644 --- a/driver.cpp +++ b/driver.cpp @@ -17,7 +17,7 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector reads, std::vector reads, std::vectorref_end + my_cpu_id * alignmentsPerDevice; short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; + unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; @@ -75,8 +75,9 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector::const_iterator beginAVec; @@ -107,7 +108,7 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector reads, std::vector reads, std::vector reads, std::vector 48000) cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); @@ -169,12 +170,12 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, startGap, extendGap); - + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, startGap, extendGap); + // copyin back end index so that we can find new min asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - + cudaStreamSynchronize (streams_cuda[0]); cudaStreamSynchronize (streams_cuda[1]); @@ -190,18 +191,18 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, startGap, extendGap); asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); - alAbeg += stringsPerIt; - alBbeg += stringsPerIt; - alAend += stringsPerIt; - alBend += stringsPerIt; - top_scores_cpu += stringsPerIt; + alAbeg += stringsPerIt; + alBbeg += stringsPerIt; + alAend += stringsPerIt; + alBend += stringsPerIt; + top_scores_cpu += stringsPerIt; - } // for iterations end here + } // for iterations end here auto end1 = NOW; std::chrono::duration diff2 = end1 - start2; @@ -225,6 +226,8 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector reads, std::vector contigs, gpu_bsw_driver::alignment_results *alignments, short scoring_matrix[], short openGap, short extendGap) { @@ -242,7 +245,7 @@ gpu_bsw_driver::kernel_driver_aa(std::vector reads, std::vector reads, std::vectorref_begin + my_cpu_id * alignmentsPerDevice; - short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; - short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; - short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results - short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - - unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); - unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); - - char *strA_d, *strB_d; - cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); - cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); - - char* strA; - cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); - char* strB; - cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); - - float total_packing = 0; - - auto start2 = NOW; - std::cout<<"loop begin\n"; - for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) - { - auto packing_start = NOW; - int blocksLaunched = 0; - std::vector::const_iterator beginAVec; - std::vector::const_iterator endAVec; - std::vector::const_iterator beginBVec; - std::vector::const_iterator endBVec; - if(perGPUIts == its - 1) - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt + leftOvers; - } - else - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt; - } - - std::vector sequencesA(beginAVec, endAVec); - std::vector sequencesB(beginBVec, endBVec); - unsigned running_sum = 0; - int sequences_per_stream = (blocksLaunched) / NSTREAMS; - int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; - unsigned half_length_A = 0; - unsigned half_length_B = 0; - - auto start_cpu = NOW; - - for(int i = 0; i < sequencesA.size(); i++) - { - running_sum +=sequencesA[i].size(); - offsetA_h[i] = running_sum;//sequencesA[i].size(); - if(i == sequences_per_stream - 1){ - half_length_A = running_sum; + } + + int BLOCKS_l = alignmentsPerDevice; + if(my_cpu_id == deviceCount - 1) + BLOCKS_l += leftOver_device; + if(my_cpu_id == 0)std::cout<<"Number of GPUs being used:"<ref_begin + my_cpu_id * alignmentsPerDevice; + short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; + short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; + short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results + short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; + + unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; + cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); + unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; + cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); + + char *strA_d, *strB_d; + cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); + cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); + + char* strA; + cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); + char* strB; + cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); + + float total_packing = 0; + + auto start2 = NOW; + std::cout<<"loop begin\n"; + for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) + { + auto packing_start = NOW; + int blocksLaunched = 0; + std::vector::const_iterator beginAVec; + std::vector::const_iterator endAVec; + std::vector::const_iterator beginBVec; + std::vector::const_iterator endBVec; + if(perGPUIts == its - 1) + { + beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align + blocksLaunched = stringsPerIt + leftOvers; + } + else + { + beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + blocksLaunched = stringsPerIt; + } + + std::vector sequencesA(beginAVec, endAVec); + std::vector sequencesB(beginBVec, endBVec); + unsigned running_sum = 0; + int sequences_per_stream = (blocksLaunched) / NSTREAMS; + int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; + unsigned half_length_A = 0; + unsigned half_length_B = 0; + + auto start_cpu = NOW; + + for(int i = 0; i < sequencesA.size(); i++) + { + running_sum +=sequencesA[i].size(); + offsetA_h[i] = running_sum;//sequencesA[i].size(); + if(i == sequences_per_stream - 1){ + half_length_A = running_sum; + running_sum = 0; + } + } + unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; + + running_sum = 0; + for(int i = 0; i < sequencesB.size(); i++) + { + running_sum +=sequencesB[i].size(); + offsetB_h[i] = running_sum; //sequencesB[i].size(); + if(i == sequences_per_stream - 1){ + half_length_B = running_sum; running_sum = 0; } - } - unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; - - running_sum = 0; - for(int i = 0; i < sequencesB.size(); i++) - { - running_sum +=sequencesB[i].size(); - offsetB_h[i] = running_sum; //sequencesB[i].size(); - if(i == sequences_per_stream - 1){ - half_length_B = running_sum; - running_sum = 0; - } - } - unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; - - auto end_cpu = NOW; - std::chrono::duration cpu_dur = end_cpu - start_cpu; - - total_time_cpu += cpu_dur.count(); - unsigned offsetSumA = 0; - unsigned offsetSumB = 0; - - for(int i = 0; i < sequencesA.size(); i++) - { - char* seqptrA = strA + offsetSumA; - memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); - char* seqptrB = strB + offsetSumB; - memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); - offsetSumA += sequencesA[i].size(); - offsetSumB += sequencesB[i].size(); - } - - auto packing_end = NOW; - std::chrono::duration packing_dur = packing_end - packing_start; - - total_packing += packing_dur.count(); - - asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); - unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; - unsigned totShmem = 3 * (minSize + 1) * sizeof(short); - unsigned alignmentPad = 4 + (4 - totShmem % 4); - size_t ShmemBytes = totShmem + alignmentPad; - if(ShmemBytes > 48000) - cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - gpu_bsw::sequence_aa_kernel<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, - openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - gpu_bsw::sequence_aa_kernel<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + } + unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; + + auto end_cpu = NOW; + std::chrono::duration cpu_dur = end_cpu - start_cpu; + + total_time_cpu += cpu_dur.count(); + unsigned offsetSumA = 0; + unsigned offsetSumB = 0; + + for(int i = 0; i < sequencesA.size(); i++) + { + char* seqptrA = strA + offsetSumA; + memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); + char* seqptrB = strB + offsetSumB; + memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); + offsetSumA += sequencesA[i].size(); + offsetSumB += sequencesB[i].size(); + } + + auto packing_end = NOW; + std::chrono::duration packing_dur = packing_end - packing_start; + + total_packing += packing_dur.count(); + + asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); + unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; + unsigned totShmem = 3 * (minSize + 1) * sizeof(short); + unsigned alignmentPad = 4 + (4 - totShmem % 4); + size_t ShmemBytes = totShmem + alignmentPad; + if(ShmemBytes > 48000) + cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + + gpu_bsw::sequence_aa_kernel<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, + openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + + gpu_bsw::sequence_aa_kernel<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - // copyin back end index so that we can find new min - asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - cudaStreamSynchronize (streams_cuda[0]); - cudaStreamSynchronize (streams_cuda[1]); + // copyin back end index so that we can find new min + asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - auto sec_cpu_start = NOW; - int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths - auto sec_cpu_end = NOW; - std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; - total_time_cpu += dur_sec_cpu.count(); + cudaStreamSynchronize (streams_cuda[0]); + cudaStreamSynchronize (streams_cuda[1]); - gpu_bsw::sequence_aa_reverse<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + auto sec_cpu_start = NOW; + int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths + auto sec_cpu_end = NOW; + std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; + total_time_cpu += dur_sec_cpu.count(); + + gpu_bsw::sequence_aa_reverse<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - gpu_bsw::sequence_aa_reverse<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + gpu_bsw::sequence_aa_reverse<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); + asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); - alAbeg += stringsPerIt; - alBbeg += stringsPerIt; - alAend += stringsPerIt; - alBend += stringsPerIt; - top_scores_cpu += stringsPerIt; + alAbeg += stringsPerIt; + alBbeg += stringsPerIt; + alAend += stringsPerIt; + alBend += stringsPerIt; + top_scores_cpu += stringsPerIt; } // for iterations end here @@ -451,7 +453,8 @@ gpu_bsw_driver::kernel_driver_aa(std::vector reads, std::vector diff = end - start; std::cout << "Total Alignments:"< Date: Fri, 10 Jul 2020 09:09:18 -0600 Subject: [PATCH 05/47] Make some stuff in driver arguments const --- driver.cpp | 25 +++++++++++++++++++------ driver.hpp | 31 ++++++++++++++++++++++--------- 2 files changed, 41 insertions(+), 15 deletions(-) diff --git a/driver.cpp b/driver.cpp index c37ac10..0faf8ab 100644 --- a/driver.cpp +++ b/driver.cpp @@ -7,9 +7,15 @@ #include #include +namespace gpu_bsw_driver{ + void -gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector contigs, gpu_bsw_driver::alignment_results *alignments, short scores[4]) -{ +kernel_driver_dna( + const std::vector &reads, + const std::vector &contigs, + gpu_bsw_driver::alignment_results *const alignments, + const short scores[4] +){ short matchScore = scores[0], misMatchScore = scores[1], startGap = scores[2], extendGap = scores[3]; unsigned maxContigSize = getMaxLength(contigs); unsigned maxReadSize = getMaxLength(reads); @@ -228,9 +234,14 @@ gpu_bsw_driver::kernel_driver_dna(std::vector reads, std::vector reads, std::vector contigs, gpu_bsw_driver::alignment_results *alignments, short scoring_matrix[], short openGap, short extendGap) -{ +void kernel_driver_aa( + const std::vector &reads, + const std::vector &contigs, + gpu_bsw_driver::alignment_results *const alignments, + const short scoring_matrix[], + const short openGap, + const short extendGap +){ unsigned maxContigSize = getMaxLength(contigs); unsigned maxReadSize = getMaxLength(reads); unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length @@ -457,4 +468,6 @@ gpu_bsw_driver::kernel_driver_aa(std::vector reads, std::vector diff = end - start; std::cout << "Total Alignments:"< reads, std::vector contigs, alignment_results *alignments, short scores[4]); -void -kernel_driver_aa(std::vector reads, std::vector contigs, alignment_results *alignments, short scoring_matrix[], short openGap, short extendGap); +void kernel_driver_dna( + const std::vector &reads, + const std::vector &contigs, + gpu_bsw_driver::alignment_results *const alignments, + const short scores[4] +); + + + +void kernel_driver_aa( + const std::vector &reads, + const std::vector &contigs, + gpu_bsw_driver::alignment_results *const alignments, + const short scoring_matrix[], + const short openGap, + const short extendGap +); void verificationTest(std::string rstFile, short* g_alAbeg, short* g_alBbeg, short* g_alAend, From 99aed0a1d2969d8493aaada84013b11e81a63557 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 09:11:37 -0600 Subject: [PATCH 06/47] Parallelize argument structure of drivers --- driver.cpp | 6 ++++-- driver.hpp | 4 +++- main.cpp | 4 ++-- 3 files changed, 9 insertions(+), 5 deletions(-) diff --git a/driver.cpp b/driver.cpp index 0faf8ab..c9d8f9a 100644 --- a/driver.cpp +++ b/driver.cpp @@ -14,9 +14,11 @@ kernel_driver_dna( const std::vector &reads, const std::vector &contigs, gpu_bsw_driver::alignment_results *const alignments, - const short scores[4] + const short scores[2], + const short startGap, + const short extendGap ){ - short matchScore = scores[0], misMatchScore = scores[1], startGap = scores[2], extendGap = scores[3]; + short matchScore = scores[0], misMatchScore = scores[1]; unsigned maxContigSize = getMaxLength(contigs); unsigned maxReadSize = getMaxLength(reads); unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length diff --git a/driver.hpp b/driver.hpp index 70aa07f..eb0ec65 100644 --- a/driver.hpp +++ b/driver.hpp @@ -32,7 +32,9 @@ void kernel_driver_dna( const std::vector &reads, const std::vector &contigs, gpu_bsw_driver::alignment_results *const alignments, - const short scores[4] + const short scores[2], + const short openGap, + const short extendGap ); diff --git a/main.cpp b/main.cpp index e2b93e7..ac8650a 100644 --- a/main.cpp +++ b/main.cpp @@ -202,10 +202,10 @@ void dnaSampleRun(string refFile, string queFile, string out_file){ gpu_bsw_driver::alignment_results results_test; - short scores[] = {1, -3, -3, -1}; + short scores[] = {1, -3}; ofstream results_file(out_file); - gpu_bsw_driver::kernel_driver_dna(G_sequencesB, G_sequencesA,&results_test, scores); + gpu_bsw_driver::kernel_driver_dna(G_sequencesB, G_sequencesA,&results_test, scores, -3, -1); for(int k = 0; k < G_sequencesA.size(); k++){ results_file< Date: Fri, 10 Jul 2020 09:47:48 -0600 Subject: [PATCH 07/47] Merge driver kernels --- driver.cpp | 539 +++++++---------------------------------------------- driver.hpp | 310 ++++++++++++++++++++++++++++-- kernel.hpp | 5 + main.cpp | 4 +- utils.cpp | 72 ------- utils.hpp | 12 +- 6 files changed, 371 insertions(+), 571 deletions(-) diff --git a/driver.cpp b/driver.cpp index c9d8f9a..0169625 100644 --- a/driver.cpp +++ b/driver.cpp @@ -1,475 +1,72 @@ #include "driver.hpp" -#include "utils.hpp" -#include -#include -#include -#include -#include -#include -namespace gpu_bsw_driver{ - -void -kernel_driver_dna( - const std::vector &reads, - const std::vector &contigs, - gpu_bsw_driver::alignment_results *const alignments, - const short scores[2], - const short startGap, - const short extendGap -){ - short matchScore = scores[0], misMatchScore = scores[1]; - unsigned maxContigSize = getMaxLength(contigs); - unsigned maxReadSize = getMaxLength(reads); - unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length - - int deviceCount; - cudaGetDeviceCount(&deviceCount); - omp_set_num_threads(deviceCount); //one OMP thread per GPU - std::cout<<"Number of available GPUs:"<20000)?(ceil((float)max_per_device/20000)):1; - initialize_alignments(alignments, totalAlignments); // pinned memory allocation - auto start = NOW; - - #pragma omp parallel - { - int my_cpu_id = omp_get_thread_num(); - cudaSetDevice(my_cpu_id); - int myGPUid; - cudaGetDevice(&myGPUid); - float total_time_cpu = 0; - cudaStream_t streams_cuda[NSTREAMS]; - for(int stm = 0; stm < NSTREAMS; stm++){ - cudaStreamCreate(&streams_cuda[stm]); - } - - int BLOCKS_l = alignmentsPerDevice; - if(my_cpu_id == deviceCount - 1) - BLOCKS_l += leftOver_device; - if(my_cpu_id == 0)std::cout<<"Number of GPUs being used:"<ref_begin + my_cpu_id * alignmentsPerDevice; - short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; - short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; - short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results - short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - - unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); - unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); - - char *strA_d, *strB_d; - cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); - cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); - - char* strA; - cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); - char* strB; - cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); - - float total_packing = 0; - - auto start2 = NOW; - std::cout<<"loop begin\n"; - for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) - { - auto packing_start = NOW; - int blocksLaunched = 0; - std::vector::const_iterator beginAVec; - std::vector::const_iterator endAVec; - std::vector::const_iterator beginBVec; - std::vector::const_iterator endBVec; - if(perGPUIts == its - 1) - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt + leftOvers; - } - else - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt; - } - - std::vector sequencesA(beginAVec, endAVec); - std::vector sequencesB(beginBVec, endBVec); - unsigned running_sum = 0; - int sequences_per_stream = (blocksLaunched) / NSTREAMS; - int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; - unsigned half_length_A = 0; - unsigned half_length_B = 0; - - auto start_cpu = NOW; - - for(int i = 0; i < sequencesA.size(); i++) - { - running_sum +=sequencesA[i].size(); - offsetA_h[i] = running_sum;//sequencesA[i].size(); - if(i == sequences_per_stream - 1){ - half_length_A = running_sum; - running_sum = 0; - } - } - unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; - - running_sum = 0; - for(int i = 0; i < sequencesB.size(); i++) - { - running_sum +=sequencesB[i].size(); - offsetB_h[i] = running_sum; //sequencesB[i].size(); - if(i == sequences_per_stream - 1){ - half_length_B = running_sum; - running_sum = 0; - } - } - unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; - - auto end_cpu = NOW; - std::chrono::duration cpu_dur = end_cpu - start_cpu; - - total_time_cpu += cpu_dur.count(); - unsigned offsetSumA = 0; - unsigned offsetSumB = 0; - - for(int i = 0; i < sequencesA.size(); i++) - { - char* seqptrA = strA + offsetSumA; - memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); - char* seqptrB = strB + offsetSumB; - memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); - offsetSumA += sequencesA[i].size(); - offsetSumB += sequencesB[i].size(); - } - - auto packing_end = NOW; - std::chrono::duration packing_dur = packing_end - packing_start; - - total_packing += packing_dur.count(); - - asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); - unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; - unsigned totShmem = 3 * (minSize + 1) * sizeof(short); - unsigned alignmentPad = 4 + (4 - totShmem % 4); - size_t ShmemBytes = totShmem + alignmentPad; - if(ShmemBytes > 48000) - cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - gpu_bsw::sequence_dna_kernel<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, startGap, extendGap); - - gpu_bsw::sequence_dna_kernel<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, startGap, extendGap); - - // copyin back end index so that we can find new min - asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - cudaStreamSynchronize (streams_cuda[0]); - cudaStreamSynchronize (streams_cuda[1]); - - auto sec_cpu_start = NOW; - int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths - auto sec_cpu_end = NOW; - std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; - total_time_cpu += dur_sec_cpu.count(); - - gpu_bsw::sequence_dna_reverse<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, startGap, extendGap); - - gpu_bsw::sequence_dna_reverse<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, startGap, extendGap); - - asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - alAbeg += stringsPerIt; - alBbeg += stringsPerIt; - alAend += stringsPerIt; - alBend += stringsPerIt; - top_scores_cpu += stringsPerIt; - - } // for iterations end here - - auto end1 = NOW; - std::chrono::duration diff2 = end1 - start2; - cudaErrchk(cudaFree(strA_d)); - cudaErrchk(cudaFree(strB_d)); - cudaFreeHost(offsetA_h); - cudaFreeHost(offsetB_h); - cudaFreeHost(strA); - cudaFreeHost(strB); - - for(int i = 0; i < NSTREAMS; i++) - cudaStreamDestroy(streams_cuda[i]); - - std::cout <<"cpu time:"< diff = end - start; - std::cout << "Total Alignments:"< &reads, - const std::vector &contigs, - gpu_bsw_driver::alignment_results *const alignments, - const short scoring_matrix[], - const short openGap, - const short extendGap -){ - unsigned maxContigSize = getMaxLength(contigs); - unsigned maxReadSize = getMaxLength(reads); - unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length - - short encoding_matrix[] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0, - 0,0,0,0,0,0,0,0,0,0,0,0,0,0, - 0,0,0,0,0,0,0,0,0,0,0,0,0,0, - 23,0,0,0,0,0,0,0,0,0,0,0,0,0, - 0,0,0,0,0,0,0,0,0,0,20,4,3,6, - 13,7,8,9,0,11,10,12,2,0,14,5, - 1,15,16,0,19,17,22,18,21}; - - int deviceCount; - cudaGetDeviceCount(&deviceCount); - omp_set_num_threads(deviceCount); //one OMP thread per GPU - std::cout<<"Number of available GPUs:"<20000)?(ceil((float)totalAlignments/20000)):1; - initialize_alignments(alignments, totalAlignments); // pinned memory allocation - auto start = NOW; - - #pragma omp parallel - { - int my_cpu_id = omp_get_thread_num(); - cudaSetDevice(my_cpu_id); - int myGPUid; - cudaGetDevice(&myGPUid); - float total_time_cpu = 0; - cudaStream_t streams_cuda[NSTREAMS]; - for(int stm = 0; stm < NSTREAMS; stm++){ - cudaStreamCreate(&streams_cuda[stm]); - } - - int BLOCKS_l = alignmentsPerDevice; - if(my_cpu_id == deviceCount - 1) - BLOCKS_l += leftOver_device; - if(my_cpu_id == 0)std::cout<<"Number of GPUs being used:"<ref_begin + my_cpu_id * alignmentsPerDevice; - short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; - short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; - short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results - short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - - unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); - unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); - - char *strA_d, *strB_d; - cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); - cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); - - char* strA; - cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); - char* strB; - cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); - - float total_packing = 0; - - auto start2 = NOW; - std::cout<<"loop begin\n"; - for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) - { - auto packing_start = NOW; - int blocksLaunched = 0; - std::vector::const_iterator beginAVec; - std::vector::const_iterator endAVec; - std::vector::const_iterator beginBVec; - std::vector::const_iterator endBVec; - if(perGPUIts == its - 1) - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt + leftOvers; - } - else - { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt; - } - - std::vector sequencesA(beginAVec, endAVec); - std::vector sequencesB(beginBVec, endBVec); - unsigned running_sum = 0; - int sequences_per_stream = (blocksLaunched) / NSTREAMS; - int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; - unsigned half_length_A = 0; - unsigned half_length_B = 0; - - auto start_cpu = NOW; - - for(int i = 0; i < sequencesA.size(); i++) - { - running_sum +=sequencesA[i].size(); - offsetA_h[i] = running_sum;//sequencesA[i].size(); - if(i == sequences_per_stream - 1){ - half_length_A = running_sum; - running_sum = 0; - } - } - unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; - - running_sum = 0; - for(int i = 0; i < sequencesB.size(); i++) - { - running_sum +=sequencesB[i].size(); - offsetB_h[i] = running_sum; //sequencesB[i].size(); - if(i == sequences_per_stream - 1){ - half_length_B = running_sum; - running_sum = 0; - } - } - unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; - - auto end_cpu = NOW; - std::chrono::duration cpu_dur = end_cpu - start_cpu; - - total_time_cpu += cpu_dur.count(); - unsigned offsetSumA = 0; - unsigned offsetSumB = 0; - - for(int i = 0; i < sequencesA.size(); i++) - { - char* seqptrA = strA + offsetSumA; - memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); - char* seqptrB = strB + offsetSumB; - memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); - offsetSumA += sequencesA[i].size(); - offsetSumB += sequencesB[i].size(); - } - - auto packing_end = NOW; - std::chrono::duration packing_dur = packing_end - packing_start; - - total_packing += packing_dur.count(); - - asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); - unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; - unsigned totShmem = 3 * (minSize + 1) * sizeof(short); - unsigned alignmentPad = 4 + (4 - totShmem % 4); - size_t ShmemBytes = totShmem + alignmentPad; - if(ShmemBytes > 48000) - cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - gpu_bsw::sequence_aa_kernel<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, - openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - gpu_bsw::sequence_aa_kernel<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - // copyin back end index so that we can find new min - asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - cudaStreamSynchronize (streams_cuda[0]); - cudaStreamSynchronize (streams_cuda[1]); - - auto sec_cpu_start = NOW; - int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths - auto sec_cpu_end = NOW; - std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; - total_time_cpu += dur_sec_cpu.count(); - - gpu_bsw::sequence_aa_reverse<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - gpu_bsw::sequence_aa_reverse<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - - asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - alAbeg += stringsPerIt; - alBbeg += stringsPerIt; - alAend += stringsPerIt; - alBend += stringsPerIt; - top_scores_cpu += stringsPerIt; - - } // for iterations end here - - auto end1 = NOW; - std::chrono::duration diff2 = end1 - start2; - cudaErrchk(cudaFree(strA_d)); - cudaErrchk(cudaFree(strB_d)); - cudaFreeHost(offsetA_h); - cudaFreeHost(offsetB_h); - cudaFreeHost(strA); - cudaFreeHost(strB); - - for(int i = 0; i < NSTREAMS; i++) - cudaStreamDestroy(streams_cuda[i]); - - std::cout <<"cpu time:"< diff = end - start; - std::cout << "Total Alignments:"<ref_begin), sizeof(short)*max_alignments); + cudaMallocHost(&(alignments->ref_end), sizeof(short)*max_alignments); + cudaMallocHost(&(alignments->query_begin), sizeof(short)*max_alignments); + cudaMallocHost(&(alignments->query_end), sizeof(short)*max_alignments); + cudaMallocHost(&(alignments->top_scores), sizeof(short)*max_alignments); +} + +void free_alignments(gpu_bsw_driver::alignment_results *alignments){ + cudaErrchk(cudaFreeHost(alignments->ref_begin)); + cudaErrchk(cudaFreeHost(alignments->ref_end)); + cudaErrchk(cudaFreeHost(alignments->query_begin)); + cudaErrchk(cudaFreeHost(alignments->query_end)); + cudaErrchk(cudaFreeHost(alignments->top_scores)); +} + +void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, +unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ + + cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu, offsetA_h, (sequences_per_stream) * sizeof(int), + cudaMemcpyHostToDevice,streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu + sequences_per_stream, offsetA_h + sequences_per_stream, + (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); + + cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu, offsetB_h, (sequences_per_stream) * sizeof(int), + cudaMemcpyHostToDevice,streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu + sequences_per_stream, offsetB_h + sequences_per_stream, + (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); + + + cudaErrchk(cudaMemcpyAsync(strA_d, strA, half_length_A * sizeof(char), + cudaMemcpyHostToDevice,streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(strA_d + half_length_A, strA + half_length_A, (totalLengthA - half_length_A) * sizeof(char), + cudaMemcpyHostToDevice,streams_cuda[1])); + + cudaErrchk(cudaMemcpyAsync(strB_d, strB, half_length_B * sizeof(char), + cudaMemcpyHostToDevice,streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(strB_d + half_length_B, strB + half_length_B, (totalLengthB - half_length_B) * sizeof(char), + cudaMemcpyHostToDevice,streams_cuda[1])); + +} + +void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ + cudaErrchk(cudaMemcpyAsync(alAend, gpu_data->ref_end_gpu, sequences_per_stream * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(alAend + sequences_per_stream, gpu_data->ref_end_gpu + sequences_per_stream, + (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); + + cudaErrchk(cudaMemcpyAsync(alBend, gpu_data->query_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(alBend + sequences_per_stream, gpu_data->query_end_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[1])); +} + +void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ + cudaErrchk(cudaMemcpyAsync(alAbeg, gpu_data->ref_start_gpu, sequences_per_stream * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(alAbeg + sequences_per_stream, gpu_data->ref_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[1])); + + cudaErrchk(cudaMemcpyAsync(alBbeg, gpu_data->query_start_gpu, sequences_per_stream * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(alBbeg + sequences_per_stream, gpu_data->query_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[1])); + + cudaErrchk(cudaMemcpyAsync(top_scores_cpu, gpu_data->scores_gpu, sequences_per_stream * sizeof(short), + cudaMemcpyDeviceToHost, streams_cuda[0])); + cudaErrchk(cudaMemcpyAsync(top_scores_cpu + sequences_per_stream, gpu_data->scores_gpu + sequences_per_stream, + (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); } \ No newline at end of file diff --git a/driver.hpp b/driver.hpp index eb0ec65..6ce6fbc 100644 --- a/driver.hpp +++ b/driver.hpp @@ -8,48 +8,318 @@ #include #include #include "alignments.hpp" +#include "driver.hpp" +#include "utils.hpp" +#include +#include +#include +#include +#include +#include + #define NSTREAMS 2 #define NOW std::chrono::high_resolution_clock::now() +namespace gpu_bsw_driver { + // for storing the alignment results + struct alignment_results{ + short* ref_begin = nullptr; + short* query_begin = nullptr; + short* ref_end = nullptr; + short* query_end = nullptr; + short* top_scores = nullptr; + }; +} -namespace gpu_bsw_driver{ +void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments); +void free_alignments(gpu_bsw_driver::alignment_results *alignments); +void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); +void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); +void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); -// for storing the alignment results -struct alignment_results{ - short* ref_begin = nullptr; - short* query_begin = nullptr; - short* ref_end = nullptr; - short* query_end = nullptr; - short* top_scores = nullptr; -}; +namespace gpu_bsw_driver{ -void kernel_driver_dna( +template +void kernel_driver( const std::vector &reads, const std::vector &contigs, gpu_bsw_driver::alignment_results *const alignments, - const short scores[2], + const short scoring_matrix[], const short openGap, const short extendGap -); +){ + unsigned maxContigSize = getMaxLength(contigs); + unsigned maxReadSize = getMaxLength(reads); + unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length + //These scores are used only by the DNA kernel + const short matchScore = scoring_matrix[0]; + const short misMatchScore = scoring_matrix[1]; + + //This matrix is used only by the RNA kernel + constexpr short encoding_matrix[] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 23,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,20,4,3,6, + 13,7,8,9,0,11,10,12,2,0,14,5, + 1,15,16,0,19,17,22,18,21}; + + int deviceCount; + cudaGetDeviceCount(&deviceCount); + omp_set_num_threads(deviceCount); //one OMP thread per GPU + std::cout<<"Number of available GPUs:"<20000)?(ceil((float)max_per_device/20000)):1; + initialize_alignments(alignments, totalAlignments); // pinned memory allocation + auto start = NOW; + + #pragma omp parallel + { + int my_cpu_id = omp_get_thread_num(); + cudaSetDevice(my_cpu_id); + int myGPUid; + cudaGetDevice(&myGPUid); + float total_time_cpu = 0; + cudaStream_t streams_cuda[NSTREAMS]; + for(int stm = 0; stm < NSTREAMS; stm++){ + cudaStreamCreate(&streams_cuda[stm]); + } + + int BLOCKS_l = alignmentsPerDevice; + if(my_cpu_id == deviceCount - 1) + BLOCKS_l += leftOver_device; + if(my_cpu_id == 0)std::cout<<"Number of GPUs being used:"<ref_begin + my_cpu_id * alignmentsPerDevice; + short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; + short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; + short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results + short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; + + unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; + cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); + unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; + cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); + + char *strA_d, *strB_d; + cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); + cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); + + char* strA; + cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); + char* strB; + cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); + + float total_packing = 0; + + auto start2 = NOW; + std::cout<<"loop begin\n"; + for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) + { + auto packing_start = NOW; + int blocksLaunched = 0; + std::vector::const_iterator beginAVec; + std::vector::const_iterator endAVec; + std::vector::const_iterator beginBVec; + std::vector::const_iterator endBVec; + if(perGPUIts == its - 1) + { + beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align + blocksLaunched = stringsPerIt + leftOvers; + } + else + { + beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); + endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + blocksLaunched = stringsPerIt; + } + + std::vector sequencesA(beginAVec, endAVec); + std::vector sequencesB(beginBVec, endBVec); + unsigned running_sum = 0; + int sequences_per_stream = (blocksLaunched) / NSTREAMS; + int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; + unsigned half_length_A = 0; + unsigned half_length_B = 0; + + auto start_cpu = NOW; + + for(int i = 0; i < sequencesA.size(); i++) + { + running_sum +=sequencesA[i].size(); + offsetA_h[i] = running_sum;//sequencesA[i].size(); + if(i == sequences_per_stream - 1){ + half_length_A = running_sum; + running_sum = 0; + } + } + unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; + + running_sum = 0; + for(int i = 0; i < sequencesB.size(); i++) + { + running_sum +=sequencesB[i].size(); + offsetB_h[i] = running_sum; //sequencesB[i].size(); + if(i == sequences_per_stream - 1){ + half_length_B = running_sum; + running_sum = 0; + } + } + unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; + + auto end_cpu = NOW; + std::chrono::duration cpu_dur = end_cpu - start_cpu; + + total_time_cpu += cpu_dur.count(); + unsigned offsetSumA = 0; + unsigned offsetSumB = 0; + + for(int i = 0; i < sequencesA.size(); i++) + { + char* seqptrA = strA + offsetSumA; + memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); + char* seqptrB = strB + offsetSumB; + memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); + offsetSumA += sequencesA[i].size(); + offsetSumB += sequencesB[i].size(); + } + + auto packing_end = NOW; + std::chrono::duration packing_dur = packing_end - packing_start; + + total_packing += packing_dur.count(); + + asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); + unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; + unsigned totShmem = 3 * (minSize + 1) * sizeof(short); + unsigned alignmentPad = 4 + (4 - totShmem % 4); + size_t ShmemBytes = totShmem + alignmentPad; + if(ShmemBytes > 48000) + cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + + if(DT==DataType::RNA){ + gpu_bsw::sequence_aa_kernel<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, + openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + + gpu_bsw::sequence_aa_kernel<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + } else if(DT==DataType::DNA){ + gpu_bsw::sequence_dna_kernel<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); + + gpu_bsw::sequence_dna_kernel<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); + } + + // copyin back end index so that we can find new min + asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); + + cudaStreamSynchronize (streams_cuda[0]); + cudaStreamSynchronize (streams_cuda[1]); + + auto sec_cpu_start = NOW; + int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths + auto sec_cpu_end = NOW; + std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; + total_time_cpu += dur_sec_cpu.count(); + + if(DT==DataType::RNA){ + gpu_bsw::sequence_aa_reverse<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + + gpu_bsw::sequence_aa_reverse<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + } else if(DT==DataType::DNA) { + gpu_bsw::sequence_dna_reverse<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); + + gpu_bsw::sequence_dna_reverse<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); + + } + + asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); + + alAbeg += stringsPerIt; + alBbeg += stringsPerIt; + alAend += stringsPerIt; + alBend += stringsPerIt; + top_scores_cpu += stringsPerIt; + + } // for iterations end here + + auto end1 = NOW; + std::chrono::duration diff2 = end1 - start2; + cudaErrchk(cudaFree(strA_d)); + cudaErrchk(cudaFree(strB_d)); + cudaFreeHost(offsetA_h); + cudaFreeHost(offsetB_h); + cudaFreeHost(strA); + cudaFreeHost(strB); + + for(int i = 0; i < NSTREAMS; i++) + cudaStreamDestroy(streams_cuda[i]); + + std::cout <<"cpu time:"< diff = end - start; + std::cout << "Total Alignments:"< &reads, - const std::vector &contigs, - gpu_bsw_driver::alignment_results *const alignments, - const short scoring_matrix[], - const short openGap, - const short extendGap -); void verificationTest(std::string rstFile, short* g_alAbeg, short* g_alBbeg, short* g_alAend, short* g_alBend); } + #endif diff --git a/kernel.hpp b/kernel.hpp index 783b8f9..415798f 100644 --- a/kernel.hpp +++ b/kernel.hpp @@ -8,6 +8,11 @@ #define ENCOD_MAT_SIZE 91 #define SCORE_MAT_SIZE 576 +enum class DataType { + DNA, + RNA +}; + namespace gpu_bsw{ __device__ short warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, unsigned lengthSeqB); diff --git a/main.cpp b/main.cpp index ac8650a..0e2058c 100644 --- a/main.cpp +++ b/main.cpp @@ -120,7 +120,7 @@ void proteinSampleRun(string refFile, string queFile, string out_file){ };*/ gpu_bsw_driver::alignment_results results_test; - gpu_bsw_driver::kernel_driver_aa(G_sequencesB, G_sequencesA, &results_test, scores_matrix, -6, -1); + gpu_bsw_driver::kernel_driver(G_sequencesB, G_sequencesA, &results_test, scores_matrix, -6, -1); // gpu_bsw_driver::verificationTest(resultFile, results_test.g_alAbeg, results_test.g_alBbeg, results_test.g_alAend, results_test.g_alBend); @@ -205,7 +205,7 @@ void dnaSampleRun(string refFile, string queFile, string out_file){ short scores[] = {1, -3}; ofstream results_file(out_file); - gpu_bsw_driver::kernel_driver_dna(G_sequencesB, G_sequencesA,&results_test, scores, -3, -1); + gpu_bsw_driver::kernel_driver(G_sequencesB, G_sequencesA,&results_test, scores, -3, -1); for(int k = 0; k < G_sequencesA.size(); k++){ results_file< v) return maxLength; } -void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments){ - cudaMallocHost(&(alignments->ref_begin), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->ref_end), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->query_begin), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->query_end), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->top_scores), sizeof(short)*max_alignments); -} - -void free_alignments(gpu_bsw_driver::alignment_results *alignments){ - cudaErrchk(cudaFreeHost(alignments->ref_begin)); - cudaErrchk(cudaFreeHost(alignments->ref_end)); - cudaErrchk(cudaFreeHost(alignments->query_begin)); - cudaErrchk(cudaFreeHost(alignments->query_end)); - cudaErrchk(cudaFreeHost(alignments->top_scores)); - -} - -void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, -unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ - - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu, offsetA_h, (sequences_per_stream) * sizeof(int), - cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu + sequences_per_stream, offsetA_h + sequences_per_stream, - (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); - - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu, offsetB_h, (sequences_per_stream) * sizeof(int), - cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu + sequences_per_stream, offsetB_h + sequences_per_stream, - (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); - - - cudaErrchk(cudaMemcpyAsync(strA_d, strA, half_length_A * sizeof(char), - cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(strA_d + half_length_A, strA + half_length_A, (totalLengthA - half_length_A) * sizeof(char), - cudaMemcpyHostToDevice,streams_cuda[1])); - - cudaErrchk(cudaMemcpyAsync(strB_d, strB, half_length_B * sizeof(char), - cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(strB_d + half_length_B, strB + half_length_B, (totalLengthB - half_length_B) * sizeof(char), - cudaMemcpyHostToDevice,streams_cuda[1])); - -} - -void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ - cudaErrchk(cudaMemcpyAsync(alAend, gpu_data->ref_end_gpu, sequences_per_stream * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alAend + sequences_per_stream, gpu_data->ref_end_gpu + sequences_per_stream, - (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); - - cudaErrchk(cudaMemcpyAsync(alBend, gpu_data->query_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alBend + sequences_per_stream, gpu_data->query_end_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[1])); -} - -void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ - cudaErrchk(cudaMemcpyAsync(alAbeg, gpu_data->ref_start_gpu, sequences_per_stream * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alAbeg + sequences_per_stream, gpu_data->ref_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[1])); - - cudaErrchk(cudaMemcpyAsync(alBbeg, gpu_data->query_start_gpu, sequences_per_stream * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alBbeg + sequences_per_stream, gpu_data->query_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[1])); - - cudaErrchk(cudaMemcpyAsync(top_scores_cpu, gpu_data->scores_gpu, sequences_per_stream * sizeof(short), - cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(top_scores_cpu + sequences_per_stream, gpu_data->scores_gpu + sequences_per_stream, - (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); - -} - int get_new_min_length(short* alAend, short* alBend, int blocksLaunched){ int newMin = 1000; int maxA = 0; diff --git a/utils.hpp b/utils.hpp index b7a238c..c8bc4f8 100644 --- a/utils.hpp +++ b/utils.hpp @@ -1,11 +1,16 @@ #ifndef UTILS_HPP #define UTILS_HPP -#include "driver.hpp" + +#include +#include +#include + #define cudaErrchk(ans) \ { \ gpuAssert((ans), __FILE__, __LINE__); \ } inline void + gpuAssert(cudaError_t code, const char* file, int line, bool abort = true) { if(code != cudaSuccess) @@ -17,10 +22,5 @@ gpuAssert(cudaError_t code, const char* file, int line, bool abort = true) } unsigned getMaxLength (std::vector v); -void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments); -void free_alignments(gpu_bsw_driver::alignment_results *alignments); -void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); int get_new_min_length(short* alAend, short* alBend, int blocksLaunched); -void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); -void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); #endif \ No newline at end of file From e9e323275ef980b511b802b141f640df6c3a906f Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Wed, 8 Jul 2020 11:10:34 -0600 Subject: [PATCH 08/47] Check input arguments to the test program --- main.cpp | 10 +++++++++- 1 file changed, 9 insertions(+), 1 deletion(-) diff --git a/main.cpp b/main.cpp index 0e2058c..4445f68 100644 --- a/main.cpp +++ b/main.cpp @@ -226,12 +226,20 @@ void dnaSampleRun(string refFile, string queFile, string out_file){ int main(int argc, char* argv[]) { + if(argc<4){ + cerr<<"Syntax: "< "< Date: Wed, 8 Jul 2020 11:13:55 -0600 Subject: [PATCH 09/47] Correct README.md file --- README.md | 22 ++++++++++------------ 1 file changed, 10 insertions(+), 12 deletions(-) diff --git a/README.md b/README.md index a25d2a1..41c17c9 100644 --- a/README.md +++ b/README.md @@ -20,25 +20,23 @@ so.** -To Build:
-mkdir build
-cd build
-cmake CMAKE_BUILD_TYPE=Release ..
-make
+To Build: -
-To Execute DNA test run:
+ mkdir build + cd build + cmake CMAKE_BUILD_TYPE=Release .. + make -./program_gpu dna ../test-data/dna-reference.fasta ../test-data/dna-query.fasta
+To Execute DNA test run: -To Execute Protein test run:
+ ./program_gpu dna ../test-data/dna-reference.fasta ../test-data/dna-query.fasta output -./program_gpu aa ../test-data/protein-reference.fasta ../test-data/protein-query.fasta
+To Execute Protein test run: + + ./program_gpu aa ../test-data/protein-reference.fasta ../test-data/protein-query.fasta output -
Contact: mgawan@lbl.gov -
If you use GPU-BSW in your project, please cite this repo as: *Muaaz G. Awan, GPU accelerated Smith-Waterman for performing batch alignments (GPU-BSW), 2019, Github Repository: https://github.com/m-gul/GPU-BSW/* From 390fef8214355279adbe2ae20f4e951db952ece1 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Wed, 8 Jul 2020 12:26:49 -0600 Subject: [PATCH 10/47] Drop .DS_Store --- .DS_Store | Bin 6148 -> 0 bytes 1 file changed, 0 insertions(+), 0 deletions(-) delete mode 100644 .DS_Store diff --git a/.DS_Store b/.DS_Store deleted file mode 100644 index e79d1a1a633d8599d5ae43e79fe29552ddf320af..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 6148 zcmeHK%Wl&^6upzA;J7@psMIdKL1Ix*4XRXxD!FO0s00!s2o``+yLO3H*N$wb0YZ>B z`~&a@h%aHqk`Lhn;LM}QPEvJ;5S=UCIrF$@#&hhM@emPfk9?b`MMMUiW5YzUz<4|N zIjgCfD?ldt@b{wRz>5-ZE>>4)1+)VHo&tRBE|Etg3Mr!U`sG`~efZ5^!o;JOBE4}o zR4e_PH;lq8-`M!UYW2p_rOSq48s=5=Wp9v-d%2sBvbLK(=cPw(KJZljNs>f=@~-zZ z495M|%5DnOfWYfO4Zf)J2u3HoP z&gK@++tX>&SiNCy@9iJIc{_PGeg8>Jf*3X{Vb>L&!e?YkQ#|RVag@ZbP|F$DXqO(6 zOGgyY1IU$84!@1`HRYv^55lok#FvFL$)^;Y6L3>-4roZj8P11uID-Y8pK~1kbScG1 zqs8OY+;cb!#;JXu;TUubB|?m|a4z-jx%gA%4#kHSROep*IupN4kEu&L)S*5!?_!i8 z6g;f5gvuXFpJx;AA`tK87NT90+$w{<%#4HL#Wl4IjOB|ffu6ZmKr3*D0(^h4;2a%= zg+#G+AQ4vpU<1{{kmo-RoMS0;6c!TE0%MX2lvJj!7);VpZ>cy(VIfh{iK)v6QzJ8V zLt$cc^lyo9Vvaz+ tg73q*@wh^wpdeAlvB>bFcnvNLZ5Gb}9fgHN)WGzQfRI5aT7kc+z;7Bk*lz#; From a5599f5d9c56790bdd7151f156d19a7ba56a6271 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 08:29:17 -0600 Subject: [PATCH 11/47] Improve file I/O --- CMakeLists.txt | 4 +- driver.cpp | 2 +- main.cpp | 311 ++++++++++++++----------------------------------- read_fasta.cpp | 108 +++++++++++++++++ read_fasta.hpp | 24 ++++ 5 files changed, 222 insertions(+), 227 deletions(-) create mode 100644 read_fasta.cpp create mode 100644 read_fasta.hpp diff --git a/CMakeLists.txt b/CMakeLists.txt index 5654b0d..e4301f9 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -12,8 +12,8 @@ set(CMAKE_CUDA_EXTENSIONS OFF CACHE BOOL "") find_package(OpenMP REQUIRED) -file(GLOB sources ${PROJECT_SOURCE_DIR}/ utils.cpp alignments.cpp kernel.cpp driver.cpp main.cpp) -file(GLOB headers ${PROJECT_SOURCE_DIR}/utils.hpp alignments.hpp kernel.hpp driver.hpp) +file(GLOB sources ${PROJECT_SOURCE_DIR}/ utils.cpp alignments.cpp kernel.cpp driver.cpp main.cpp read_fasta.cpp) +file(GLOB headers ${PROJECT_SOURCE_DIR}/utils.hpp alignments.hpp kernel.hpp driver.hpp read_fasta.hpp) set_source_files_properties(${sources} PROPERTIES LANGUAGE CUDA diff --git a/driver.cpp b/driver.cpp index 0169625..ef0c07a 100644 --- a/driver.cpp +++ b/driver.cpp @@ -69,4 +69,4 @@ void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbe cudaErrchk(cudaMemcpyAsync(top_scores_cpu + sequences_per_stream, gpu_data->scores_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); -} \ No newline at end of file +} diff --git a/main.cpp b/main.cpp index 4445f68..fdbd247 100644 --- a/main.cpp +++ b/main.cpp @@ -8,239 +8,102 @@ #include #include"utils.hpp" -using namespace std; - -void proteinSampleRun(string refFile, string queFile, string out_file){ - long long int total_cells = 0; - vector G_sequencesA, G_sequencesB; - string myInLine; - int largestA = 0, largestB = 0, totSizeA = 0, totSizeB = 0; - ifstream ref_file(refFile), quer_file(queFile); - - if(ref_file.is_open()) - { - while(getline(ref_file, myInLine)) - { - // string seq = myInLine.substr(myInLine.find(":") + 1, myInLine.size() - 1); - if(myInLine[0] == '>'){ - continue; - }else{ - string seq = myInLine; - G_sequencesA.push_back(seq); - //std::cout<<"ref:"< largestA) - { - largestA = seq.size(); - } - - } - - } - ref_file.close(); - } - - - if(quer_file.is_open()) - { - while(getline(quer_file, myInLine)) - { - //string seq = myInLine.substr(myInLine.find(":") + 1, myInLine.size() - 1); - if(myInLine[0] == '>'){ - continue; - }else{ - string seq = myInLine; - G_sequencesB.push_back(seq); - // std::cout<<"que:"< largestB) - { - largestB = seq.size(); - } - - } - - } - quer_file.close(); - } - - - - - short scores_matrix[] = {4 ,-1 ,-2 ,-2 ,0 ,-1 ,-1 ,0 ,-2 ,-1 ,-1 ,-1 ,-1 ,-2 ,-1 ,1 ,0 ,-3 ,-2 ,0 ,-2 ,-1 ,0 ,-4 , -1 ,5 ,0 ,-2 ,-3 ,1 ,0 ,-2 ,0 ,-3 ,-2 ,2 ,-1 ,-3 ,-2 ,-1 ,-1 ,-3 ,-2 ,-3 ,-1 ,0 ,-1 ,-4 , - -2 ,0 ,6 ,1 ,-3 ,0 ,0 ,0 ,1 ,-3 ,-3 ,0 ,-2 ,-3 ,-2 ,1 ,0 ,-4 ,-2 ,-3 ,3 ,0 ,-1 ,-4 , - -2 ,-2 ,1 ,6 ,-3 ,0 ,2 ,-1 ,-1 ,-3 ,-4 ,-1 ,-3 ,-3 ,-1 ,0 ,-1 ,-4 ,-3 ,-3 ,4 ,1 ,-1 ,-4 , - 0 ,-3 ,-3 ,-3 ,9 ,-3 ,-4 ,-3 ,-3 ,-1 ,-1 ,-3 ,-1 ,-2 ,-3 ,-1 ,-1 ,-2 ,-2 ,-1 ,-3 ,-3 ,-2 ,-4 , - -1 ,1 ,0 ,0 ,-3 ,5 ,2 ,-2 ,0 ,-3 ,-2 ,1 ,0 ,-3 ,-1 ,0 ,-1 ,-2 ,-1 ,-2 ,0 ,3 ,-1 ,-4 , - -1 ,0 ,0 ,2 ,-4 ,2 ,5 ,-2 ,0 ,-3 ,-3 ,1 ,-2 ,-3 ,-1 ,0 ,-1 ,-3 ,-2 ,-2 ,1 ,4 ,-1 ,-4 , - 0 ,-2 ,0 ,-1 ,-3 ,-2 ,-2 ,6 ,-2 ,-4 ,-4 ,-2 ,-3 ,-3 ,-2 ,0 ,-2 ,-2 ,-3 ,-3 ,-1 ,-2 ,-1 ,-4 , - -2 ,0 ,1 ,-1 ,-3 ,0 ,0 ,-2 ,8 ,-3 ,-3 ,-1 ,-2 ,-1 ,-2 ,-1 ,-2 ,-2 ,2 ,-3 ,0 ,0 ,-1 ,-4 , - -1 ,-3 ,-3 ,-3 ,-1 ,-3 ,-3 ,-4 ,-3 ,4 ,2 ,-3 ,1 ,0 ,-3 ,-2 ,-1 ,-3 ,-1 ,3 ,-3 ,-3 ,-1 ,-4 , - -1 ,-2 ,-3 ,-4 ,-1 ,-2 ,-3 ,-4 ,-3 ,2 ,4 ,-2 ,2 ,0 ,-3 ,-2 ,-1 ,-2 ,-1 ,1 ,-4 ,-3 ,-1 ,-4 , - -1 ,2 ,0 ,-1 ,-3 ,1 ,1 ,-2 ,-1 ,-3 ,-2 ,5 ,-1 ,-3 ,-1 ,0 ,-1 ,-3 ,-2 ,-2 ,0 ,1 ,-1 ,-4 , - -1 ,-1 ,-2 ,-3 ,-1 ,0 ,-2 ,-3 ,-2 ,1 ,2 ,-1 ,5 ,0 ,-2 ,-1 ,-1 ,-1 ,-1 ,1 ,-3 ,-1 ,-1 ,-4 , - -2 ,-3 ,-3 ,-3 ,-2 ,-3 ,-3 ,-3 ,-1 ,0 ,0 ,-3 ,0 ,6 ,-4 ,-2 ,-2 ,1 ,3 ,-1 ,-3 ,-3 ,-1 ,-4 , - -1 ,-2 ,-2 ,-1 ,-3 ,-1 ,-1 ,-2 ,-2 ,-3 ,-3 ,-1 ,-2 ,-4 ,7 ,-1 ,-1 ,-4 ,-3 ,-2 ,-2 ,-1 ,-2 ,-4 , - 1 ,-1 ,1 ,0 ,-1 ,0 ,0 ,0 ,-1 ,-2 ,-2 ,0 ,-1 ,-2 ,-1 ,4 ,1 ,-3 ,-2 ,-2 ,0 ,0 ,0 ,-4 , - 0 ,-1 ,0 ,-1 ,-1 ,-1 ,-1 ,-2 ,-2 ,-1 ,-1 ,-1 ,-1 ,-2 ,-1 ,1 ,5 ,-2 ,-2 ,0 ,-1 ,-1 ,0 ,-4 , - -3 ,-3 ,-4 ,-4 ,-2 ,-2 ,-3 ,-2 ,-2 ,-3 ,-2 ,-3 ,-1 ,1 ,-4 ,-3 ,-2 ,11 ,2 ,-3 ,-4 ,-3 ,-2 ,-4 , - -2 ,-2 ,-2 ,-3 ,-2 ,-1 ,-2 ,-3 ,2 ,-1 ,-1 ,-2 ,-1 ,3 ,-3 ,-2 ,-2 ,2 ,7 ,-1 ,-3 ,-2 ,-1 ,-4 , - 0 ,-3 ,-3 ,-3 ,-1 ,-2 ,-2 ,-3 ,-3 ,3 ,1 ,-2 ,1 ,-1 ,-2 ,-2 ,0 ,-3 ,-1 ,4 ,-3 ,-2 ,-1 ,-4 , - -2 ,-1 ,3 ,4 ,-3 ,0 ,1 ,-1 ,0 ,-3 ,-4 ,0 ,-3 ,-3 ,-2 ,0 ,-1 ,-4 ,-3 ,-3 ,4 ,1 ,-1 ,-4 , - -1 ,0 ,0 ,1 ,-3 ,3 ,4 ,-2 ,0 ,-3 ,-3 ,1 ,-1 ,-3 ,-1 ,0 ,-1 ,-3 ,-2 ,-2 ,1 ,4 ,-1 ,-4 , - 0 ,-1 ,-1 ,-1 ,-2 ,-1 ,-1 ,-1 ,-1 ,-1 ,-1 ,-1 ,-1 ,-1 ,-2 ,0 ,0 ,-2 ,-1 ,-1 ,-1 ,-1 ,-1 ,-4 , - -4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,-4 ,1}; // blosum 62 - - /*blposum 50 = {// 24 x 24 table - // A R N D C Q E G H I L K M F P S T W Y V B Z X * - 5, -2, -1, -2, -1, -1, -1, 0, -2, -1, -2, -1, -1, -3, -1, 1, 0, -3, -2, 0, -2, -1, -1, -5, // A - -2, 7, -1, -2, -4, 1, 0, -3, 0, -4, -3, 3, -2, -3, -3, -1, -1, -3, -1, -3, -1, 0, -1, -5, // R - -1, -1, 7, 2, -2, 0, 0, 0, 1, -3, -4, 0, -2, -4, -2, 1, 0, -4, -2, -3, 5, 0, -1, -5, // N - -2, -2, 2, 8, -4, 0, 2, -1, -1, -4, -4, -1, -4, -5, -1, 0, -1, -5, -3, -4, 6, 1, -1, -5, // D - -1, -4, -2, -4, 13, -3, -3, -3, -3, -2, -2, -3, -2, -2, -4, -1, -1, -5, -3, -1, -3, -3, -1, -5, // C - -1, 1, 0, 0, -3, 7, 2, -2, 1, -3, -2, 2, 0, -4, -1, 0, -1, -1, -1, -3, 0, 4, -1, -5, // Q - -1, 0, 0, 2, -3, 2, 6, -3, 0, -4, -3, 1, -2, -3, -1, -1, -1, -3, -2, -3, 1, 5, -1, -5, // E - 0, -3, 0, -1, -3, -2, -3, 8, -2, -4, -4, -2, -3, -4, -2, 0, -2, -3, -3, -4, -1, -2, -1, -5, // G - -2, 0, 1, -1, -3, 1, 0, -2, 10, -4, -3, 0, -1, -1, -2, -1, -2, -3, 2, -4, 0, 0, -1, -5, // H - -1, -4, -3, -4, -2, -3, -4, -4, -4, 5, 2, -3, 2, 0, -3, -3, -1, -3, -1, 4, -4, -3, -1, -5, // I - -2, -3, -4, -4, -2, -2, -3, -4, -3, 2, 5, -3, 3, 1, -4, -3, -1, -2, -1, 1, -4, -3, -1, -5, // L - -1, 3, 0, -1, -3, 2, 1, -2, 0, -3, -3, 6, -2, -4, -1, 0, -1, -3, -2, -3, 0, 1, -1, -5, // K - -1, -2, -2, -4, -2, 0, -2, -3, -1, 2, 3, -2, 7, 0, -3, -2, -1, -1, 0, 1, -3, -1, -1, -5, // M - -3, -3, -4, -5, -2, -4, -3, -4, -1, 0, 1, -4, 0, 8, -4, -3, -2, 1, 4, -1, -4, -4, -1, -5, // F - -1, -3, -2, -1, -4, -1, -1, -2, -2, -3, -4, -1, -3, -4, 10, -1, -1, -4, -3, -3, -2, -1, -1, -5, // P - 1, -1, 1, 0, -1, 0, -1, 0, -1, -3, -3, 0, -2, -3, -1, 5, 2, -4, -2, -2, 0, 0, -1, -5, // S - 0, -1, 0, -1, -1, -1, -1, -2, -2, -1, -1, -1, -1, -2, -1, 2, 5, -3, -2, 0, 0, -1, -1, -5, // T - -3, -3, -4, -5, -5, -1, -3, -3, -3, -3, -2, -3, -1, 1, -4, -4, -3, 15, 2, -3, -5, -2, -1, -5, // W - -2, -1, -2, -3, -3, -1, -2, -3, 2, -1, -1, -2, 0, 4, -3, -2, -2, 2, 8, -1, -3, -2, -1, -5, // Y - 0, -3, -3, -4, -1, -3, -3, -4, -4, 4, 1, -3, 1, -1, -3, -2, 0, -3, -1, 5, -3, -3, -1, -5, // V - -2, -1, 5, 6, -3, 0, 1, -1, 0, -4, -4, 0, -3, -4, -2, 0, 0, -5, -3, -3, 6, 1, -1, -5, // B - -1, 0, 0, 1, -3, 4, 5, -2, 0, -3, -3, 1, -1, -4, -1, 0, -1, -2, -2, -3, 1, 5, -1, -5, // Z - -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -1, -5, // X - -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, -5, 1 // * - };*/ - - gpu_bsw_driver::alignment_results results_test; - gpu_bsw_driver::kernel_driver(G_sequencesB, G_sequencesA, &results_test, scores_matrix, -6, -1); - - // gpu_bsw_driver::verificationTest(resultFile, results_test.g_alAbeg, results_test.g_alBbeg, results_test.g_alAend, results_test.g_alBend); - - ofstream results_file(out_file); - - - for(int k = 0; k < G_sequencesA.size(); k++){ - results_file< "< G_sequencesA, - G_sequencesB; - - string myInLine; - ifstream ref_file(refFile); - ifstream quer_file(queFile); - unsigned largestA = 0, largestB = 0; - - int totSizeA = 0, totSizeB = 0; - - if(ref_file.is_open()) - { - while(getline(ref_file, myInLine)) - { - // string seq = myInLine.substr(myInLine.find(":") + 1, myInLine.size() - 1); - if(myInLine[0] == '>'){ - continue; - }else{ - string seq = myInLine; - G_sequencesA.push_back(seq); - //std::cout<<"ref:"< largestA) - { - largestA = seq.size(); - } - - } - - } - ref_file.close(); - } + const auto input_data = ReadFastaQueryTargetPair(refFile, queFile); - if(quer_file.is_open()) - { - while(getline(quer_file, myInLine)) - { - //string seq = myInLine.substr(myInLine.find(":") + 1, myInLine.size() - 1); - if(myInLine[0] == '>'){ - continue; - }else{ - string seq = myInLine; - G_sequencesB.push_back(seq); - // std::cout<<"que:"< largestB) - { - largestB = seq.size(); - } - - } - - } - quer_file.close(); + gpu_bsw_driver::alignment_results results; + if(in_arg == "aa"){ + gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, blosum62, -6, -1); + } else if(in_arg == "dna") { + gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, match_mismatch_scores, -3, -1); + } else { + std::cerr<<"Data type must be 'aa' or 'dna'!"<(G_sequencesB, G_sequencesA,&results_test, scores, -3, -1); - for(int k = 0; k < G_sequencesA.size(); k++){ - results_file< "<' translates to 0b00 (0) = Forward, natural + * - '<' translates to 0b01 (1) = Reverse, natural + * - '/' translates to 0b10 (2) = Forward, complemented + * - '+' translates to 0b11 (3) = Reverse, complemented + * No protection is done, so any other number will only have its two first bytes counted as above. + */ + + //Load sequences from the files + std::string input_line; + while (std::getline(fin, input_line)){ + //Skip empty lines + if(input_line.empty()) + continue; + //Skip lines entirely made of whitespace + if(std::all_of(input_line.begin(), input_line.end(), [](const auto &x) {return std::isspace(x);})) + continue; + + //Determine if the line starts with a special character + const auto q = std::find(line_starts.begin(), line_starts.end(), input_line.front()); + + if(q!=line_starts.end()){ //Line begins with a special character. It's the start of a new sequence! + fasta.modifiers.push_back(*q); //Make a note of which special modifying character was used + fasta.headers.push_back(input_line.substr(1)); //Copy the header text, dropping the start/mod character + + if (reading_sequence) { + // a sequence was already being read. Now it's done, so we should find its length. + fasta.total_sequence_bytes += fasta.sequences.back().length(); + fasta.maximum_sequence_length = std::max(fasta.sequences.back().length(), fasta.maximum_sequence_length); + } + reading_sequence = false; + + } else if (!reading_sequence) { + //If we're here then the line didn't begin with a special character and + //we're not currently appending to a sequence, so we start a new sequence. + fasta.sequences.push_back(input_line); + reading_sequence = true; + } else if (reading_sequence) { + fasta.sequences.back() += input_line; + } + } + + //We've reached the end of the file, so we need one last update of the sequence lengths + fasta.total_sequence_bytes += fasta.sequences.back().length(); + fasta.maximum_sequence_length = std::max(fasta.sequences.back().length(), fasta.maximum_sequence_length); + + return fasta; +} + + + +FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target){ + FastaPair ret; + ret.a = ReadFasta(query); + ret.b = ReadFasta(target); + + if(ret.a.sequences.size()!=ret.b.sequences.size()) + throw std::runtime_error("Query and Target files were not the same length!"); + + return ret; +} + + +size_t FastaInput::sequence_count() const { + return sequences.size(); +} + +uint64_t FastaPair::total_cells_1_to_1() const { + uint64_t count = 0; + for(size_t i=0;i +#include + +struct FastaInput { + std::vector sequences; + std::vector headers; + std::vector modifiers; + size_t maximum_sequence_length = 0; + size_t total_sequence_bytes = 0; + size_t sequence_count() const; +}; + +struct FastaPair { + FastaInput a; + FastaInput b; + uint64_t total_cells_1_to_1() const; + size_t sequence_count() const; +}; + +FastaInput ReadFasta(const std::string &filename); + +FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target); \ No newline at end of file From d9a0e5f3274245e4889cedd009bb41c169e90092 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 08:52:02 -0600 Subject: [PATCH 12/47] Compile with Wall and -Wextra --- CMakeLists.txt | 5 ++--- 1 file changed, 2 insertions(+), 3 deletions(-) diff --git a/CMakeLists.txt b/CMakeLists.txt index e4301f9..3659851 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -8,10 +8,8 @@ set(CMAKE_CUDA_STANDARD 14 CACHE STRING "") set(CMAKE_CUDA_EXTENSIONS OFF CACHE BOOL "") #find_package(timemory REQUIRED COMPONENTS headers cuda cupti compile-options arch) -#find_package(cuda REQUIRED) find_package(OpenMP REQUIRED) - file(GLOB sources ${PROJECT_SOURCE_DIR}/ utils.cpp alignments.cpp kernel.cpp driver.cpp main.cpp read_fasta.cpp) file(GLOB headers ${PROJECT_SOURCE_DIR}/utils.hpp alignments.hpp kernel.hpp driver.hpp read_fasta.hpp) @@ -20,7 +18,8 @@ set_source_files_properties(${sources} PROPERTIES LINKER_LANGUAGE CUDA) add_executable(program_gpu ${sources} ${headers}) -target_compile_options(program_gpu PUBLIC $<$:-gencode arch=compute_70,code=sm_70>) +target_compile_options(program_gpu PUBLIC $<$:-gencode arch=compute_70,code=sm_70;-Xcompiler=-Wall,-Wextra>) + #target_link_libraries(program_gpu PUBLIC timemory OpenMP::OpenMP_CXX) target_link_libraries(program_gpu PUBLIC OpenMP::OpenMP_CXX) target_include_directories(program_gpu PUBLIC ${PROJECT_SOURCE_DIR}) From 822092894533c0db8008e7ac81513961732de52f Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 15:00:55 -0600 Subject: [PATCH 13/47] Rearrange project into a standard library form --- .gitignore | 2 ++ CMakeLists.txt | 33 ++++++++++++------- main.cpp => evaluation/main.cpp | 11 +++---- .../gpu_bsw/alignments.hpp | 0 driver.hpp => include/gpu_bsw/driver.hpp | 24 +++++++------- kernel.hpp => include/gpu_bsw/kernel.hpp | 2 ++ .../gpu_bsw/read_fasta.hpp | 0 utils.hpp => include/gpu_bsw/utils.hpp | 0 alignments.cpp => src/alignments.cpp | 5 +-- driver.cpp => src/driver.cpp | 2 +- kernel.cpp => src/kernel.cpp | 2 +- read_fasta.cpp => src/read_fasta.cpp | 2 +- utils.cpp => src/utils.cpp | 3 +- 13 files changed, 49 insertions(+), 37 deletions(-) create mode 100644 .gitignore rename main.cpp => evaluation/main.cpp (98%) rename alignments.hpp => include/gpu_bsw/alignments.hpp (100%) rename driver.hpp => include/gpu_bsw/driver.hpp (99%) rename kernel.hpp => include/gpu_bsw/kernel.hpp (99%) rename read_fasta.hpp => include/gpu_bsw/read_fasta.hpp (100%) rename utils.hpp => include/gpu_bsw/utils.hpp (100%) rename alignments.cpp => src/alignments.cpp (93%) rename driver.cpp => src/driver.cpp (99%) rename kernel.cpp => src/kernel.cpp (99%) rename read_fasta.cpp => src/read_fasta.cpp (99%) rename utils.cpp => src/utils.cpp (95%) diff --git a/.gitignore b/.gitignore new file mode 100644 index 0000000..6f31401 --- /dev/null +++ b/.gitignore @@ -0,0 +1,2 @@ +build/ +.vscode/ diff --git a/CMakeLists.txt b/CMakeLists.txt index 3659851..17b94db 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -1,6 +1,6 @@ cmake_minimum_required(VERSION 3.14 FATAL_ERROR) -project(sw_GPU LANGUAGES C CXX CUDA) +project(sw_GPU LANGUAGES CXX CUDA) set(CMAKE_CXX_STANDARD 14 CACHE STRING "") set(CMAKE_CXX_EXTENSIONS OFF CACHE BOOL "") @@ -10,25 +10,34 @@ set(CMAKE_CUDA_EXTENSIONS OFF CACHE BOOL "") #find_package(timemory REQUIRED COMPONENTS headers cuda cupti compile-options arch) find_package(OpenMP REQUIRED) -file(GLOB sources ${PROJECT_SOURCE_DIR}/ utils.cpp alignments.cpp kernel.cpp driver.cpp main.cpp read_fasta.cpp) -file(GLOB headers ${PROJECT_SOURCE_DIR}/utils.hpp alignments.hpp kernel.hpp driver.hpp read_fasta.hpp) - -set_source_files_properties(${sources} PROPERTIES - LANGUAGE CUDA - LINKER_LANGUAGE CUDA) +set(sources + src/utils.cpp + src/alignments.cpp + src/kernel.cpp + src/driver.cpp + src/read_fasta.cpp +) -add_executable(program_gpu ${sources} ${headers}) -target_compile_options(program_gpu PUBLIC $<$:-gencode arch=compute_70,code=sm_70;-Xcompiler=-Wall,-Wextra>) +set_source_files_properties(${sources} evaluation/main.cpp +PROPERTIES + LANGUAGE CUDA + LINKER_LANGUAGE CUDA +) +add_library(gpu_bsw ${sources}) +target_include_directories(gpu_bsw PUBLIC include) +target_link_libraries(gpu_bsw PUBLIC OpenMP::OpenMP_CXX) +target_compile_options(gpu_bsw PUBLIC $<$:-gencode arch=compute_70,code=sm_70;-Xcompiler=-Wall,-Wextra>) #target_link_libraries(program_gpu PUBLIC timemory OpenMP::OpenMP_CXX) -target_link_libraries(program_gpu PUBLIC OpenMP::OpenMP_CXX) -target_include_directories(program_gpu PUBLIC ${PROJECT_SOURCE_DIR}) get_property(LANGUAGES GLOBAL PROPERTY ENABLED_LANGUAGES) if(CMAKE_CUDA_COMPILER AND "CUDA" IN_LIST LANGUAGES) - target_compile_options(program_gpu PUBLIC $<$:-Xcompiler -fopenmp>) + target_compile_options(gpu_bsw PUBLIC $<$:-Xcompiler -fopenmp>) endif() +add_executable(program_gpu evaluation/main.cpp) +target_link_libraries(program_gpu PRIVATE gpu_bsw) + add_custom_target( regression_tests ALL COMMAND ${CMAKE_COMMAND} -E make_directory ${CMAKE_BINARY_DIR}/regression_test diff --git a/main.cpp b/evaluation/main.cpp similarity index 98% rename from main.cpp rename to evaluation/main.cpp index fdbd247..e73dc87 100644 --- a/main.cpp +++ b/evaluation/main.cpp @@ -1,14 +1,11 @@ -#include "driver.hpp" -#include +#include +#include + #include #include #include -#include #include -#include -#include"utils.hpp" - -#include "read_fasta.hpp" +#include constexpr short blosum62[] = { // A R N D C Q E G H I L K M F P S T W Y V B Z X * diff --git a/alignments.hpp b/include/gpu_bsw/alignments.hpp similarity index 100% rename from alignments.hpp rename to include/gpu_bsw/alignments.hpp diff --git a/driver.hpp b/include/gpu_bsw/driver.hpp similarity index 99% rename from driver.hpp rename to include/gpu_bsw/driver.hpp index 6ce6fbc..61fa808 100644 --- a/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -1,22 +1,22 @@ #ifndef DRIVER_HPP #define DRIVER_HPP -#include "kernel.hpp" -#include -#include -#include -#include -#include -#include "alignments.hpp" -#include "driver.hpp" -#include "utils.hpp" -#include -#include -#include +#include +#include +#include +#include + #include #include #include +#include +#include +#include +#include +#include +#include +#include #define NSTREAMS 2 diff --git a/kernel.hpp b/include/gpu_bsw/kernel.hpp similarity index 99% rename from kernel.hpp rename to include/gpu_bsw/kernel.hpp index 415798f..8098959 100644 --- a/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -1,9 +1,11 @@ #ifndef KERNEL_HPP #define KERNEL_HPP + #include #include #include #include + #define NUM_OF_AA 21 #define ENCOD_MAT_SIZE 91 #define SCORE_MAT_SIZE 576 diff --git a/read_fasta.hpp b/include/gpu_bsw/read_fasta.hpp similarity index 100% rename from read_fasta.hpp rename to include/gpu_bsw/read_fasta.hpp diff --git a/utils.hpp b/include/gpu_bsw/utils.hpp similarity index 100% rename from utils.hpp rename to include/gpu_bsw/utils.hpp diff --git a/alignments.cpp b/src/alignments.cpp similarity index 93% rename from alignments.cpp rename to src/alignments.cpp index 6390af0..1172e2b 100644 --- a/alignments.cpp +++ b/src/alignments.cpp @@ -1,5 +1,6 @@ -#include "alignments.hpp" -#include"utils.hpp" +#include +#include + gpu_alignments::gpu_alignments(int max_alignments){ cudaErrchk(cudaMalloc(&offset_query_gpu, (max_alignments) * sizeof(int))); cudaErrchk(cudaMalloc(&offset_ref_gpu, (max_alignments) * sizeof(int))); diff --git a/driver.cpp b/src/driver.cpp similarity index 99% rename from driver.cpp rename to src/driver.cpp index ef0c07a..2b87904 100644 --- a/driver.cpp +++ b/src/driver.cpp @@ -1,4 +1,4 @@ -#include "driver.hpp" +#include void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments){ cudaMallocHost(&(alignments->ref_begin), sizeof(short)*max_alignments); diff --git a/kernel.cpp b/src/kernel.cpp similarity index 99% rename from kernel.cpp rename to src/kernel.cpp index 814fd50..cfb4480 100644 --- a/kernel.cpp +++ b/src/kernel.cpp @@ -1,4 +1,4 @@ -#include +#include __inline__ __device__ short gpu_bsw::warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) diff --git a/read_fasta.cpp b/src/read_fasta.cpp similarity index 99% rename from read_fasta.cpp rename to src/read_fasta.cpp index b4d98a3..4d5ce1f 100644 --- a/read_fasta.cpp +++ b/src/read_fasta.cpp @@ -1,4 +1,4 @@ -#include +#include #include #include diff --git a/utils.cpp b/src/utils.cpp similarity index 95% rename from utils.cpp rename to src/utils.cpp index 02f3ec3..ed095ad 100644 --- a/utils.cpp +++ b/src/utils.cpp @@ -1,4 +1,5 @@ -#include +#include + unsigned getMaxLength (std::vector v) { unsigned maxLength = 0; From 979e7a0ecc874f7a4265b29b2b65fd6de885c79e Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 16:17:15 -0600 Subject: [PATCH 14/47] Fix up timers --- evaluation/main.cpp | 8 +++++++ include/gpu_bsw/driver.hpp | 47 +++++++++++++++++--------------------- include/gpu_bsw/timer.hpp | 45 ++++++++++++++++++++++++++++++++++++ 3 files changed, 74 insertions(+), 26 deletions(-) create mode 100644 include/gpu_bsw/timer.hpp diff --git a/evaluation/main.cpp b/evaluation/main.cpp index e73dc87..b35c19a 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -1,5 +1,6 @@ #include #include +#include #include #include @@ -82,6 +83,9 @@ int main(int argc, char* argv[]){ const auto input_data = ReadFastaQueryTargetPair(refFile, queFile); + Timer timer_calc; + timer_calc.start(); + gpu_bsw_driver::alignment_results results; if(in_arg == "aa"){ gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, blosum62, -6, -1); @@ -92,6 +96,8 @@ int main(int argc, char* argv[]){ return -1; } + timer_calc.stop(); + std::ofstream results_file(out_file); for(size_t k = 0; k < input_data.sequence_count(); k++){ results_file<::const_iterator beginAVec; std::vector::const_iterator endAVec; @@ -174,7 +176,7 @@ void kernel_driver( unsigned half_length_A = 0; unsigned half_length_B = 0; - auto start_cpu = NOW; + timer_cpu.start(); for(int i = 0; i < sequencesA.size(); i++) { @@ -199,10 +201,8 @@ void kernel_driver( } unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; - auto end_cpu = NOW; - std::chrono::duration cpu_dur = end_cpu - start_cpu; + timer_cpu.stop(); - total_time_cpu += cpu_dur.count(); unsigned offsetSumA = 0; unsigned offsetSumB = 0; @@ -216,10 +216,7 @@ void kernel_driver( offsetSumB += sequencesB[i].size(); } - auto packing_end = NOW; - std::chrono::duration packing_dur = packing_end - packing_start; - - total_packing += packing_dur.count(); + timer_packing.stop(); asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; @@ -256,11 +253,9 @@ void kernel_driver( cudaStreamSynchronize (streams_cuda[0]); cudaStreamSynchronize (streams_cuda[1]); - auto sec_cpu_start = NOW; + timer_cpu.start(); int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths - auto sec_cpu_end = NOW; - std::chrono::duration dur_sec_cpu = sec_cpu_end - sec_cpu_start; - total_time_cpu += dur_sec_cpu.count(); + timer_cpu.stop(); if(DT==DataType::RNA){ gpu_bsw::sequence_aa_reverse<<>>( @@ -293,8 +288,6 @@ void kernel_driver( } // for iterations end here - auto end1 = NOW; - std::chrono::duration diff2 = end1 - start2; cudaErrchk(cudaFree(strA_d)); cudaErrchk(cudaFree(strB_d)); cudaFreeHost(offsetA_h); @@ -305,14 +298,16 @@ void kernel_driver( for(int i = 0; i < NSTREAMS; i++) cudaStreamDestroy(streams_cuda[i]); - std::cout <<"cpu time:"<(this_duration); + started = false; + } + + void print() const { + std::cout << name << " = " << elapsed_time.count() << " msec" << std::endl; + } + + double getTime() const { return elapsed_time.count();} + + double getSeconds() const { return elapsed_time.count()/(1e6); } + + private: + std::chrono::time_point start_time; + const std::string name; + std::chrono::microseconds elapsed_time = std::chrono::microseconds(0); + bool started = false; +}; From 89b811200c497c981843bacf1098a28a3c377fe6 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 16:23:24 -0600 Subject: [PATCH 15/47] Add beginnings of unit tests --- CMakeLists.txt | 11 +- unittest/doctest.h | 6205 ++++++++++++++++++++++++++++++++++ unittest/test_main.cpp | 2 + unittest/test_read_fasta.cpp | 26 + unittest/test_timer.cpp | 14 + 5 files changed, 6257 insertions(+), 1 deletion(-) create mode 100644 unittest/doctest.h create mode 100644 unittest/test_main.cpp create mode 100644 unittest/test_read_fasta.cpp create mode 100644 unittest/test_timer.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index 17b94db..bb05917 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -18,7 +18,13 @@ set(sources src/read_fasta.cpp ) -set_source_files_properties(${sources} evaluation/main.cpp +set(test_sources + unittest/test_main.cpp + unittest/test_read_fasta.cpp + unittest/test_timer.cpp +) + +set_source_files_properties(${sources} ${test_sources} evaluation/main.cpp PROPERTIES LANGUAGE CUDA LINKER_LANGUAGE CUDA @@ -38,6 +44,9 @@ endif() add_executable(program_gpu evaluation/main.cpp) target_link_libraries(program_gpu PRIVATE gpu_bsw) +add_executable(unittest ${test_sources}) +target_link_libraries(unittest PRIVATE gpu_bsw) + add_custom_target( regression_tests ALL COMMAND ${CMAKE_COMMAND} -E make_directory ${CMAKE_BINARY_DIR}/regression_test diff --git a/unittest/doctest.h b/unittest/doctest.h new file mode 100644 index 0000000..9444698 --- /dev/null +++ b/unittest/doctest.h @@ -0,0 +1,6205 @@ +// ====================================================================== lgtm [cpp/missing-header-guard] +// == DO NOT MODIFY THIS FILE BY HAND - IT IS AUTO GENERATED BY CMAKE! == +// ====================================================================== +// +// doctest.h - the lightest feature-rich C++ single-header testing framework for unit tests and TDD +// +// Copyright (c) 2016-2019 Viktor Kirilov +// +// Distributed under the MIT Software License +// See accompanying file LICENSE.txt or copy at +// https://opensource.org/licenses/MIT +// +// The documentation can be found at the library's page: +// https://github.com/onqtam/doctest/blob/master/doc/markdown/readme.md +// +// ================================================================================================= +// ================================================================================================= +// ================================================================================================= +// +// The library is heavily influenced by Catch - https://github.com/catchorg/Catch2 +// which uses the Boost Software License - Version 1.0 +// see here - https://github.com/catchorg/Catch2/blob/master/LICENSE.txt +// +// The concept of subcases (sections in Catch) and expression decomposition are from there. +// Some parts of the code are taken directly: +// - stringification - the detection of "ostream& operator<<(ostream&, const T&)" and StringMaker<> +// - the Approx() helper class for floating point comparison +// - colors in the console +// - breaking into a debugger +// - signal / SEH handling +// - timer +// - XmlWriter class - thanks to Phil Nash for allowing the direct reuse (AKA copy/paste) +// +// The expression decomposing templates are taken from lest - https://github.com/martinmoene/lest +// which uses the Boost Software License - Version 1.0 +// see here - https://github.com/martinmoene/lest/blob/master/LICENSE.txt +// +// ================================================================================================= +// ================================================================================================= +// ================================================================================================= + +#ifndef DOCTEST_LIBRARY_INCLUDED +#define DOCTEST_LIBRARY_INCLUDED + +// ================================================================================================= +// == VERSION ====================================================================================== +// ================================================================================================= + +#define DOCTEST_VERSION_MAJOR 2 +#define DOCTEST_VERSION_MINOR 4 +#define DOCTEST_VERSION_PATCH 0 +#define DOCTEST_VERSION_STR "2.4.0" + +#define DOCTEST_VERSION \ + (DOCTEST_VERSION_MAJOR * 10000 + DOCTEST_VERSION_MINOR * 100 + DOCTEST_VERSION_PATCH) + +// ================================================================================================= +// == COMPILER VERSION ============================================================================= +// ================================================================================================= + +// ideas for the version stuff are taken from here: https://github.com/cxxstuff/cxx_detect + +#define DOCTEST_COMPILER(MAJOR, MINOR, PATCH) ((MAJOR)*10000000 + (MINOR)*100000 + (PATCH)) + +// GCC/Clang and GCC/MSVC are mutually exclusive, but Clang/MSVC are not because of clang-cl... +#if defined(_MSC_VER) && defined(_MSC_FULL_VER) +#if _MSC_VER == _MSC_FULL_VER / 10000 +#define DOCTEST_MSVC DOCTEST_COMPILER(_MSC_VER / 100, _MSC_VER % 100, _MSC_FULL_VER % 10000) +#else // MSVC +#define DOCTEST_MSVC \ + DOCTEST_COMPILER(_MSC_VER / 100, (_MSC_FULL_VER / 100000) % 100, _MSC_FULL_VER % 100000) +#endif // MSVC +#endif // MSVC +#if defined(__clang__) && defined(__clang_minor__) +#define DOCTEST_CLANG DOCTEST_COMPILER(__clang_major__, __clang_minor__, __clang_patchlevel__) +#elif defined(__GNUC__) && defined(__GNUC_MINOR__) && defined(__GNUC_PATCHLEVEL__) && \ + !defined(__INTEL_COMPILER) +#define DOCTEST_GCC DOCTEST_COMPILER(__GNUC__, __GNUC_MINOR__, __GNUC_PATCHLEVEL__) +#endif // GCC + +#ifndef DOCTEST_MSVC +#define DOCTEST_MSVC 0 +#endif // DOCTEST_MSVC +#ifndef DOCTEST_CLANG +#define DOCTEST_CLANG 0 +#endif // DOCTEST_CLANG +#ifndef DOCTEST_GCC +#define DOCTEST_GCC 0 +#endif // DOCTEST_GCC + +// ================================================================================================= +// == COMPILER WARNINGS HELPERS ==================================================================== +// ================================================================================================= + +#if DOCTEST_CLANG +#define DOCTEST_PRAGMA_TO_STR(x) _Pragma(#x) +#define DOCTEST_CLANG_SUPPRESS_WARNING_PUSH _Pragma("clang diagnostic push") +#define DOCTEST_CLANG_SUPPRESS_WARNING(w) DOCTEST_PRAGMA_TO_STR(clang diagnostic ignored w) +#define DOCTEST_CLANG_SUPPRESS_WARNING_POP _Pragma("clang diagnostic pop") +#define DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH(w) \ + DOCTEST_CLANG_SUPPRESS_WARNING_PUSH DOCTEST_CLANG_SUPPRESS_WARNING(w) +#else // DOCTEST_CLANG +#define DOCTEST_CLANG_SUPPRESS_WARNING_PUSH +#define DOCTEST_CLANG_SUPPRESS_WARNING(w) +#define DOCTEST_CLANG_SUPPRESS_WARNING_POP +#define DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH(w) +#endif // DOCTEST_CLANG + +#if DOCTEST_GCC +#define DOCTEST_PRAGMA_TO_STR(x) _Pragma(#x) +#define DOCTEST_GCC_SUPPRESS_WARNING_PUSH _Pragma("GCC diagnostic push") +#define DOCTEST_GCC_SUPPRESS_WARNING(w) DOCTEST_PRAGMA_TO_STR(GCC diagnostic ignored w) +#define DOCTEST_GCC_SUPPRESS_WARNING_POP _Pragma("GCC diagnostic pop") +#define DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH(w) \ + DOCTEST_GCC_SUPPRESS_WARNING_PUSH DOCTEST_GCC_SUPPRESS_WARNING(w) +#else // DOCTEST_GCC +#define DOCTEST_GCC_SUPPRESS_WARNING_PUSH +#define DOCTEST_GCC_SUPPRESS_WARNING(w) +#define DOCTEST_GCC_SUPPRESS_WARNING_POP +#define DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH(w) +#endif // DOCTEST_GCC + +#if DOCTEST_MSVC +#define DOCTEST_MSVC_SUPPRESS_WARNING_PUSH __pragma(warning(push)) +#define DOCTEST_MSVC_SUPPRESS_WARNING(w) __pragma(warning(disable : w)) +#define DOCTEST_MSVC_SUPPRESS_WARNING_POP __pragma(warning(pop)) +#define DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(w) \ + DOCTEST_MSVC_SUPPRESS_WARNING_PUSH DOCTEST_MSVC_SUPPRESS_WARNING(w) +#else // DOCTEST_MSVC +#define DOCTEST_MSVC_SUPPRESS_WARNING_PUSH +#define DOCTEST_MSVC_SUPPRESS_WARNING(w) +#define DOCTEST_MSVC_SUPPRESS_WARNING_POP +#define DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(w) +#endif // DOCTEST_MSVC + +// ================================================================================================= +// == COMPILER WARNINGS ============================================================================ +// ================================================================================================= + +DOCTEST_CLANG_SUPPRESS_WARNING_PUSH +DOCTEST_CLANG_SUPPRESS_WARNING("-Wunknown-pragmas") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wnon-virtual-dtor") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wweak-vtables") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wpadded") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wdeprecated") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-prototypes") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wunused-local-typedef") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wc++98-compat") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wc++98-compat-pedantic") + +DOCTEST_GCC_SUPPRESS_WARNING_PUSH +DOCTEST_GCC_SUPPRESS_WARNING("-Wunknown-pragmas") +DOCTEST_GCC_SUPPRESS_WARNING("-Wpragmas") +DOCTEST_GCC_SUPPRESS_WARNING("-Weffc++") +DOCTEST_GCC_SUPPRESS_WARNING("-Wstrict-overflow") +DOCTEST_GCC_SUPPRESS_WARNING("-Wstrict-aliasing") +DOCTEST_GCC_SUPPRESS_WARNING("-Wctor-dtor-privacy") +DOCTEST_GCC_SUPPRESS_WARNING("-Wmissing-declarations") +DOCTEST_GCC_SUPPRESS_WARNING("-Wnon-virtual-dtor") +DOCTEST_GCC_SUPPRESS_WARNING("-Wunused-local-typedefs") +DOCTEST_GCC_SUPPRESS_WARNING("-Wuseless-cast") +DOCTEST_GCC_SUPPRESS_WARNING("-Wnoexcept") +DOCTEST_GCC_SUPPRESS_WARNING("-Wsign-promo") + +DOCTEST_MSVC_SUPPRESS_WARNING_PUSH +DOCTEST_MSVC_SUPPRESS_WARNING(4616) // invalid compiler warning +DOCTEST_MSVC_SUPPRESS_WARNING(4619) // invalid compiler warning +DOCTEST_MSVC_SUPPRESS_WARNING(4996) // The compiler encountered a deprecated declaration +DOCTEST_MSVC_SUPPRESS_WARNING(4706) // assignment within conditional expression +DOCTEST_MSVC_SUPPRESS_WARNING(4512) // 'class' : assignment operator could not be generated +DOCTEST_MSVC_SUPPRESS_WARNING(4127) // conditional expression is constant +DOCTEST_MSVC_SUPPRESS_WARNING(4820) // padding +DOCTEST_MSVC_SUPPRESS_WARNING(4625) // copy constructor was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(4626) // assignment operator was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(5027) // move assignment operator was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(5026) // move constructor was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(4623) // default constructor was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(4640) // construction of local static object is not thread-safe +// static analysis +DOCTEST_MSVC_SUPPRESS_WARNING(26439) // This kind of function may not throw. Declare it 'noexcept' +DOCTEST_MSVC_SUPPRESS_WARNING(26495) // Always initialize a member variable +DOCTEST_MSVC_SUPPRESS_WARNING(26451) // Arithmetic overflow ... +DOCTEST_MSVC_SUPPRESS_WARNING(26444) // Avoid unnamed objects with custom construction and dtr... +DOCTEST_MSVC_SUPPRESS_WARNING(26812) // Prefer 'enum class' over 'enum' + +// 4548 - expression before comma has no effect; expected expression with side - effect +// 4265 - class has virtual functions, but destructor is not virtual +// 4986 - exception specification does not match previous declaration +// 4350 - behavior change: 'member1' called instead of 'member2' +// 4668 - 'x' is not defined as a preprocessor macro, replacing with '0' for '#if/#elif' +// 4365 - conversion from 'int' to 'unsigned long', signed/unsigned mismatch +// 4774 - format string expected in argument 'x' is not a string literal +// 4820 - padding in structs + +// only 4 should be disabled globally: +// - 4514 # unreferenced inline function has been removed +// - 4571 # SEH related +// - 4710 # function not inlined +// - 4711 # function 'x' selected for automatic inline expansion + +#define DOCTEST_MAKE_STD_HEADERS_CLEAN_FROM_WARNINGS_ON_WALL_BEGIN \ + DOCTEST_MSVC_SUPPRESS_WARNING_PUSH \ + DOCTEST_MSVC_SUPPRESS_WARNING(4548) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4265) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4986) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4350) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4668) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4365) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4774) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4820) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4625) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4626) \ + DOCTEST_MSVC_SUPPRESS_WARNING(5027) \ + DOCTEST_MSVC_SUPPRESS_WARNING(5026) \ + DOCTEST_MSVC_SUPPRESS_WARNING(4623) \ + DOCTEST_MSVC_SUPPRESS_WARNING(5039) \ + DOCTEST_MSVC_SUPPRESS_WARNING(5045) \ + DOCTEST_MSVC_SUPPRESS_WARNING(5105) + +#define DOCTEST_MAKE_STD_HEADERS_CLEAN_FROM_WARNINGS_ON_WALL_END DOCTEST_MSVC_SUPPRESS_WARNING_POP + +// ================================================================================================= +// == FEATURE DETECTION ============================================================================ +// ================================================================================================= + +// general compiler feature support table: https://en.cppreference.com/w/cpp/compiler_support +// MSVC C++11 feature support table: https://msdn.microsoft.com/en-us/library/hh567368.aspx +// GCC C++11 feature support table: https://gcc.gnu.org/projects/cxx-status.html +// MSVC version table: +// https://en.wikipedia.org/wiki/Microsoft_Visual_C%2B%2B#Internal_version_numbering +// MSVC++ 14.2 (16) _MSC_VER == 1920 (Visual Studio 2019) +// MSVC++ 14.1 (15) _MSC_VER == 1910 (Visual Studio 2017) +// MSVC++ 14.0 _MSC_VER == 1900 (Visual Studio 2015) +// MSVC++ 12.0 _MSC_VER == 1800 (Visual Studio 2013) +// MSVC++ 11.0 _MSC_VER == 1700 (Visual Studio 2012) +// MSVC++ 10.0 _MSC_VER == 1600 (Visual Studio 2010) +// MSVC++ 9.0 _MSC_VER == 1500 (Visual Studio 2008) +// MSVC++ 8.0 _MSC_VER == 1400 (Visual Studio 2005) + +#if DOCTEST_MSVC && !defined(DOCTEST_CONFIG_WINDOWS_SEH) +#define DOCTEST_CONFIG_WINDOWS_SEH +#endif // MSVC +#if defined(DOCTEST_CONFIG_NO_WINDOWS_SEH) && defined(DOCTEST_CONFIG_WINDOWS_SEH) +#undef DOCTEST_CONFIG_WINDOWS_SEH +#endif // DOCTEST_CONFIG_NO_WINDOWS_SEH + +#if !defined(_WIN32) && !defined(__QNX__) && !defined(DOCTEST_CONFIG_POSIX_SIGNALS) && \ + !defined(__EMSCRIPTEN__) +#define DOCTEST_CONFIG_POSIX_SIGNALS +#endif // _WIN32 +#if defined(DOCTEST_CONFIG_NO_POSIX_SIGNALS) && defined(DOCTEST_CONFIG_POSIX_SIGNALS) +#undef DOCTEST_CONFIG_POSIX_SIGNALS +#endif // DOCTEST_CONFIG_NO_POSIX_SIGNALS + +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS +#if !defined(__cpp_exceptions) && !defined(__EXCEPTIONS) && !defined(_CPPUNWIND) +#define DOCTEST_CONFIG_NO_EXCEPTIONS +#endif // no exceptions +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + +#ifdef DOCTEST_CONFIG_NO_EXCEPTIONS_BUT_WITH_ALL_ASSERTS +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS +#define DOCTEST_CONFIG_NO_EXCEPTIONS +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS_BUT_WITH_ALL_ASSERTS + +#if defined(DOCTEST_CONFIG_NO_EXCEPTIONS) && !defined(DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS) +#define DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS && !DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS + +#if defined(DOCTEST_CONFIG_IMPLEMENT_WITH_MAIN) && !defined(DOCTEST_CONFIG_IMPLEMENT) +#define DOCTEST_CONFIG_IMPLEMENT +#endif // DOCTEST_CONFIG_IMPLEMENT_WITH_MAIN + +#if defined(_WIN32) || defined(__CYGWIN__) +#if DOCTEST_MSVC +#define DOCTEST_SYMBOL_EXPORT __declspec(dllexport) +#define DOCTEST_SYMBOL_IMPORT __declspec(dllimport) +#else // MSVC +#define DOCTEST_SYMBOL_EXPORT __attribute__((dllexport)) +#define DOCTEST_SYMBOL_IMPORT __attribute__((dllimport)) +#endif // MSVC +#else // _WIN32 +#define DOCTEST_SYMBOL_EXPORT __attribute__((visibility("default"))) +#define DOCTEST_SYMBOL_IMPORT +#endif // _WIN32 + +#ifdef DOCTEST_CONFIG_IMPLEMENTATION_IN_DLL +#ifdef DOCTEST_CONFIG_IMPLEMENT +#define DOCTEST_INTERFACE DOCTEST_SYMBOL_EXPORT +#else // DOCTEST_CONFIG_IMPLEMENT +#define DOCTEST_INTERFACE DOCTEST_SYMBOL_IMPORT +#endif // DOCTEST_CONFIG_IMPLEMENT +#else // DOCTEST_CONFIG_IMPLEMENTATION_IN_DLL +#define DOCTEST_INTERFACE +#endif // DOCTEST_CONFIG_IMPLEMENTATION_IN_DLL + +#define DOCTEST_EMPTY + +#if DOCTEST_MSVC +#define DOCTEST_NOINLINE __declspec(noinline) +#define DOCTEST_UNUSED +#define DOCTEST_ALIGNMENT(x) +#else // MSVC +#define DOCTEST_NOINLINE __attribute__((noinline)) +#define DOCTEST_UNUSED __attribute__((unused)) +#define DOCTEST_ALIGNMENT(x) __attribute__((aligned(x))) +#endif // MSVC + +#ifndef DOCTEST_NORETURN +#define DOCTEST_NORETURN [[noreturn]] +#endif // DOCTEST_NORETURN + +#ifndef DOCTEST_NOEXCEPT +#define DOCTEST_NOEXCEPT noexcept +#endif // DOCTEST_NOEXCEPT + +// ================================================================================================= +// == FEATURE DETECTION END ======================================================================== +// ================================================================================================= + +// internal macros for string concatenation and anonymous variable name generation +#define DOCTEST_CAT_IMPL(s1, s2) s1##s2 +#define DOCTEST_CAT(s1, s2) DOCTEST_CAT_IMPL(s1, s2) +#ifdef __COUNTER__ // not standard and may be missing for some compilers +#define DOCTEST_ANONYMOUS(x) DOCTEST_CAT(x, __COUNTER__) +#else // __COUNTER__ +#define DOCTEST_ANONYMOUS(x) DOCTEST_CAT(x, __LINE__) +#endif // __COUNTER__ + +#define DOCTEST_TOSTR(x) #x + +#ifndef DOCTEST_CONFIG_ASSERTION_PARAMETERS_BY_VALUE +#define DOCTEST_REF_WRAP(x) x& +#else // DOCTEST_CONFIG_ASSERTION_PARAMETERS_BY_VALUE +#define DOCTEST_REF_WRAP(x) x +#endif // DOCTEST_CONFIG_ASSERTION_PARAMETERS_BY_VALUE + +// not using __APPLE__ because... this is how Catch does it +#ifdef __MAC_OS_X_VERSION_MIN_REQUIRED +#define DOCTEST_PLATFORM_MAC +#elif defined(__IPHONE_OS_VERSION_MIN_REQUIRED) +#define DOCTEST_PLATFORM_IPHONE +#elif defined(_WIN32) +#define DOCTEST_PLATFORM_WINDOWS +#else // DOCTEST_PLATFORM +#define DOCTEST_PLATFORM_LINUX +#endif // DOCTEST_PLATFORM + +#define DOCTEST_GLOBAL_NO_WARNINGS(var) \ + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wglobal-constructors") \ + DOCTEST_CLANG_SUPPRESS_WARNING("-Wunused-variable") \ + static int var DOCTEST_UNUSED // NOLINT(fuchsia-statically-constructed-objects,cert-err58-cpp) +#define DOCTEST_GLOBAL_NO_WARNINGS_END() DOCTEST_CLANG_SUPPRESS_WARNING_POP + +#ifndef DOCTEST_BREAK_INTO_DEBUGGER +// should probably take a look at https://github.com/scottt/debugbreak +#ifdef DOCTEST_PLATFORM_MAC +#define DOCTEST_BREAK_INTO_DEBUGGER() __asm__("int $3\n" : :) +#elif DOCTEST_MSVC +#define DOCTEST_BREAK_INTO_DEBUGGER() __debugbreak() +#elif defined(__MINGW32__) +DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wredundant-decls") +extern "C" __declspec(dllimport) void __stdcall DebugBreak(); +DOCTEST_GCC_SUPPRESS_WARNING_POP +#define DOCTEST_BREAK_INTO_DEBUGGER() ::DebugBreak() +#else // linux +#define DOCTEST_BREAK_INTO_DEBUGGER() ((void)0) +#endif // linux +#endif // DOCTEST_BREAK_INTO_DEBUGGER + +// this is kept here for backwards compatibility since the config option was changed +#ifdef DOCTEST_CONFIG_USE_IOSFWD +#define DOCTEST_CONFIG_USE_STD_HEADERS +#endif // DOCTEST_CONFIG_USE_IOSFWD + +#ifdef DOCTEST_CONFIG_USE_STD_HEADERS +#include +#include +#include +#else // DOCTEST_CONFIG_USE_STD_HEADERS + +#if DOCTEST_CLANG +// to detect if libc++ is being used with clang (the _LIBCPP_VERSION identifier) +#include +#endif // clang + +#ifdef _LIBCPP_VERSION +#define DOCTEST_STD_NAMESPACE_BEGIN _LIBCPP_BEGIN_NAMESPACE_STD +#define DOCTEST_STD_NAMESPACE_END _LIBCPP_END_NAMESPACE_STD +#else // _LIBCPP_VERSION +#define DOCTEST_STD_NAMESPACE_BEGIN namespace std { +#define DOCTEST_STD_NAMESPACE_END } +#endif // _LIBCPP_VERSION + +// Forward declaring 'X' in namespace std is not permitted by the C++ Standard. +DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4643) + +DOCTEST_STD_NAMESPACE_BEGIN // NOLINT (cert-dcl58-cpp) +typedef decltype(nullptr) nullptr_t; +template +struct char_traits; +template <> +struct char_traits; +template +class basic_ostream; +typedef basic_ostream> ostream; +template +class tuple; +#if DOCTEST_MSVC >= DOCTEST_COMPILER(19, 20, 0) +// see this issue on why this is needed: https://github.com/onqtam/doctest/issues/183 +template +class allocator; +template +class basic_string; +using string = basic_string, allocator>; +#endif // VS 2019 +DOCTEST_STD_NAMESPACE_END + +DOCTEST_MSVC_SUPPRESS_WARNING_POP + +#endif // DOCTEST_CONFIG_USE_STD_HEADERS + +#ifdef DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS +#include +#endif // DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + +namespace doctest { + +DOCTEST_INTERFACE extern bool is_running_in_test; + +// A 24 byte string class (can be as small as 17 for x64 and 13 for x86) that can hold strings with length +// of up to 23 chars on the stack before going on the heap - the last byte of the buffer is used for: +// - "is small" bit - the highest bit - if "0" then it is small - otherwise its "1" (128) +// - if small - capacity left before going on the heap - using the lowest 5 bits +// - if small - 2 bits are left unused - the second and third highest ones +// - if small - acts as a null terminator if strlen() is 23 (24 including the null terminator) +// and the "is small" bit remains "0" ("as well as the capacity left") so its OK +// Idea taken from this lecture about the string implementation of facebook/folly - fbstring +// https://www.youtube.com/watch?v=kPR8h4-qZdk +// TODO: +// - optimizations - like not deleting memory unnecessarily in operator= and etc. +// - resize/reserve/clear +// - substr +// - replace +// - back/front +// - iterator stuff +// - find & friends +// - push_back/pop_back +// - assign/insert/erase +// - relational operators as free functions - taking const char* as one of the params +class DOCTEST_INTERFACE String +{ + static const unsigned len = 24; //!OCLINT avoid private static members + static const unsigned last = len - 1; //!OCLINT avoid private static members + + struct view // len should be more than sizeof(view) - because of the final byte for flags + { + char* ptr; + unsigned size; + unsigned capacity; + }; + + union + { + char buf[len]; + view data; + }; + + bool isOnStack() const { return (buf[last] & 128) == 0; } + void setOnHeap(); + void setLast(unsigned in = last); + + void copy(const String& other); + +public: + String(); + ~String(); + + // cppcheck-suppress noExplicitConstructor + String(const char* in); + String(const char* in, unsigned in_size); + + String(const String& other); + String& operator=(const String& other); + + String& operator+=(const String& other); + String operator+(const String& other) const; + + String(String&& other); + String& operator=(String&& other); + + char operator[](unsigned i) const; + char& operator[](unsigned i); + + // the only functions I'm willing to leave in the interface - available for inlining + const char* c_str() const { return const_cast(this)->c_str(); } // NOLINT + char* c_str() { + if(isOnStack()) + return reinterpret_cast(buf); + return data.ptr; + } + + unsigned size() const; + unsigned capacity() const; + + int compare(const char* other, bool no_case = false) const; + int compare(const String& other, bool no_case = false) const; +}; + +DOCTEST_INTERFACE bool operator==(const String& lhs, const String& rhs); +DOCTEST_INTERFACE bool operator!=(const String& lhs, const String& rhs); +DOCTEST_INTERFACE bool operator<(const String& lhs, const String& rhs); +DOCTEST_INTERFACE bool operator>(const String& lhs, const String& rhs); +DOCTEST_INTERFACE bool operator<=(const String& lhs, const String& rhs); +DOCTEST_INTERFACE bool operator>=(const String& lhs, const String& rhs); + +DOCTEST_INTERFACE std::ostream& operator<<(std::ostream& s, const String& in); + +namespace Color { + enum Enum + { + None = 0, + White, + Red, + Green, + Blue, + Cyan, + Yellow, + Grey, + + Bright = 0x10, + + BrightRed = Bright | Red, + BrightGreen = Bright | Green, + LightGrey = Bright | Grey, + BrightWhite = Bright | White + }; + + DOCTEST_INTERFACE std::ostream& operator<<(std::ostream& s, Color::Enum code); +} // namespace Color + +namespace assertType { + enum Enum + { + // macro traits + + is_warn = 1, + is_check = 2 * is_warn, + is_require = 2 * is_check, + + is_normal = 2 * is_require, + is_throws = 2 * is_normal, + is_throws_as = 2 * is_throws, + is_throws_with = 2 * is_throws_as, + is_nothrow = 2 * is_throws_with, + + is_false = 2 * is_nothrow, + is_unary = 2 * is_false, // not checked anywhere - used just to distinguish the types + + is_eq = 2 * is_unary, + is_ne = 2 * is_eq, + + is_lt = 2 * is_ne, + is_gt = 2 * is_lt, + + is_ge = 2 * is_gt, + is_le = 2 * is_ge, + + // macro types + + DT_WARN = is_normal | is_warn, + DT_CHECK = is_normal | is_check, + DT_REQUIRE = is_normal | is_require, + + DT_WARN_FALSE = is_normal | is_false | is_warn, + DT_CHECK_FALSE = is_normal | is_false | is_check, + DT_REQUIRE_FALSE = is_normal | is_false | is_require, + + DT_WARN_THROWS = is_throws | is_warn, + DT_CHECK_THROWS = is_throws | is_check, + DT_REQUIRE_THROWS = is_throws | is_require, + + DT_WARN_THROWS_AS = is_throws_as | is_warn, + DT_CHECK_THROWS_AS = is_throws_as | is_check, + DT_REQUIRE_THROWS_AS = is_throws_as | is_require, + + DT_WARN_THROWS_WITH = is_throws_with | is_warn, + DT_CHECK_THROWS_WITH = is_throws_with | is_check, + DT_REQUIRE_THROWS_WITH = is_throws_with | is_require, + + DT_WARN_THROWS_WITH_AS = is_throws_with | is_throws_as | is_warn, + DT_CHECK_THROWS_WITH_AS = is_throws_with | is_throws_as | is_check, + DT_REQUIRE_THROWS_WITH_AS = is_throws_with | is_throws_as | is_require, + + DT_WARN_NOTHROW = is_nothrow | is_warn, + DT_CHECK_NOTHROW = is_nothrow | is_check, + DT_REQUIRE_NOTHROW = is_nothrow | is_require, + + DT_WARN_EQ = is_normal | is_eq | is_warn, + DT_CHECK_EQ = is_normal | is_eq | is_check, + DT_REQUIRE_EQ = is_normal | is_eq | is_require, + + DT_WARN_NE = is_normal | is_ne | is_warn, + DT_CHECK_NE = is_normal | is_ne | is_check, + DT_REQUIRE_NE = is_normal | is_ne | is_require, + + DT_WARN_GT = is_normal | is_gt | is_warn, + DT_CHECK_GT = is_normal | is_gt | is_check, + DT_REQUIRE_GT = is_normal | is_gt | is_require, + + DT_WARN_LT = is_normal | is_lt | is_warn, + DT_CHECK_LT = is_normal | is_lt | is_check, + DT_REQUIRE_LT = is_normal | is_lt | is_require, + + DT_WARN_GE = is_normal | is_ge | is_warn, + DT_CHECK_GE = is_normal | is_ge | is_check, + DT_REQUIRE_GE = is_normal | is_ge | is_require, + + DT_WARN_LE = is_normal | is_le | is_warn, + DT_CHECK_LE = is_normal | is_le | is_check, + DT_REQUIRE_LE = is_normal | is_le | is_require, + + DT_WARN_UNARY = is_normal | is_unary | is_warn, + DT_CHECK_UNARY = is_normal | is_unary | is_check, + DT_REQUIRE_UNARY = is_normal | is_unary | is_require, + + DT_WARN_UNARY_FALSE = is_normal | is_false | is_unary | is_warn, + DT_CHECK_UNARY_FALSE = is_normal | is_false | is_unary | is_check, + DT_REQUIRE_UNARY_FALSE = is_normal | is_false | is_unary | is_require, + }; +} // namespace assertType + +DOCTEST_INTERFACE const char* assertString(assertType::Enum at); +DOCTEST_INTERFACE const char* failureString(assertType::Enum at); +DOCTEST_INTERFACE const char* skipPathFromFilename(const char* file); + +struct DOCTEST_INTERFACE TestCaseData +{ + String m_file; // the file in which the test was registered + unsigned m_line; // the line where the test was registered + const char* m_name; // name of the test case + const char* m_test_suite; // the test suite in which the test was added + const char* m_description; + bool m_skip; + bool m_may_fail; + bool m_should_fail; + int m_expected_failures; + double m_timeout; +}; + +struct DOCTEST_INTERFACE AssertData +{ + // common - for all asserts + const TestCaseData* m_test_case; + assertType::Enum m_at; + const char* m_file; + int m_line; + const char* m_expr; + bool m_failed; + + // exception-related - for all asserts + bool m_threw; + String m_exception; + + // for normal asserts + String m_decomp; + + // for specific exception-related asserts + bool m_threw_as; + const char* m_exception_type; + const char* m_exception_string; +}; + +struct DOCTEST_INTERFACE MessageData +{ + String m_string; + const char* m_file; + int m_line; + assertType::Enum m_severity; +}; + +struct DOCTEST_INTERFACE SubcaseSignature +{ + String m_name; + const char* m_file; + int m_line; + + bool operator<(const SubcaseSignature& other) const; +}; + +struct DOCTEST_INTERFACE IContextScope +{ + IContextScope(); + virtual ~IContextScope(); + virtual void stringify(std::ostream*) const = 0; +}; + +struct ContextOptions //!OCLINT too many fields +{ + std::ostream* cout; // stdout stream - std::cout by default + std::ostream* cerr; // stderr stream - std::cerr by default + String binary_name; // the test binary name + + // == parameters from the command line + String out; // output filename + String order_by; // how tests should be ordered + unsigned rand_seed; // the seed for rand ordering + + unsigned first; // the first (matching) test to be executed + unsigned last; // the last (matching) test to be executed + + int abort_after; // stop tests after this many failed assertions + int subcase_filter_levels; // apply the subcase filters for the first N levels + + bool success; // include successful assertions in output + bool case_sensitive; // if filtering should be case sensitive + bool exit; // if the program should be exited after the tests are ran/whatever + bool duration; // print the time duration of each test case + bool no_throw; // to skip exceptions-related assertion macros + bool no_exitcode; // if the framework should return 0 as the exitcode + bool no_run; // to not run the tests at all (can be done with an "*" exclude) + bool no_version; // to not print the version of the framework + bool no_colors; // if output to the console should be colorized + bool force_colors; // forces the use of colors even when a tty cannot be detected + bool no_breaks; // to not break into the debugger + bool no_skip; // don't skip test cases which are marked to be skipped + bool gnu_file_line; // if line numbers should be surrounded with :x: and not (x): + bool no_path_in_filenames; // if the path to files should be removed from the output + bool no_line_numbers; // if source code line numbers should be omitted from the output + bool no_skipped_summary; // don't print "skipped" in the summary !!! UNDOCUMENTED !!! + bool no_time_in_output; // omit any time/timestamps from output !!! UNDOCUMENTED !!! + + bool help; // to print the help + bool version; // to print the version + bool count; // if only the count of matching tests is to be retrieved + bool list_test_cases; // to list all tests matching the filters + bool list_test_suites; // to list all suites matching the filters + bool list_reporters; // lists all registered reporters +}; + +namespace detail { +#if defined(DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING) || defined(DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS) + template + struct enable_if + {}; + + template + struct enable_if + { typedef TYPE type; }; +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING) || DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + + // clang-format off + template struct remove_reference { typedef T type; }; + template struct remove_reference { typedef T type; }; + template struct remove_reference { typedef T type; }; + + template struct remove_const { typedef T type; }; + template struct remove_const { typedef T type; }; + // clang-format on + + template + struct deferred_false + // cppcheck-suppress unusedStructMember + { static const bool value = false; }; + + namespace has_insertion_operator_impl { + std::ostream &os(); + template + DOCTEST_REF_WRAP(T) val(); + + template + struct check { + static constexpr auto value = false; + }; + + template + struct check(), void())> { + static constexpr auto value = true; + }; + } // namespace has_insertion_operator_impl + + template + using has_insertion_operator = has_insertion_operator_impl::check; + + DOCTEST_INTERFACE void my_memcpy(void* dest, const void* src, unsigned num); + + DOCTEST_INTERFACE std::ostream* getTlsOss(); // returns a thread-local ostringstream + DOCTEST_INTERFACE String getTlsOssResult(); + + template + struct StringMakerBase + { + template + static String convert(const DOCTEST_REF_WRAP(T)) { + return "{?}"; + } + }; + + template <> + struct StringMakerBase + { + template + static String convert(const DOCTEST_REF_WRAP(T) in) { + *getTlsOss() << in; + return getTlsOssResult(); + } + }; + + DOCTEST_INTERFACE String rawMemoryToString(const void* object, unsigned size); + + template + String rawMemoryToString(const DOCTEST_REF_WRAP(T) object) { + return rawMemoryToString(&object, sizeof(object)); + } + + template + const char* type_to_string() { + return "<>"; + } +} // namespace detail + +template +struct StringMaker : public detail::StringMakerBase::value> +{}; + +template +struct StringMaker +{ + template + static String convert(U* p) { + if(p) + return detail::rawMemoryToString(p); + return "NULL"; + } +}; + +template +struct StringMaker +{ + static String convert(R C::*p) { + if(p) + return detail::rawMemoryToString(p); + return "NULL"; + } +}; + +template +String toString(const DOCTEST_REF_WRAP(T) value) { + return StringMaker::convert(value); +} + +#ifdef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +DOCTEST_INTERFACE String toString(char* in); +DOCTEST_INTERFACE String toString(const char* in); +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +DOCTEST_INTERFACE String toString(bool in); +DOCTEST_INTERFACE String toString(float in); +DOCTEST_INTERFACE String toString(double in); +DOCTEST_INTERFACE String toString(double long in); + +DOCTEST_INTERFACE String toString(char in); +DOCTEST_INTERFACE String toString(char signed in); +DOCTEST_INTERFACE String toString(char unsigned in); +DOCTEST_INTERFACE String toString(int short in); +DOCTEST_INTERFACE String toString(int short unsigned in); +DOCTEST_INTERFACE String toString(int in); +DOCTEST_INTERFACE String toString(int unsigned in); +DOCTEST_INTERFACE String toString(int long in); +DOCTEST_INTERFACE String toString(int long unsigned in); +DOCTEST_INTERFACE String toString(int long long in); +DOCTEST_INTERFACE String toString(int long long unsigned in); +DOCTEST_INTERFACE String toString(std::nullptr_t in); + +#if DOCTEST_MSVC >= DOCTEST_COMPILER(19, 20, 0) +// see this issue on why this is needed: https://github.com/onqtam/doctest/issues/183 +DOCTEST_INTERFACE String toString(const std::string& in); +#endif // VS 2019 + +class DOCTEST_INTERFACE Approx +{ +public: + explicit Approx(double value); + + Approx operator()(double value) const; + +#ifdef DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + template + explicit Approx(const T& value, + typename detail::enable_if::value>::type* = + static_cast(nullptr)) { + *this = Approx(static_cast(value)); + } +#endif // DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + + Approx& epsilon(double newEpsilon); + +#ifdef DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + template + typename detail::enable_if::value, Approx&>::type epsilon( + const T& newEpsilon) { + m_epsilon = static_cast(newEpsilon); + return *this; + } +#endif // DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + + Approx& scale(double newScale); + +#ifdef DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + template + typename detail::enable_if::value, Approx&>::type scale( + const T& newScale) { + m_scale = static_cast(newScale); + return *this; + } +#endif // DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + + // clang-format off + DOCTEST_INTERFACE friend bool operator==(double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator==(const Approx & lhs, double rhs); + DOCTEST_INTERFACE friend bool operator!=(double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator!=(const Approx & lhs, double rhs); + DOCTEST_INTERFACE friend bool operator<=(double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator<=(const Approx & lhs, double rhs); + DOCTEST_INTERFACE friend bool operator>=(double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator>=(const Approx & lhs, double rhs); + DOCTEST_INTERFACE friend bool operator< (double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator< (const Approx & lhs, double rhs); + DOCTEST_INTERFACE friend bool operator> (double lhs, const Approx & rhs); + DOCTEST_INTERFACE friend bool operator> (const Approx & lhs, double rhs); + + DOCTEST_INTERFACE friend String toString(const Approx& in); + +#ifdef DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS +#define DOCTEST_APPROX_PREFIX \ + template friend typename detail::enable_if::value, bool>::type + + DOCTEST_APPROX_PREFIX operator==(const T& lhs, const Approx& rhs) { return operator==(double(lhs), rhs); } + DOCTEST_APPROX_PREFIX operator==(const Approx& lhs, const T& rhs) { return operator==(rhs, lhs); } + DOCTEST_APPROX_PREFIX operator!=(const T& lhs, const Approx& rhs) { return !operator==(lhs, rhs); } + DOCTEST_APPROX_PREFIX operator!=(const Approx& lhs, const T& rhs) { return !operator==(rhs, lhs); } + DOCTEST_APPROX_PREFIX operator<=(const T& lhs, const Approx& rhs) { return double(lhs) < rhs.m_value || lhs == rhs; } + DOCTEST_APPROX_PREFIX operator<=(const Approx& lhs, const T& rhs) { return lhs.m_value < double(rhs) || lhs == rhs; } + DOCTEST_APPROX_PREFIX operator>=(const T& lhs, const Approx& rhs) { return double(lhs) > rhs.m_value || lhs == rhs; } + DOCTEST_APPROX_PREFIX operator>=(const Approx& lhs, const T& rhs) { return lhs.m_value > double(rhs) || lhs == rhs; } + DOCTEST_APPROX_PREFIX operator< (const T& lhs, const Approx& rhs) { return double(lhs) < rhs.m_value && lhs != rhs; } + DOCTEST_APPROX_PREFIX operator< (const Approx& lhs, const T& rhs) { return lhs.m_value < double(rhs) && lhs != rhs; } + DOCTEST_APPROX_PREFIX operator> (const T& lhs, const Approx& rhs) { return double(lhs) > rhs.m_value && lhs != rhs; } + DOCTEST_APPROX_PREFIX operator> (const Approx& lhs, const T& rhs) { return lhs.m_value > double(rhs) && lhs != rhs; } +#undef DOCTEST_APPROX_PREFIX +#endif // DOCTEST_CONFIG_INCLUDE_TYPE_TRAITS + + // clang-format on + +private: + double m_epsilon; + double m_scale; + double m_value; +}; + +DOCTEST_INTERFACE String toString(const Approx& in); + +DOCTEST_INTERFACE const ContextOptions* getContextOptions(); + +#if !defined(DOCTEST_CONFIG_DISABLE) + +namespace detail { + // clang-format off +#ifdef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + template struct decay_array { typedef T type; }; + template struct decay_array { typedef T* type; }; + template struct decay_array { typedef T* type; }; + + template struct not_char_pointer { enum { value = 1 }; }; + template<> struct not_char_pointer { enum { value = 0 }; }; + template<> struct not_char_pointer { enum { value = 0 }; }; + + template struct can_use_op : public not_char_pointer::type> {}; +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + // clang-format on + + struct DOCTEST_INTERFACE TestFailureException + { + }; + + DOCTEST_INTERFACE bool checkIfShouldThrow(assertType::Enum at); + +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + DOCTEST_NORETURN +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + DOCTEST_INTERFACE void throwException(); + + struct DOCTEST_INTERFACE Subcase + { + SubcaseSignature m_signature; + bool m_entered = false; + + Subcase(const String& name, const char* file, int line); + ~Subcase(); + + operator bool() const; + }; + + template + String stringifyBinaryExpr(const DOCTEST_REF_WRAP(L) lhs, const char* op, + const DOCTEST_REF_WRAP(R) rhs) { + return toString(lhs) + op + toString(rhs); + } + +#define DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(op, op_str, op_macro) \ + template \ + DOCTEST_NOINLINE Result operator op(const DOCTEST_REF_WRAP(R) rhs) { \ + bool res = op_macro(lhs, rhs); \ + if(m_at & assertType::is_false) \ + res = !res; \ + if(!res || doctest::getContextOptions()->success) \ + return Result(res, stringifyBinaryExpr(lhs, op_str, rhs)); \ + return Result(res); \ + } + + // more checks could be added - like in Catch: + // https://github.com/catchorg/Catch2/pull/1480/files + // https://github.com/catchorg/Catch2/pull/1481/files +#define DOCTEST_FORBIT_EXPRESSION(rt, op) \ + template \ + rt& operator op(const R&) { \ + static_assert(deferred_false::value, \ + "Expression Too Complex Please Rewrite As Binary Comparison!"); \ + return *this; \ + } + + struct DOCTEST_INTERFACE Result + { + bool m_passed; + String m_decomp; + + Result(bool passed, const String& decomposition = String()); + + // forbidding some expressions based on this table: https://en.cppreference.com/w/cpp/language/operator_precedence + DOCTEST_FORBIT_EXPRESSION(Result, &) + DOCTEST_FORBIT_EXPRESSION(Result, ^) + DOCTEST_FORBIT_EXPRESSION(Result, |) + DOCTEST_FORBIT_EXPRESSION(Result, &&) + DOCTEST_FORBIT_EXPRESSION(Result, ||) + DOCTEST_FORBIT_EXPRESSION(Result, ==) + DOCTEST_FORBIT_EXPRESSION(Result, !=) + DOCTEST_FORBIT_EXPRESSION(Result, <) + DOCTEST_FORBIT_EXPRESSION(Result, >) + DOCTEST_FORBIT_EXPRESSION(Result, <=) + DOCTEST_FORBIT_EXPRESSION(Result, >=) + DOCTEST_FORBIT_EXPRESSION(Result, =) + DOCTEST_FORBIT_EXPRESSION(Result, +=) + DOCTEST_FORBIT_EXPRESSION(Result, -=) + DOCTEST_FORBIT_EXPRESSION(Result, *=) + DOCTEST_FORBIT_EXPRESSION(Result, /=) + DOCTEST_FORBIT_EXPRESSION(Result, %=) + DOCTEST_FORBIT_EXPRESSION(Result, <<=) + DOCTEST_FORBIT_EXPRESSION(Result, >>=) + DOCTEST_FORBIT_EXPRESSION(Result, &=) + DOCTEST_FORBIT_EXPRESSION(Result, ^=) + DOCTEST_FORBIT_EXPRESSION(Result, |=) + }; + +#ifndef DOCTEST_CONFIG_NO_COMPARISON_WARNING_SUPPRESSION + + DOCTEST_CLANG_SUPPRESS_WARNING_PUSH + DOCTEST_CLANG_SUPPRESS_WARNING("-Wsign-conversion") + DOCTEST_CLANG_SUPPRESS_WARNING("-Wsign-compare") + //DOCTEST_CLANG_SUPPRESS_WARNING("-Wdouble-promotion") + //DOCTEST_CLANG_SUPPRESS_WARNING("-Wconversion") + //DOCTEST_CLANG_SUPPRESS_WARNING("-Wfloat-equal") + + DOCTEST_GCC_SUPPRESS_WARNING_PUSH + DOCTEST_GCC_SUPPRESS_WARNING("-Wsign-conversion") + DOCTEST_GCC_SUPPRESS_WARNING("-Wsign-compare") + //DOCTEST_GCC_SUPPRESS_WARNING("-Wdouble-promotion") + //DOCTEST_GCC_SUPPRESS_WARNING("-Wconversion") + //DOCTEST_GCC_SUPPRESS_WARNING("-Wfloat-equal") + + DOCTEST_MSVC_SUPPRESS_WARNING_PUSH + // https://stackoverflow.com/questions/39479163 what's the difference between 4018 and 4389 + DOCTEST_MSVC_SUPPRESS_WARNING(4388) // signed/unsigned mismatch + DOCTEST_MSVC_SUPPRESS_WARNING(4389) // 'operator' : signed/unsigned mismatch + DOCTEST_MSVC_SUPPRESS_WARNING(4018) // 'expression' : signed/unsigned mismatch + //DOCTEST_MSVC_SUPPRESS_WARNING(4805) // 'operation' : unsafe mix of type 'type' and type 'type' in operation + +#endif // DOCTEST_CONFIG_NO_COMPARISON_WARNING_SUPPRESSION + + // clang-format off +#ifndef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +#define DOCTEST_COMPARISON_RETURN_TYPE bool +#else // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +#define DOCTEST_COMPARISON_RETURN_TYPE typename enable_if::value || can_use_op::value, bool>::type + inline bool eq(const char* lhs, const char* rhs) { return String(lhs) == String(rhs); } + inline bool ne(const char* lhs, const char* rhs) { return String(lhs) != String(rhs); } + inline bool lt(const char* lhs, const char* rhs) { return String(lhs) < String(rhs); } + inline bool gt(const char* lhs, const char* rhs) { return String(lhs) > String(rhs); } + inline bool le(const char* lhs, const char* rhs) { return String(lhs) <= String(rhs); } + inline bool ge(const char* lhs, const char* rhs) { return String(lhs) >= String(rhs); } +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + // clang-format on + +#define DOCTEST_RELATIONAL_OP(name, op) \ + template \ + DOCTEST_COMPARISON_RETURN_TYPE name(const DOCTEST_REF_WRAP(L) lhs, \ + const DOCTEST_REF_WRAP(R) rhs) { \ + return lhs op rhs; \ + } + + DOCTEST_RELATIONAL_OP(eq, ==) + DOCTEST_RELATIONAL_OP(ne, !=) + DOCTEST_RELATIONAL_OP(lt, <) + DOCTEST_RELATIONAL_OP(gt, >) + DOCTEST_RELATIONAL_OP(le, <=) + DOCTEST_RELATIONAL_OP(ge, >=) + +#ifndef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +#define DOCTEST_CMP_EQ(l, r) l == r +#define DOCTEST_CMP_NE(l, r) l != r +#define DOCTEST_CMP_GT(l, r) l > r +#define DOCTEST_CMP_LT(l, r) l < r +#define DOCTEST_CMP_GE(l, r) l >= r +#define DOCTEST_CMP_LE(l, r) l <= r +#else // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +#define DOCTEST_CMP_EQ(l, r) eq(l, r) +#define DOCTEST_CMP_NE(l, r) ne(l, r) +#define DOCTEST_CMP_GT(l, r) gt(l, r) +#define DOCTEST_CMP_LT(l, r) lt(l, r) +#define DOCTEST_CMP_GE(l, r) ge(l, r) +#define DOCTEST_CMP_LE(l, r) le(l, r) +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + + template + // cppcheck-suppress copyCtorAndEqOperator + struct Expression_lhs + { + L lhs; + assertType::Enum m_at; + + explicit Expression_lhs(L in, assertType::Enum at) + : lhs(in) + , m_at(at) {} + + DOCTEST_NOINLINE operator Result() { + bool res = !!lhs; + if(m_at & assertType::is_false) //!OCLINT bitwise operator in conditional + res = !res; + + if(!res || getContextOptions()->success) + return Result(res, toString(lhs)); + return Result(res); + } + + // clang-format off + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(==, " == ", DOCTEST_CMP_EQ) //!OCLINT bitwise operator in conditional + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(!=, " != ", DOCTEST_CMP_NE) //!OCLINT bitwise operator in conditional + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(>, " > ", DOCTEST_CMP_GT) //!OCLINT bitwise operator in conditional + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(<, " < ", DOCTEST_CMP_LT) //!OCLINT bitwise operator in conditional + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(>=, " >= ", DOCTEST_CMP_GE) //!OCLINT bitwise operator in conditional + DOCTEST_DO_BINARY_EXPRESSION_COMPARISON(<=, " <= ", DOCTEST_CMP_LE) //!OCLINT bitwise operator in conditional + // clang-format on + + // forbidding some expressions based on this table: https://en.cppreference.com/w/cpp/language/operator_precedence + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, &) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, ^) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, |) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, &&) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, ||) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, =) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, +=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, -=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, *=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, /=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, %=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, <<=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, >>=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, &=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, ^=) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, |=) + // these 2 are unfortunate because they should be allowed - they have higher precedence over the comparisons, but the + // ExpressionDecomposer class uses the left shift operator to capture the left operand of the binary expression... + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, <<) + DOCTEST_FORBIT_EXPRESSION(Expression_lhs, >>) + }; + +#ifndef DOCTEST_CONFIG_NO_COMPARISON_WARNING_SUPPRESSION + + DOCTEST_CLANG_SUPPRESS_WARNING_POP + DOCTEST_MSVC_SUPPRESS_WARNING_POP + DOCTEST_GCC_SUPPRESS_WARNING_POP + +#endif // DOCTEST_CONFIG_NO_COMPARISON_WARNING_SUPPRESSION + + struct DOCTEST_INTERFACE ExpressionDecomposer + { + assertType::Enum m_at; + + ExpressionDecomposer(assertType::Enum at); + + // The right operator for capturing expressions is "<=" instead of "<<" (based on the operator precedence table) + // but then there will be warnings from GCC about "-Wparentheses" and since "_Pragma()" is problematic this will stay for now... + // https://github.com/catchorg/Catch2/issues/870 + // https://github.com/catchorg/Catch2/issues/565 + template + Expression_lhs operator<<(const DOCTEST_REF_WRAP(L) operand) { + return Expression_lhs(operand, m_at); + } + }; + + struct DOCTEST_INTERFACE TestSuite + { + const char* m_test_suite; + const char* m_description; + bool m_skip; + bool m_may_fail; + bool m_should_fail; + int m_expected_failures; + double m_timeout; + + TestSuite& operator*(const char* in); + + template + TestSuite& operator*(const T& in) { + in.fill(*this); + return *this; + } + }; + + typedef void (*funcType)(); + + struct DOCTEST_INTERFACE TestCase : public TestCaseData + { + funcType m_test; // a function pointer to the test case + + const char* m_type; // for templated test cases - gets appended to the real name + int m_template_id; // an ID used to distinguish between the different versions of a templated test case + String m_full_name; // contains the name (only for templated test cases!) + the template type + + TestCase(funcType test, const char* file, unsigned line, const TestSuite& test_suite, + const char* type = "", int template_id = -1); + + TestCase(const TestCase& other); + + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(26434) // hides a non-virtual function + TestCase& operator=(const TestCase& other); + DOCTEST_MSVC_SUPPRESS_WARNING_POP + + TestCase& operator*(const char* in); + + template + TestCase& operator*(const T& in) { + in.fill(*this); + return *this; + } + + bool operator<(const TestCase& other) const; + }; + + // forward declarations of functions used by the macros + DOCTEST_INTERFACE int regTest(const TestCase& tc); + DOCTEST_INTERFACE int setTestSuite(const TestSuite& ts); + DOCTEST_INTERFACE bool isDebuggerActive(); + + template + int instantiationHelper(const T&) { return 0; } + + namespace binaryAssertComparison { + enum Enum + { + eq = 0, + ne, + gt, + lt, + ge, + le + }; + } // namespace binaryAssertComparison + + // clang-format off + template struct RelationalComparator { bool operator()(const DOCTEST_REF_WRAP(L), const DOCTEST_REF_WRAP(R) ) const { return false; } }; + +#define DOCTEST_BINARY_RELATIONAL_OP(n, op) \ + template struct RelationalComparator { bool operator()(const DOCTEST_REF_WRAP(L) lhs, const DOCTEST_REF_WRAP(R) rhs) const { return op(lhs, rhs); } }; + // clang-format on + + DOCTEST_BINARY_RELATIONAL_OP(0, eq) + DOCTEST_BINARY_RELATIONAL_OP(1, ne) + DOCTEST_BINARY_RELATIONAL_OP(2, gt) + DOCTEST_BINARY_RELATIONAL_OP(3, lt) + DOCTEST_BINARY_RELATIONAL_OP(4, ge) + DOCTEST_BINARY_RELATIONAL_OP(5, le) + + struct DOCTEST_INTERFACE ResultBuilder : public AssertData + { + ResultBuilder(assertType::Enum at, const char* file, int line, const char* expr, + const char* exception_type = "", const char* exception_string = ""); + + void setResult(const Result& res); + + template + DOCTEST_NOINLINE void binary_assert(const DOCTEST_REF_WRAP(L) lhs, + const DOCTEST_REF_WRAP(R) rhs) { + m_failed = !RelationalComparator()(lhs, rhs); + if(m_failed || getContextOptions()->success) + m_decomp = stringifyBinaryExpr(lhs, ", ", rhs); + } + + template + DOCTEST_NOINLINE void unary_assert(const DOCTEST_REF_WRAP(L) val) { + m_failed = !val; + + if(m_at & assertType::is_false) //!OCLINT bitwise operator in conditional + m_failed = !m_failed; + + if(m_failed || getContextOptions()->success) + m_decomp = toString(val); + } + + void translateException(); + + bool log(); + void react() const; + }; + + namespace assertAction { + enum Enum + { + nothing = 0, + dbgbreak = 1, + shouldthrow = 2 + }; + } // namespace assertAction + + DOCTEST_INTERFACE void failed_out_of_a_testing_context(const AssertData& ad); + + DOCTEST_INTERFACE void decomp_assert(assertType::Enum at, const char* file, int line, + const char* expr, Result result); + +#define DOCTEST_ASSERT_OUT_OF_TESTS(decomp) \ + do { \ + if(!is_running_in_test) { \ + if(failed) { \ + ResultBuilder rb(at, file, line, expr); \ + rb.m_failed = failed; \ + rb.m_decomp = decomp; \ + failed_out_of_a_testing_context(rb); \ + if(isDebuggerActive() && !getContextOptions()->no_breaks) \ + DOCTEST_BREAK_INTO_DEBUGGER(); \ + if(checkIfShouldThrow(at)) \ + throwException(); \ + } \ + return; \ + } \ + } while(false) + +#define DOCTEST_ASSERT_IN_TESTS(decomp) \ + ResultBuilder rb(at, file, line, expr); \ + rb.m_failed = failed; \ + if(rb.m_failed || getContextOptions()->success) \ + rb.m_decomp = decomp; \ + if(rb.log()) \ + DOCTEST_BREAK_INTO_DEBUGGER(); \ + if(rb.m_failed && checkIfShouldThrow(at)) \ + throwException() + + template + DOCTEST_NOINLINE void binary_assert(assertType::Enum at, const char* file, int line, + const char* expr, const DOCTEST_REF_WRAP(L) lhs, + const DOCTEST_REF_WRAP(R) rhs) { + bool failed = !RelationalComparator()(lhs, rhs); + + // ################################################################################### + // IF THE DEBUGGER BREAKS HERE - GO 1 LEVEL UP IN THE CALLSTACK FOR THE FAILING ASSERT + // THIS IS THE EFFECT OF HAVING 'DOCTEST_CONFIG_SUPER_FAST_ASSERTS' DEFINED + // ################################################################################### + DOCTEST_ASSERT_OUT_OF_TESTS(stringifyBinaryExpr(lhs, ", ", rhs)); + DOCTEST_ASSERT_IN_TESTS(stringifyBinaryExpr(lhs, ", ", rhs)); + } + + template + DOCTEST_NOINLINE void unary_assert(assertType::Enum at, const char* file, int line, + const char* expr, const DOCTEST_REF_WRAP(L) val) { + bool failed = !val; + + if(at & assertType::is_false) //!OCLINT bitwise operator in conditional + failed = !failed; + + // ################################################################################### + // IF THE DEBUGGER BREAKS HERE - GO 1 LEVEL UP IN THE CALLSTACK FOR THE FAILING ASSERT + // THIS IS THE EFFECT OF HAVING 'DOCTEST_CONFIG_SUPER_FAST_ASSERTS' DEFINED + // ################################################################################### + DOCTEST_ASSERT_OUT_OF_TESTS(toString(val)); + DOCTEST_ASSERT_IN_TESTS(toString(val)); + } + + struct DOCTEST_INTERFACE IExceptionTranslator + { + IExceptionTranslator(); + virtual ~IExceptionTranslator(); + virtual bool translate(String&) const = 0; + }; + + template + class ExceptionTranslator : public IExceptionTranslator //!OCLINT destructor of virtual class + { + public: + explicit ExceptionTranslator(String (*translateFunction)(T)) + : m_translateFunction(translateFunction) {} + + bool translate(String& res) const override { +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + try { + throw; // lgtm [cpp/rethrow-no-exception] + // cppcheck-suppress catchExceptionByValue + } catch(T ex) { // NOLINT + res = m_translateFunction(ex); //!OCLINT parameter reassignment + return true; + } catch(...) {} //!OCLINT - empty catch statement +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + ((void)res); // to silence -Wunused-parameter + return false; + } + + private: + String (*m_translateFunction)(T); + }; + + DOCTEST_INTERFACE void registerExceptionTranslatorImpl(const IExceptionTranslator* et); + + template + struct StringStreamBase + { + template + static void convert(std::ostream* s, const T& in) { + *s << toString(in); + } + + // always treat char* as a string in this context - no matter + // if DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING is defined + static void convert(std::ostream* s, const char* in) { *s << String(in); } + }; + + template <> + struct StringStreamBase + { + template + static void convert(std::ostream* s, const T& in) { + *s << in; + } + }; + + template + struct StringStream : public StringStreamBase::value> + {}; + + template + void toStream(std::ostream* s, const T& value) { + StringStream::convert(s, value); + } + +#ifdef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + DOCTEST_INTERFACE void toStream(std::ostream* s, char* in); + DOCTEST_INTERFACE void toStream(std::ostream* s, const char* in); +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + DOCTEST_INTERFACE void toStream(std::ostream* s, bool in); + DOCTEST_INTERFACE void toStream(std::ostream* s, float in); + DOCTEST_INTERFACE void toStream(std::ostream* s, double in); + DOCTEST_INTERFACE void toStream(std::ostream* s, double long in); + + DOCTEST_INTERFACE void toStream(std::ostream* s, char in); + DOCTEST_INTERFACE void toStream(std::ostream* s, char signed in); + DOCTEST_INTERFACE void toStream(std::ostream* s, char unsigned in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int short in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int short unsigned in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int unsigned in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int long in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int long unsigned in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int long long in); + DOCTEST_INTERFACE void toStream(std::ostream* s, int long long unsigned in); + + // ContextScope base class used to allow implementing methods of ContextScope + // that don't depend on the template parameter in doctest.cpp. + class DOCTEST_INTERFACE ContextScopeBase : public IContextScope { + protected: + ContextScopeBase(); + + void destroy(); + }; + + template class ContextScope : public ContextScopeBase + { + const L &lambda_; + + public: + explicit ContextScope(const L &lambda) : lambda_(lambda) {} + + ContextScope(ContextScope &&other) : lambda_(other.lambda_) {} + + void stringify(std::ostream* s) const override { lambda_(s); } + + ~ContextScope() override { destroy(); } + }; + + struct DOCTEST_INTERFACE MessageBuilder : public MessageData + { + std::ostream* m_stream; + + MessageBuilder(const char* file, int line, assertType::Enum severity); + MessageBuilder() = delete; + ~MessageBuilder(); + + template + MessageBuilder& operator<<(const T& in) { + toStream(m_stream, in); + return *this; + } + + bool log(); + void react(); + }; + + template + ContextScope MakeContextScope(const L &lambda) { + return ContextScope(lambda); + } +} // namespace detail + +#define DOCTEST_DEFINE_DECORATOR(name, type, def) \ + struct name \ + { \ + type data; \ + name(type in = def) \ + : data(in) {} \ + void fill(detail::TestCase& state) const { state.DOCTEST_CAT(m_, name) = data; } \ + void fill(detail::TestSuite& state) const { state.DOCTEST_CAT(m_, name) = data; } \ + } + +DOCTEST_DEFINE_DECORATOR(test_suite, const char*, ""); +DOCTEST_DEFINE_DECORATOR(description, const char*, ""); +DOCTEST_DEFINE_DECORATOR(skip, bool, true); +DOCTEST_DEFINE_DECORATOR(timeout, double, 0); +DOCTEST_DEFINE_DECORATOR(may_fail, bool, true); +DOCTEST_DEFINE_DECORATOR(should_fail, bool, true); +DOCTEST_DEFINE_DECORATOR(expected_failures, int, 0); + +template +int registerExceptionTranslator(String (*translateFunction)(T)) { + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wexit-time-destructors") + static detail::ExceptionTranslator exceptionTranslator(translateFunction); + DOCTEST_CLANG_SUPPRESS_WARNING_POP + detail::registerExceptionTranslatorImpl(&exceptionTranslator); + return 0; +} + +} // namespace doctest + +// in a separate namespace outside of doctest because the DOCTEST_TEST_SUITE macro +// introduces an anonymous namespace in which getCurrentTestSuite gets overridden +namespace doctest_detail_test_suite_ns { +DOCTEST_INTERFACE doctest::detail::TestSuite& getCurrentTestSuite(); +} // namespace doctest_detail_test_suite_ns + +namespace doctest { +#else // DOCTEST_CONFIG_DISABLE +template +int registerExceptionTranslator(String (*)(T)) { + return 0; +} +#endif // DOCTEST_CONFIG_DISABLE + +namespace detail { + typedef void (*assert_handler)(const AssertData&); + struct ContextState; +} // namespace detail + +class DOCTEST_INTERFACE Context +{ + detail::ContextState* p; + + void parseArgs(int argc, const char* const* argv, bool withDefaults = false); + +public: + explicit Context(int argc = 0, const char* const* argv = nullptr); + + ~Context(); + + void applyCommandLine(int argc, const char* const* argv); + + void addFilter(const char* filter, const char* value); + void clearFilters(); + void setOption(const char* option, int value); + void setOption(const char* option, const char* value); + + bool shouldExit(); + + void setAsDefaultForAssertsOutOfTestCases(); + + void setAssertHandler(detail::assert_handler ah); + + int run(); +}; + +namespace TestCaseFailureReason { + enum Enum + { + None = 0, + AssertFailure = 1, // an assertion has failed in the test case + Exception = 2, // test case threw an exception + Crash = 4, // a crash... + TooManyFailedAsserts = 8, // the abort-after option + Timeout = 16, // see the timeout decorator + ShouldHaveFailedButDidnt = 32, // see the should_fail decorator + ShouldHaveFailedAndDid = 64, // see the should_fail decorator + DidntFailExactlyNumTimes = 128, // see the expected_failures decorator + FailedExactlyNumTimes = 256, // see the expected_failures decorator + CouldHaveFailedAndDid = 512 // see the may_fail decorator + }; +} // namespace TestCaseFailureReason + +struct DOCTEST_INTERFACE CurrentTestCaseStats +{ + int numAssertsCurrentTest; + int numAssertsFailedCurrentTest; + double seconds; + int failure_flags; // use TestCaseFailureReason::Enum +}; + +struct DOCTEST_INTERFACE TestCaseException +{ + String error_string; + bool is_crash; +}; + +struct DOCTEST_INTERFACE TestRunStats +{ + unsigned numTestCases; + unsigned numTestCasesPassingFilters; + unsigned numTestSuitesPassingFilters; + unsigned numTestCasesFailed; + int numAsserts; + int numAssertsFailed; +}; + +struct QueryData +{ + const TestRunStats* run_stats = nullptr; + const TestCaseData** data = nullptr; + unsigned num_data = 0; +}; + +struct DOCTEST_INTERFACE IReporter +{ + // The constructor has to accept "const ContextOptions&" as a single argument + // which has most of the options for the run + a pointer to the stdout stream + // Reporter(const ContextOptions& in) + + // called when a query should be reported (listing test cases, printing the version, etc.) + virtual void report_query(const QueryData&) = 0; + + // called when the whole test run starts + virtual void test_run_start() = 0; + // called when the whole test run ends (caching a pointer to the input doesn't make sense here) + virtual void test_run_end(const TestRunStats&) = 0; + + // called when a test case is started (safe to cache a pointer to the input) + virtual void test_case_start(const TestCaseData&) = 0; + // called when a test case is reentered because of unfinished subcases (safe to cache a pointer to the input) + virtual void test_case_reenter(const TestCaseData&) = 0; + // called when a test case has ended + virtual void test_case_end(const CurrentTestCaseStats&) = 0; + + // called when an exception is thrown from the test case (or it crashes) + virtual void test_case_exception(const TestCaseException&) = 0; + + // called whenever a subcase is entered (don't cache pointers to the input) + virtual void subcase_start(const SubcaseSignature&) = 0; + // called whenever a subcase is exited (don't cache pointers to the input) + virtual void subcase_end() = 0; + + // called for each assert (don't cache pointers to the input) + virtual void log_assert(const AssertData&) = 0; + // called for each message (don't cache pointers to the input) + virtual void log_message(const MessageData&) = 0; + + // called when a test case is skipped either because it doesn't pass the filters, has a skip decorator + // or isn't in the execution range (between first and last) (safe to cache a pointer to the input) + virtual void test_case_skipped(const TestCaseData&) = 0; + + // doctest will not be managing the lifetimes of reporters given to it but this would still be nice to have + virtual ~IReporter(); + + // can obtain all currently active contexts and stringify them if one wishes to do so + static int get_num_active_contexts(); + static const IContextScope* const* get_active_contexts(); + + // can iterate through contexts which have been stringified automatically in their destructors when an exception has been thrown + static int get_num_stringified_contexts(); + static const String* get_stringified_contexts(); +}; + +namespace detail { + typedef IReporter* (*reporterCreatorFunc)(const ContextOptions&); + + DOCTEST_INTERFACE void registerReporterImpl(const char* name, int prio, reporterCreatorFunc c, bool isReporter); + + template + IReporter* reporterCreator(const ContextOptions& o) { + return new Reporter(o); + } +} // namespace detail + +template +int registerReporter(const char* name, int priority, bool isReporter) { + detail::registerReporterImpl(name, priority, detail::reporterCreator, isReporter); + return 0; +} +} // namespace doctest + +// if registering is not disabled +#if !defined(DOCTEST_CONFIG_DISABLE) + +// common code in asserts - for convenience +#define DOCTEST_ASSERT_LOG_AND_REACT(b) \ + if(b.log()) \ + DOCTEST_BREAK_INTO_DEBUGGER(); \ + b.react() + +#ifdef DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS +#define DOCTEST_WRAP_IN_TRY(x) x; +#else // DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS +#define DOCTEST_WRAP_IN_TRY(x) \ + try { \ + x; \ + } catch(...) { _DOCTEST_RB.translateException(); } +#endif // DOCTEST_CONFIG_NO_TRY_CATCH_IN_ASSERTS + +#ifdef DOCTEST_CONFIG_VOID_CAST_EXPRESSIONS +#define DOCTEST_CAST_TO_VOID(...) \ + DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wuseless-cast") \ + static_cast(__VA_ARGS__); \ + DOCTEST_GCC_SUPPRESS_WARNING_POP +#else // DOCTEST_CONFIG_VOID_CAST_EXPRESSIONS +#define DOCTEST_CAST_TO_VOID(...) __VA_ARGS__; +#endif // DOCTEST_CONFIG_VOID_CAST_EXPRESSIONS + +// registers the test by initializing a dummy var with a function +#define DOCTEST_REGISTER_FUNCTION(global_prefix, f, decorators) \ + global_prefix DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_VAR_)) = \ + doctest::detail::regTest( \ + doctest::detail::TestCase( \ + f, __FILE__, __LINE__, \ + doctest_detail_test_suite_ns::getCurrentTestSuite()) * \ + decorators); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() + +#define DOCTEST_IMPLEMENT_FIXTURE(der, base, func, decorators) \ + namespace { \ + struct der : public base \ + { \ + void f(); \ + }; \ + static void func() { \ + der v; \ + v.f(); \ + } \ + DOCTEST_REGISTER_FUNCTION(DOCTEST_EMPTY, func, decorators) \ + } \ + inline DOCTEST_NOINLINE void der::f() + +#define DOCTEST_CREATE_AND_REGISTER_FUNCTION(f, decorators) \ + static void f(); \ + DOCTEST_REGISTER_FUNCTION(DOCTEST_EMPTY, f, decorators) \ + static void f() + +#define DOCTEST_CREATE_AND_REGISTER_FUNCTION_IN_CLASS(f, proxy, decorators) \ + static doctest::detail::funcType proxy() { return f; } \ + DOCTEST_REGISTER_FUNCTION(inline const, proxy(), decorators) \ + static void f() + +// for registering tests +#define DOCTEST_TEST_CASE(decorators) \ + DOCTEST_CREATE_AND_REGISTER_FUNCTION(DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), decorators) + +// for registering tests in classes - requires C++17 for inline variables! +#if __cplusplus >= 201703L || (DOCTEST_MSVC >= DOCTEST_COMPILER(19, 12, 0) && _MSVC_LANG >= 201703L) +#define DOCTEST_TEST_CASE_CLASS(decorators) \ + DOCTEST_CREATE_AND_REGISTER_FUNCTION_IN_CLASS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), \ + DOCTEST_ANONYMOUS(_DOCTEST_ANON_PROXY_), \ + decorators) +#else // DOCTEST_TEST_CASE_CLASS +#define DOCTEST_TEST_CASE_CLASS(...) \ + TEST_CASES_CAN_BE_REGISTERED_IN_CLASSES_ONLY_IN_CPP17_MODE_OR_WITH_VS_2017_OR_NEWER +#endif // DOCTEST_TEST_CASE_CLASS + +// for registering tests with a fixture +#define DOCTEST_TEST_CASE_FIXTURE(c, decorators) \ + DOCTEST_IMPLEMENT_FIXTURE(DOCTEST_ANONYMOUS(_DOCTEST_ANON_CLASS_), c, \ + DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), decorators) + +// for converting types to strings without the header and demangling +#define DOCTEST_TYPE_TO_STRING_IMPL(...) \ + template <> \ + inline const char* type_to_string<__VA_ARGS__>() { \ + return "<" #__VA_ARGS__ ">"; \ + } +#define DOCTEST_TYPE_TO_STRING(...) \ + namespace doctest { namespace detail { \ + DOCTEST_TYPE_TO_STRING_IMPL(__VA_ARGS__) \ + } \ + } \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +#define DOCTEST_TEST_CASE_TEMPLATE_DEFINE_IMPL(dec, T, iter, func) \ + template \ + static void func(); \ + namespace { \ + template \ + struct iter; \ + template \ + struct iter> \ + { \ + iter(const char* file, unsigned line, int index) { \ + doctest::detail::regTest(doctest::detail::TestCase(func, file, line, \ + doctest_detail_test_suite_ns::getCurrentTestSuite(), \ + doctest::detail::type_to_string(), \ + int(line) * 1000 + index) \ + * dec); \ + iter>(file, line, index + 1); \ + } \ + }; \ + template <> \ + struct iter> \ + { \ + iter(const char*, unsigned, int) {} \ + }; \ + } \ + template \ + static void func() + +#define DOCTEST_TEST_CASE_TEMPLATE_DEFINE(dec, T, id) \ + DOCTEST_TEST_CASE_TEMPLATE_DEFINE_IMPL(dec, T, DOCTEST_CAT(id, ITERATOR), \ + DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_)) + +#define DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE_IMPL(id, anon, ...) \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_CAT(anon, DUMMY)) = \ + doctest::detail::instantiationHelper(DOCTEST_CAT(id, ITERATOR)<__VA_ARGS__>(__FILE__, __LINE__, 0));\ + DOCTEST_GLOBAL_NO_WARNINGS_END() + +#define DOCTEST_TEST_CASE_TEMPLATE_INVOKE(id, ...) \ + DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE_IMPL(id, DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_), std::tuple<__VA_ARGS__>) \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +#define DOCTEST_TEST_CASE_TEMPLATE_APPLY(id, ...) \ + DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE_IMPL(id, DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_), __VA_ARGS__) \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +#define DOCTEST_TEST_CASE_TEMPLATE_IMPL(dec, T, anon, ...) \ + DOCTEST_TEST_CASE_TEMPLATE_DEFINE_IMPL(dec, T, DOCTEST_CAT(anon, ITERATOR), anon); \ + DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE_IMPL(anon, anon, std::tuple<__VA_ARGS__>) \ + template \ + static void anon() + +#define DOCTEST_TEST_CASE_TEMPLATE(dec, T, ...) \ + DOCTEST_TEST_CASE_TEMPLATE_IMPL(dec, T, DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_), __VA_ARGS__) + +// for subcases +#define DOCTEST_SUBCASE(name) \ + if(const doctest::detail::Subcase & DOCTEST_ANONYMOUS(_DOCTEST_ANON_SUBCASE_) DOCTEST_UNUSED = \ + doctest::detail::Subcase(name, __FILE__, __LINE__)) + +// for grouping tests in test suites by using code blocks +#define DOCTEST_TEST_SUITE_IMPL(decorators, ns_name) \ + namespace ns_name { namespace doctest_detail_test_suite_ns { \ + static DOCTEST_NOINLINE doctest::detail::TestSuite& getCurrentTestSuite() { \ + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4640) \ + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wexit-time-destructors") \ + static doctest::detail::TestSuite data; \ + static bool inited = false; \ + DOCTEST_MSVC_SUPPRESS_WARNING_POP \ + DOCTEST_CLANG_SUPPRESS_WARNING_POP \ + if(!inited) { \ + data* decorators; \ + inited = true; \ + } \ + return data; \ + } \ + } \ + } \ + namespace ns_name + +#define DOCTEST_TEST_SUITE(decorators) \ + DOCTEST_TEST_SUITE_IMPL(decorators, DOCTEST_ANONYMOUS(_DOCTEST_ANON_SUITE_)) + +// for starting a testsuite block +#define DOCTEST_TEST_SUITE_BEGIN(decorators) \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_VAR_)) = \ + doctest::detail::setTestSuite(doctest::detail::TestSuite() * decorators); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for ending a testsuite block +#define DOCTEST_TEST_SUITE_END \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_VAR_)) = \ + doctest::detail::setTestSuite(doctest::detail::TestSuite() * ""); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for registering exception translators +#define DOCTEST_REGISTER_EXCEPTION_TRANSLATOR_IMPL(translatorName, signature) \ + inline doctest::String translatorName(signature); \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_TRANSLATOR_)) = \ + doctest::registerExceptionTranslator(translatorName); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() \ + doctest::String translatorName(signature) + +#define DOCTEST_REGISTER_EXCEPTION_TRANSLATOR(signature) \ + DOCTEST_REGISTER_EXCEPTION_TRANSLATOR_IMPL(DOCTEST_ANONYMOUS(_DOCTEST_ANON_TRANSLATOR_), \ + signature) + +// for registering reporters +#define DOCTEST_REGISTER_REPORTER(name, priority, reporter) \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_REPORTER_)) = \ + doctest::registerReporter(name, priority, true); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for registering listeners +#define DOCTEST_REGISTER_LISTENER(name, priority, reporter) \ + DOCTEST_GLOBAL_NO_WARNINGS(DOCTEST_ANONYMOUS(_DOCTEST_ANON_REPORTER_)) = \ + doctest::registerReporter(name, priority, false); \ + DOCTEST_GLOBAL_NO_WARNINGS_END() typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for logging +#define DOCTEST_INFO(expression) \ + DOCTEST_INFO_IMPL(DOCTEST_ANONYMOUS(_DOCTEST_CAPTURE_), DOCTEST_ANONYMOUS(_DOCTEST_CAPTURE_), \ + DOCTEST_ANONYMOUS(_DOCTEST_CAPTURE_), expression) + +#define DOCTEST_INFO_IMPL(lambda_name, mb_name, s_name, expression) \ + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4626) \ + auto lambda_name = [&](std::ostream* s_name) { \ + doctest::detail::MessageBuilder mb_name(__FILE__, __LINE__, doctest::assertType::is_warn); \ + mb_name.m_stream = s_name; \ + mb_name << expression; \ + }; \ + DOCTEST_MSVC_SUPPRESS_WARNING_POP \ + auto DOCTEST_ANONYMOUS(_DOCTEST_CAPTURE_) = doctest::detail::MakeContextScope(lambda_name) + +#define DOCTEST_CAPTURE(x) DOCTEST_INFO(#x " := " << x) + +#define DOCTEST_ADD_AT_IMPL(type, file, line, mb, x) \ + do { \ + doctest::detail::MessageBuilder mb(file, line, doctest::assertType::type); \ + mb << x; \ + DOCTEST_ASSERT_LOG_AND_REACT(mb); \ + } while(false) + +// clang-format off +#define DOCTEST_ADD_MESSAGE_AT(file, line, x) DOCTEST_ADD_AT_IMPL(is_warn, file, line, DOCTEST_ANONYMOUS(_DOCTEST_MESSAGE_), x) +#define DOCTEST_ADD_FAIL_CHECK_AT(file, line, x) DOCTEST_ADD_AT_IMPL(is_check, file, line, DOCTEST_ANONYMOUS(_DOCTEST_MESSAGE_), x) +#define DOCTEST_ADD_FAIL_AT(file, line, x) DOCTEST_ADD_AT_IMPL(is_require, file, line, DOCTEST_ANONYMOUS(_DOCTEST_MESSAGE_), x) +// clang-format on + +#define DOCTEST_MESSAGE(x) DOCTEST_ADD_MESSAGE_AT(__FILE__, __LINE__, x) +#define DOCTEST_FAIL_CHECK(x) DOCTEST_ADD_FAIL_CHECK_AT(__FILE__, __LINE__, x) +#define DOCTEST_FAIL(x) DOCTEST_ADD_FAIL_AT(__FILE__, __LINE__, x) + +#define DOCTEST_TO_LVALUE(...) __VA_ARGS__ // Not removed to keep backwards compatibility. + +#ifndef DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +#define DOCTEST_ASSERT_IMPLEMENT_2(assert_type, ...) \ + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Woverloaded-shift-op-parentheses") \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, #__VA_ARGS__); \ + DOCTEST_WRAP_IN_TRY(_DOCTEST_RB.setResult( \ + doctest::detail::ExpressionDecomposer(doctest::assertType::assert_type) \ + << __VA_ARGS__)) \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB) \ + DOCTEST_CLANG_SUPPRESS_WARNING_POP + +#define DOCTEST_ASSERT_IMPLEMENT_1(assert_type, ...) \ + do { \ + DOCTEST_ASSERT_IMPLEMENT_2(assert_type, __VA_ARGS__); \ + } while(false) + +#else // DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +// necessary for _MESSAGE +#define DOCTEST_ASSERT_IMPLEMENT_2 DOCTEST_ASSERT_IMPLEMENT_1 + +#define DOCTEST_ASSERT_IMPLEMENT_1(assert_type, ...) \ + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Woverloaded-shift-op-parentheses") \ + doctest::detail::decomp_assert( \ + doctest::assertType::assert_type, __FILE__, __LINE__, #__VA_ARGS__, \ + doctest::detail::ExpressionDecomposer(doctest::assertType::assert_type) \ + << __VA_ARGS__) DOCTEST_CLANG_SUPPRESS_WARNING_POP + +#endif // DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +#define DOCTEST_WARN(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_WARN, __VA_ARGS__) +#define DOCTEST_CHECK(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_CHECK, __VA_ARGS__) +#define DOCTEST_REQUIRE(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_REQUIRE, __VA_ARGS__) +#define DOCTEST_WARN_FALSE(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_WARN_FALSE, __VA_ARGS__) +#define DOCTEST_CHECK_FALSE(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_CHECK_FALSE, __VA_ARGS__) +#define DOCTEST_REQUIRE_FALSE(...) DOCTEST_ASSERT_IMPLEMENT_1(DT_REQUIRE_FALSE, __VA_ARGS__) + +// clang-format off +#define DOCTEST_WARN_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_WARN, cond); } while(false) +#define DOCTEST_CHECK_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_CHECK, cond); } while(false) +#define DOCTEST_REQUIRE_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_REQUIRE, cond); } while(false) +#define DOCTEST_WARN_FALSE_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_WARN_FALSE, cond); } while(false) +#define DOCTEST_CHECK_FALSE_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_CHECK_FALSE, cond); } while(false) +#define DOCTEST_REQUIRE_FALSE_MESSAGE(cond, msg) do { DOCTEST_INFO(msg); DOCTEST_ASSERT_IMPLEMENT_2(DT_REQUIRE_FALSE, cond); } while(false) +// clang-format on + +#define DOCTEST_ASSERT_THROWS_AS(expr, assert_type, message, ...) \ + do { \ + if(!doctest::getContextOptions()->no_throw) { \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, #expr, #__VA_ARGS__, message); \ + try { \ + DOCTEST_CAST_TO_VOID(expr) \ + } catch(const doctest::detail::remove_const< \ + doctest::detail::remove_reference<__VA_ARGS__>::type>::type&) { \ + _DOCTEST_RB.translateException(); \ + _DOCTEST_RB.m_threw_as = true; \ + } catch(...) { _DOCTEST_RB.translateException(); } \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB); \ + } \ + } while(false) + +#define DOCTEST_ASSERT_THROWS_WITH(expr, expr_str, assert_type, ...) \ + do { \ + if(!doctest::getContextOptions()->no_throw) { \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, expr_str, "", __VA_ARGS__); \ + try { \ + DOCTEST_CAST_TO_VOID(expr) \ + } catch(...) { _DOCTEST_RB.translateException(); } \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB); \ + } \ + } while(false) + +#define DOCTEST_ASSERT_NOTHROW(assert_type, ...) \ + do { \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, #__VA_ARGS__); \ + try { \ + DOCTEST_CAST_TO_VOID(__VA_ARGS__) \ + } catch(...) { _DOCTEST_RB.translateException(); } \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB); \ + } while(false) + +// clang-format off +#define DOCTEST_WARN_THROWS(...) DOCTEST_ASSERT_THROWS_WITH((__VA_ARGS__), #__VA_ARGS__, DT_WARN_THROWS, "") +#define DOCTEST_CHECK_THROWS(...) DOCTEST_ASSERT_THROWS_WITH((__VA_ARGS__), #__VA_ARGS__, DT_CHECK_THROWS, "") +#define DOCTEST_REQUIRE_THROWS(...) DOCTEST_ASSERT_THROWS_WITH((__VA_ARGS__), #__VA_ARGS__, DT_REQUIRE_THROWS, "") + +#define DOCTEST_WARN_THROWS_AS(expr, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_WARN_THROWS_AS, "", __VA_ARGS__) +#define DOCTEST_CHECK_THROWS_AS(expr, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_CHECK_THROWS_AS, "", __VA_ARGS__) +#define DOCTEST_REQUIRE_THROWS_AS(expr, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_REQUIRE_THROWS_AS, "", __VA_ARGS__) + +#define DOCTEST_WARN_THROWS_WITH(expr, ...) DOCTEST_ASSERT_THROWS_WITH(expr, #expr, DT_WARN_THROWS_WITH, __VA_ARGS__) +#define DOCTEST_CHECK_THROWS_WITH(expr, ...) DOCTEST_ASSERT_THROWS_WITH(expr, #expr, DT_CHECK_THROWS_WITH, __VA_ARGS__) +#define DOCTEST_REQUIRE_THROWS_WITH(expr, ...) DOCTEST_ASSERT_THROWS_WITH(expr, #expr, DT_REQUIRE_THROWS_WITH, __VA_ARGS__) + +#define DOCTEST_WARN_THROWS_WITH_AS(expr, message, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_WARN_THROWS_WITH_AS, message, __VA_ARGS__) +#define DOCTEST_CHECK_THROWS_WITH_AS(expr, message, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_CHECK_THROWS_WITH_AS, message, __VA_ARGS__) +#define DOCTEST_REQUIRE_THROWS_WITH_AS(expr, message, ...) DOCTEST_ASSERT_THROWS_AS(expr, DT_REQUIRE_THROWS_WITH_AS, message, __VA_ARGS__) + +#define DOCTEST_WARN_NOTHROW(...) DOCTEST_ASSERT_NOTHROW(DT_WARN_NOTHROW, __VA_ARGS__) +#define DOCTEST_CHECK_NOTHROW(...) DOCTEST_ASSERT_NOTHROW(DT_CHECK_NOTHROW, __VA_ARGS__) +#define DOCTEST_REQUIRE_NOTHROW(...) DOCTEST_ASSERT_NOTHROW(DT_REQUIRE_NOTHROW, __VA_ARGS__) + +#define DOCTEST_WARN_THROWS_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_WARN_THROWS(expr); } while(false) +#define DOCTEST_CHECK_THROWS_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_CHECK_THROWS(expr); } while(false) +#define DOCTEST_REQUIRE_THROWS_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_REQUIRE_THROWS(expr); } while(false) +#define DOCTEST_WARN_THROWS_AS_MESSAGE(expr, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_WARN_THROWS_AS(expr, ex); } while(false) +#define DOCTEST_CHECK_THROWS_AS_MESSAGE(expr, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_CHECK_THROWS_AS(expr, ex); } while(false) +#define DOCTEST_REQUIRE_THROWS_AS_MESSAGE(expr, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_REQUIRE_THROWS_AS(expr, ex); } while(false) +#define DOCTEST_WARN_THROWS_WITH_MESSAGE(expr, with, msg) do { DOCTEST_INFO(msg); DOCTEST_WARN_THROWS_WITH(expr, with); } while(false) +#define DOCTEST_CHECK_THROWS_WITH_MESSAGE(expr, with, msg) do { DOCTEST_INFO(msg); DOCTEST_CHECK_THROWS_WITH(expr, with); } while(false) +#define DOCTEST_REQUIRE_THROWS_WITH_MESSAGE(expr, with, msg) do { DOCTEST_INFO(msg); DOCTEST_REQUIRE_THROWS_WITH(expr, with); } while(false) +#define DOCTEST_WARN_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_WARN_THROWS_WITH_AS(expr, with, ex); } while(false) +#define DOCTEST_CHECK_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_CHECK_THROWS_WITH_AS(expr, with, ex); } while(false) +#define DOCTEST_REQUIRE_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) do { DOCTEST_INFO(msg); DOCTEST_REQUIRE_THROWS_WITH_AS(expr, with, ex); } while(false) +#define DOCTEST_WARN_NOTHROW_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_WARN_NOTHROW(expr); } while(false) +#define DOCTEST_CHECK_NOTHROW_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_CHECK_NOTHROW(expr); } while(false) +#define DOCTEST_REQUIRE_NOTHROW_MESSAGE(expr, msg) do { DOCTEST_INFO(msg); DOCTEST_REQUIRE_NOTHROW(expr); } while(false) +// clang-format on + +#ifndef DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +#define DOCTEST_BINARY_ASSERT(assert_type, comp, ...) \ + do { \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, #__VA_ARGS__); \ + DOCTEST_WRAP_IN_TRY( \ + _DOCTEST_RB.binary_assert( \ + __VA_ARGS__)) \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB); \ + } while(false) + +#define DOCTEST_UNARY_ASSERT(assert_type, ...) \ + do { \ + doctest::detail::ResultBuilder _DOCTEST_RB(doctest::assertType::assert_type, __FILE__, \ + __LINE__, #__VA_ARGS__); \ + DOCTEST_WRAP_IN_TRY(_DOCTEST_RB.unary_assert(__VA_ARGS__)) \ + DOCTEST_ASSERT_LOG_AND_REACT(_DOCTEST_RB); \ + } while(false) + +#else // DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +#define DOCTEST_BINARY_ASSERT(assert_type, comparison, ...) \ + doctest::detail::binary_assert( \ + doctest::assertType::assert_type, __FILE__, __LINE__, #__VA_ARGS__, __VA_ARGS__) + +#define DOCTEST_UNARY_ASSERT(assert_type, ...) \ + doctest::detail::unary_assert(doctest::assertType::assert_type, __FILE__, __LINE__, \ + #__VA_ARGS__, __VA_ARGS__) + +#endif // DOCTEST_CONFIG_SUPER_FAST_ASSERTS + +#define DOCTEST_WARN_EQ(...) DOCTEST_BINARY_ASSERT(DT_WARN_EQ, eq, __VA_ARGS__) +#define DOCTEST_CHECK_EQ(...) DOCTEST_BINARY_ASSERT(DT_CHECK_EQ, eq, __VA_ARGS__) +#define DOCTEST_REQUIRE_EQ(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_EQ, eq, __VA_ARGS__) +#define DOCTEST_WARN_NE(...) DOCTEST_BINARY_ASSERT(DT_WARN_NE, ne, __VA_ARGS__) +#define DOCTEST_CHECK_NE(...) DOCTEST_BINARY_ASSERT(DT_CHECK_NE, ne, __VA_ARGS__) +#define DOCTEST_REQUIRE_NE(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_NE, ne, __VA_ARGS__) +#define DOCTEST_WARN_GT(...) DOCTEST_BINARY_ASSERT(DT_WARN_GT, gt, __VA_ARGS__) +#define DOCTEST_CHECK_GT(...) DOCTEST_BINARY_ASSERT(DT_CHECK_GT, gt, __VA_ARGS__) +#define DOCTEST_REQUIRE_GT(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_GT, gt, __VA_ARGS__) +#define DOCTEST_WARN_LT(...) DOCTEST_BINARY_ASSERT(DT_WARN_LT, lt, __VA_ARGS__) +#define DOCTEST_CHECK_LT(...) DOCTEST_BINARY_ASSERT(DT_CHECK_LT, lt, __VA_ARGS__) +#define DOCTEST_REQUIRE_LT(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_LT, lt, __VA_ARGS__) +#define DOCTEST_WARN_GE(...) DOCTEST_BINARY_ASSERT(DT_WARN_GE, ge, __VA_ARGS__) +#define DOCTEST_CHECK_GE(...) DOCTEST_BINARY_ASSERT(DT_CHECK_GE, ge, __VA_ARGS__) +#define DOCTEST_REQUIRE_GE(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_GE, ge, __VA_ARGS__) +#define DOCTEST_WARN_LE(...) DOCTEST_BINARY_ASSERT(DT_WARN_LE, le, __VA_ARGS__) +#define DOCTEST_CHECK_LE(...) DOCTEST_BINARY_ASSERT(DT_CHECK_LE, le, __VA_ARGS__) +#define DOCTEST_REQUIRE_LE(...) DOCTEST_BINARY_ASSERT(DT_REQUIRE_LE, le, __VA_ARGS__) + +#define DOCTEST_WARN_UNARY(...) DOCTEST_UNARY_ASSERT(DT_WARN_UNARY, __VA_ARGS__) +#define DOCTEST_CHECK_UNARY(...) DOCTEST_UNARY_ASSERT(DT_CHECK_UNARY, __VA_ARGS__) +#define DOCTEST_REQUIRE_UNARY(...) DOCTEST_UNARY_ASSERT(DT_REQUIRE_UNARY, __VA_ARGS__) +#define DOCTEST_WARN_UNARY_FALSE(...) DOCTEST_UNARY_ASSERT(DT_WARN_UNARY_FALSE, __VA_ARGS__) +#define DOCTEST_CHECK_UNARY_FALSE(...) DOCTEST_UNARY_ASSERT(DT_CHECK_UNARY_FALSE, __VA_ARGS__) +#define DOCTEST_REQUIRE_UNARY_FALSE(...) DOCTEST_UNARY_ASSERT(DT_REQUIRE_UNARY_FALSE, __VA_ARGS__) + +#ifdef DOCTEST_CONFIG_NO_EXCEPTIONS + +#undef DOCTEST_WARN_THROWS +#undef DOCTEST_CHECK_THROWS +#undef DOCTEST_REQUIRE_THROWS +#undef DOCTEST_WARN_THROWS_AS +#undef DOCTEST_CHECK_THROWS_AS +#undef DOCTEST_REQUIRE_THROWS_AS +#undef DOCTEST_WARN_THROWS_WITH +#undef DOCTEST_CHECK_THROWS_WITH +#undef DOCTEST_REQUIRE_THROWS_WITH +#undef DOCTEST_WARN_THROWS_WITH_AS +#undef DOCTEST_CHECK_THROWS_WITH_AS +#undef DOCTEST_REQUIRE_THROWS_WITH_AS +#undef DOCTEST_WARN_NOTHROW +#undef DOCTEST_CHECK_NOTHROW +#undef DOCTEST_REQUIRE_NOTHROW + +#undef DOCTEST_WARN_THROWS_MESSAGE +#undef DOCTEST_CHECK_THROWS_MESSAGE +#undef DOCTEST_REQUIRE_THROWS_MESSAGE +#undef DOCTEST_WARN_THROWS_AS_MESSAGE +#undef DOCTEST_CHECK_THROWS_AS_MESSAGE +#undef DOCTEST_REQUIRE_THROWS_AS_MESSAGE +#undef DOCTEST_WARN_THROWS_WITH_MESSAGE +#undef DOCTEST_CHECK_THROWS_WITH_MESSAGE +#undef DOCTEST_REQUIRE_THROWS_WITH_MESSAGE +#undef DOCTEST_WARN_THROWS_WITH_AS_MESSAGE +#undef DOCTEST_CHECK_THROWS_WITH_AS_MESSAGE +#undef DOCTEST_REQUIRE_THROWS_WITH_AS_MESSAGE +#undef DOCTEST_WARN_NOTHROW_MESSAGE +#undef DOCTEST_CHECK_NOTHROW_MESSAGE +#undef DOCTEST_REQUIRE_NOTHROW_MESSAGE + +#ifdef DOCTEST_CONFIG_NO_EXCEPTIONS_BUT_WITH_ALL_ASSERTS + +#define DOCTEST_WARN_THROWS(...) ((void)0) +#define DOCTEST_CHECK_THROWS(...) ((void)0) +#define DOCTEST_REQUIRE_THROWS(...) ((void)0) +#define DOCTEST_WARN_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_WARN_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_WARN_NOTHROW(...) ((void)0) +#define DOCTEST_CHECK_NOTHROW(...) ((void)0) +#define DOCTEST_REQUIRE_NOTHROW(...) ((void)0) + +#define DOCTEST_WARN_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_WARN_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_WARN_NOTHROW_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_CHECK_NOTHROW_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_REQUIRE_NOTHROW_MESSAGE(expr, msg) ((void)0) + +#else // DOCTEST_CONFIG_NO_EXCEPTIONS_BUT_WITH_ALL_ASSERTS + +#undef DOCTEST_REQUIRE +#undef DOCTEST_REQUIRE_FALSE +#undef DOCTEST_REQUIRE_MESSAGE +#undef DOCTEST_REQUIRE_FALSE_MESSAGE +#undef DOCTEST_REQUIRE_EQ +#undef DOCTEST_REQUIRE_NE +#undef DOCTEST_REQUIRE_GT +#undef DOCTEST_REQUIRE_LT +#undef DOCTEST_REQUIRE_GE +#undef DOCTEST_REQUIRE_LE +#undef DOCTEST_REQUIRE_UNARY +#undef DOCTEST_REQUIRE_UNARY_FALSE + +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS_BUT_WITH_ALL_ASSERTS + +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + +// ================================================================================================= +// == WHAT FOLLOWS IS VERSIONS OF THE MACROS THAT DO NOT DO ANY REGISTERING! == +// == THIS CAN BE ENABLED BY DEFINING DOCTEST_CONFIG_DISABLE GLOBALLY! == +// ================================================================================================= +#else // DOCTEST_CONFIG_DISABLE + +#define DOCTEST_IMPLEMENT_FIXTURE(der, base, func, name) \ + namespace { \ + template \ + struct der : public base \ + { void f(); }; \ + } \ + template \ + inline void der::f() + +#define DOCTEST_CREATE_AND_REGISTER_FUNCTION(f, name) \ + template \ + static inline void f() + +// for registering tests +#define DOCTEST_TEST_CASE(name) \ + DOCTEST_CREATE_AND_REGISTER_FUNCTION(DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), name) + +// for registering tests in classes +#define DOCTEST_TEST_CASE_CLASS(name) \ + DOCTEST_CREATE_AND_REGISTER_FUNCTION(DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), name) + +// for registering tests with a fixture +#define DOCTEST_TEST_CASE_FIXTURE(x, name) \ + DOCTEST_IMPLEMENT_FIXTURE(DOCTEST_ANONYMOUS(_DOCTEST_ANON_CLASS_), x, \ + DOCTEST_ANONYMOUS(_DOCTEST_ANON_FUNC_), name) + +// for converting types to strings without the header and demangling +#define DOCTEST_TYPE_TO_STRING(...) typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) +#define DOCTEST_TYPE_TO_STRING_IMPL(...) + +// for typed tests +#define DOCTEST_TEST_CASE_TEMPLATE(name, type, ...) \ + template \ + inline void DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_)() + +#define DOCTEST_TEST_CASE_TEMPLATE_DEFINE(name, type, id) \ + template \ + inline void DOCTEST_ANONYMOUS(_DOCTEST_ANON_TMP_)() + +#define DOCTEST_TEST_CASE_TEMPLATE_INVOKE(id, ...) \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +#define DOCTEST_TEST_CASE_TEMPLATE_APPLY(id, ...) \ + typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for subcases +#define DOCTEST_SUBCASE(name) + +// for a testsuite block +#define DOCTEST_TEST_SUITE(name) namespace + +// for starting a testsuite block +#define DOCTEST_TEST_SUITE_BEGIN(name) typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +// for ending a testsuite block +#define DOCTEST_TEST_SUITE_END typedef int DOCTEST_ANONYMOUS(_DOCTEST_ANON_FOR_SEMICOLON_) + +#define DOCTEST_REGISTER_EXCEPTION_TRANSLATOR(signature) \ + template \ + static inline doctest::String DOCTEST_ANONYMOUS(_DOCTEST_ANON_TRANSLATOR_)(signature) + +#define DOCTEST_REGISTER_REPORTER(name, priority, reporter) +#define DOCTEST_REGISTER_LISTENER(name, priority, reporter) + +#define DOCTEST_INFO(x) ((void)0) +#define DOCTEST_CAPTURE(x) ((void)0) +#define DOCTEST_ADD_MESSAGE_AT(file, line, x) ((void)0) +#define DOCTEST_ADD_FAIL_CHECK_AT(file, line, x) ((void)0) +#define DOCTEST_ADD_FAIL_AT(file, line, x) ((void)0) +#define DOCTEST_MESSAGE(x) ((void)0) +#define DOCTEST_FAIL_CHECK(x) ((void)0) +#define DOCTEST_FAIL(x) ((void)0) + +#define DOCTEST_WARN(...) ((void)0) +#define DOCTEST_CHECK(...) ((void)0) +#define DOCTEST_REQUIRE(...) ((void)0) +#define DOCTEST_WARN_FALSE(...) ((void)0) +#define DOCTEST_CHECK_FALSE(...) ((void)0) +#define DOCTEST_REQUIRE_FALSE(...) ((void)0) + +#define DOCTEST_WARN_MESSAGE(cond, msg) ((void)0) +#define DOCTEST_CHECK_MESSAGE(cond, msg) ((void)0) +#define DOCTEST_REQUIRE_MESSAGE(cond, msg) ((void)0) +#define DOCTEST_WARN_FALSE_MESSAGE(cond, msg) ((void)0) +#define DOCTEST_CHECK_FALSE_MESSAGE(cond, msg) ((void)0) +#define DOCTEST_REQUIRE_FALSE_MESSAGE(cond, msg) ((void)0) + +#define DOCTEST_WARN_THROWS(...) ((void)0) +#define DOCTEST_CHECK_THROWS(...) ((void)0) +#define DOCTEST_REQUIRE_THROWS(...) ((void)0) +#define DOCTEST_WARN_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_AS(expr, ...) ((void)0) +#define DOCTEST_WARN_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH(expr, ...) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_AS(expr, with, ...) ((void)0) +#define DOCTEST_WARN_NOTHROW(...) ((void)0) +#define DOCTEST_CHECK_NOTHROW(...) ((void)0) +#define DOCTEST_REQUIRE_NOTHROW(...) ((void)0) + +#define DOCTEST_WARN_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_WARN_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_AS_MESSAGE(expr, ex, msg) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_MESSAGE(expr, with, msg) ((void)0) +#define DOCTEST_WARN_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_CHECK_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_REQUIRE_THROWS_WITH_AS_MESSAGE(expr, with, ex, msg) ((void)0) +#define DOCTEST_WARN_NOTHROW_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_CHECK_NOTHROW_MESSAGE(expr, msg) ((void)0) +#define DOCTEST_REQUIRE_NOTHROW_MESSAGE(expr, msg) ((void)0) + +#define DOCTEST_WARN_EQ(...) ((void)0) +#define DOCTEST_CHECK_EQ(...) ((void)0) +#define DOCTEST_REQUIRE_EQ(...) ((void)0) +#define DOCTEST_WARN_NE(...) ((void)0) +#define DOCTEST_CHECK_NE(...) ((void)0) +#define DOCTEST_REQUIRE_NE(...) ((void)0) +#define DOCTEST_WARN_GT(...) ((void)0) +#define DOCTEST_CHECK_GT(...) ((void)0) +#define DOCTEST_REQUIRE_GT(...) ((void)0) +#define DOCTEST_WARN_LT(...) ((void)0) +#define DOCTEST_CHECK_LT(...) ((void)0) +#define DOCTEST_REQUIRE_LT(...) ((void)0) +#define DOCTEST_WARN_GE(...) ((void)0) +#define DOCTEST_CHECK_GE(...) ((void)0) +#define DOCTEST_REQUIRE_GE(...) ((void)0) +#define DOCTEST_WARN_LE(...) ((void)0) +#define DOCTEST_CHECK_LE(...) ((void)0) +#define DOCTEST_REQUIRE_LE(...) ((void)0) + +#define DOCTEST_WARN_UNARY(...) ((void)0) +#define DOCTEST_CHECK_UNARY(...) ((void)0) +#define DOCTEST_REQUIRE_UNARY(...) ((void)0) +#define DOCTEST_WARN_UNARY_FALSE(...) ((void)0) +#define DOCTEST_CHECK_UNARY_FALSE(...) ((void)0) +#define DOCTEST_REQUIRE_UNARY_FALSE(...) ((void)0) + +#endif // DOCTEST_CONFIG_DISABLE + +// clang-format off +// KEPT FOR BACKWARDS COMPATIBILITY - FORWARDING TO THE RIGHT MACROS +#define DOCTEST_FAST_WARN_EQ DOCTEST_WARN_EQ +#define DOCTEST_FAST_CHECK_EQ DOCTEST_CHECK_EQ +#define DOCTEST_FAST_REQUIRE_EQ DOCTEST_REQUIRE_EQ +#define DOCTEST_FAST_WARN_NE DOCTEST_WARN_NE +#define DOCTEST_FAST_CHECK_NE DOCTEST_CHECK_NE +#define DOCTEST_FAST_REQUIRE_NE DOCTEST_REQUIRE_NE +#define DOCTEST_FAST_WARN_GT DOCTEST_WARN_GT +#define DOCTEST_FAST_CHECK_GT DOCTEST_CHECK_GT +#define DOCTEST_FAST_REQUIRE_GT DOCTEST_REQUIRE_GT +#define DOCTEST_FAST_WARN_LT DOCTEST_WARN_LT +#define DOCTEST_FAST_CHECK_LT DOCTEST_CHECK_LT +#define DOCTEST_FAST_REQUIRE_LT DOCTEST_REQUIRE_LT +#define DOCTEST_FAST_WARN_GE DOCTEST_WARN_GE +#define DOCTEST_FAST_CHECK_GE DOCTEST_CHECK_GE +#define DOCTEST_FAST_REQUIRE_GE DOCTEST_REQUIRE_GE +#define DOCTEST_FAST_WARN_LE DOCTEST_WARN_LE +#define DOCTEST_FAST_CHECK_LE DOCTEST_CHECK_LE +#define DOCTEST_FAST_REQUIRE_LE DOCTEST_REQUIRE_LE + +#define DOCTEST_FAST_WARN_UNARY DOCTEST_WARN_UNARY +#define DOCTEST_FAST_CHECK_UNARY DOCTEST_CHECK_UNARY +#define DOCTEST_FAST_REQUIRE_UNARY DOCTEST_REQUIRE_UNARY +#define DOCTEST_FAST_WARN_UNARY_FALSE DOCTEST_WARN_UNARY_FALSE +#define DOCTEST_FAST_CHECK_UNARY_FALSE DOCTEST_CHECK_UNARY_FALSE +#define DOCTEST_FAST_REQUIRE_UNARY_FALSE DOCTEST_REQUIRE_UNARY_FALSE + +#define DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE DOCTEST_TEST_CASE_TEMPLATE_INVOKE +// clang-format on + +// BDD style macros +// clang-format off +#define DOCTEST_SCENARIO(name) DOCTEST_TEST_CASE(" Scenario: " name) +#define DOCTEST_SCENARIO_CLASS(name) DOCTEST_TEST_CASE_CLASS(" Scenario: " name) +#define DOCTEST_SCENARIO_TEMPLATE(name, T, ...) DOCTEST_TEST_CASE_TEMPLATE(" Scenario: " name, T, __VA_ARGS__) +#define DOCTEST_SCENARIO_TEMPLATE_DEFINE(name, T, id) DOCTEST_TEST_CASE_TEMPLATE_DEFINE(" Scenario: " name, T, id) + +#define DOCTEST_GIVEN(name) DOCTEST_SUBCASE(" Given: " name) +#define DOCTEST_WHEN(name) DOCTEST_SUBCASE(" When: " name) +#define DOCTEST_AND_WHEN(name) DOCTEST_SUBCASE("And when: " name) +#define DOCTEST_THEN(name) DOCTEST_SUBCASE(" Then: " name) +#define DOCTEST_AND_THEN(name) DOCTEST_SUBCASE(" And: " name) +// clang-format on + +// == SHORT VERSIONS OF THE MACROS +#if !defined(DOCTEST_CONFIG_NO_SHORT_MACRO_NAMES) + +#define TEST_CASE DOCTEST_TEST_CASE +#define TEST_CASE_CLASS DOCTEST_TEST_CASE_CLASS +#define TEST_CASE_FIXTURE DOCTEST_TEST_CASE_FIXTURE +#define TYPE_TO_STRING DOCTEST_TYPE_TO_STRING +#define TEST_CASE_TEMPLATE DOCTEST_TEST_CASE_TEMPLATE +#define TEST_CASE_TEMPLATE_DEFINE DOCTEST_TEST_CASE_TEMPLATE_DEFINE +#define TEST_CASE_TEMPLATE_INVOKE DOCTEST_TEST_CASE_TEMPLATE_INVOKE +#define TEST_CASE_TEMPLATE_APPLY DOCTEST_TEST_CASE_TEMPLATE_APPLY +#define SUBCASE DOCTEST_SUBCASE +#define TEST_SUITE DOCTEST_TEST_SUITE +#define TEST_SUITE_BEGIN DOCTEST_TEST_SUITE_BEGIN +#define TEST_SUITE_END DOCTEST_TEST_SUITE_END +#define REGISTER_EXCEPTION_TRANSLATOR DOCTEST_REGISTER_EXCEPTION_TRANSLATOR +#define REGISTER_REPORTER DOCTEST_REGISTER_REPORTER +#define REGISTER_LISTENER DOCTEST_REGISTER_LISTENER +#define INFO DOCTEST_INFO +#define CAPTURE DOCTEST_CAPTURE +#define ADD_MESSAGE_AT DOCTEST_ADD_MESSAGE_AT +#define ADD_FAIL_CHECK_AT DOCTEST_ADD_FAIL_CHECK_AT +#define ADD_FAIL_AT DOCTEST_ADD_FAIL_AT +#define MESSAGE DOCTEST_MESSAGE +#define FAIL_CHECK DOCTEST_FAIL_CHECK +#define FAIL DOCTEST_FAIL +#define TO_LVALUE DOCTEST_TO_LVALUE + +#define WARN DOCTEST_WARN +#define WARN_FALSE DOCTEST_WARN_FALSE +#define WARN_THROWS DOCTEST_WARN_THROWS +#define WARN_THROWS_AS DOCTEST_WARN_THROWS_AS +#define WARN_THROWS_WITH DOCTEST_WARN_THROWS_WITH +#define WARN_THROWS_WITH_AS DOCTEST_WARN_THROWS_WITH_AS +#define WARN_NOTHROW DOCTEST_WARN_NOTHROW +#define CHECK DOCTEST_CHECK +#define CHECK_FALSE DOCTEST_CHECK_FALSE +#define CHECK_THROWS DOCTEST_CHECK_THROWS +#define CHECK_THROWS_AS DOCTEST_CHECK_THROWS_AS +#define CHECK_THROWS_WITH DOCTEST_CHECK_THROWS_WITH +#define CHECK_THROWS_WITH_AS DOCTEST_CHECK_THROWS_WITH_AS +#define CHECK_NOTHROW DOCTEST_CHECK_NOTHROW +#define REQUIRE DOCTEST_REQUIRE +#define REQUIRE_FALSE DOCTEST_REQUIRE_FALSE +#define REQUIRE_THROWS DOCTEST_REQUIRE_THROWS +#define REQUIRE_THROWS_AS DOCTEST_REQUIRE_THROWS_AS +#define REQUIRE_THROWS_WITH DOCTEST_REQUIRE_THROWS_WITH +#define REQUIRE_THROWS_WITH_AS DOCTEST_REQUIRE_THROWS_WITH_AS +#define REQUIRE_NOTHROW DOCTEST_REQUIRE_NOTHROW + +#define WARN_MESSAGE DOCTEST_WARN_MESSAGE +#define WARN_FALSE_MESSAGE DOCTEST_WARN_FALSE_MESSAGE +#define WARN_THROWS_MESSAGE DOCTEST_WARN_THROWS_MESSAGE +#define WARN_THROWS_AS_MESSAGE DOCTEST_WARN_THROWS_AS_MESSAGE +#define WARN_THROWS_WITH_MESSAGE DOCTEST_WARN_THROWS_WITH_MESSAGE +#define WARN_THROWS_WITH_AS_MESSAGE DOCTEST_WARN_THROWS_WITH_AS_MESSAGE +#define WARN_NOTHROW_MESSAGE DOCTEST_WARN_NOTHROW_MESSAGE +#define CHECK_MESSAGE DOCTEST_CHECK_MESSAGE +#define CHECK_FALSE_MESSAGE DOCTEST_CHECK_FALSE_MESSAGE +#define CHECK_THROWS_MESSAGE DOCTEST_CHECK_THROWS_MESSAGE +#define CHECK_THROWS_AS_MESSAGE DOCTEST_CHECK_THROWS_AS_MESSAGE +#define CHECK_THROWS_WITH_MESSAGE DOCTEST_CHECK_THROWS_WITH_MESSAGE +#define CHECK_THROWS_WITH_AS_MESSAGE DOCTEST_CHECK_THROWS_WITH_AS_MESSAGE +#define CHECK_NOTHROW_MESSAGE DOCTEST_CHECK_NOTHROW_MESSAGE +#define REQUIRE_MESSAGE DOCTEST_REQUIRE_MESSAGE +#define REQUIRE_FALSE_MESSAGE DOCTEST_REQUIRE_FALSE_MESSAGE +#define REQUIRE_THROWS_MESSAGE DOCTEST_REQUIRE_THROWS_MESSAGE +#define REQUIRE_THROWS_AS_MESSAGE DOCTEST_REQUIRE_THROWS_AS_MESSAGE +#define REQUIRE_THROWS_WITH_MESSAGE DOCTEST_REQUIRE_THROWS_WITH_MESSAGE +#define REQUIRE_THROWS_WITH_AS_MESSAGE DOCTEST_REQUIRE_THROWS_WITH_AS_MESSAGE +#define REQUIRE_NOTHROW_MESSAGE DOCTEST_REQUIRE_NOTHROW_MESSAGE + +#define SCENARIO DOCTEST_SCENARIO +#define SCENARIO_CLASS DOCTEST_SCENARIO_CLASS +#define SCENARIO_TEMPLATE DOCTEST_SCENARIO_TEMPLATE +#define SCENARIO_TEMPLATE_DEFINE DOCTEST_SCENARIO_TEMPLATE_DEFINE +#define GIVEN DOCTEST_GIVEN +#define WHEN DOCTEST_WHEN +#define AND_WHEN DOCTEST_AND_WHEN +#define THEN DOCTEST_THEN +#define AND_THEN DOCTEST_AND_THEN + +#define WARN_EQ DOCTEST_WARN_EQ +#define CHECK_EQ DOCTEST_CHECK_EQ +#define REQUIRE_EQ DOCTEST_REQUIRE_EQ +#define WARN_NE DOCTEST_WARN_NE +#define CHECK_NE DOCTEST_CHECK_NE +#define REQUIRE_NE DOCTEST_REQUIRE_NE +#define WARN_GT DOCTEST_WARN_GT +#define CHECK_GT DOCTEST_CHECK_GT +#define REQUIRE_GT DOCTEST_REQUIRE_GT +#define WARN_LT DOCTEST_WARN_LT +#define CHECK_LT DOCTEST_CHECK_LT +#define REQUIRE_LT DOCTEST_REQUIRE_LT +#define WARN_GE DOCTEST_WARN_GE +#define CHECK_GE DOCTEST_CHECK_GE +#define REQUIRE_GE DOCTEST_REQUIRE_GE +#define WARN_LE DOCTEST_WARN_LE +#define CHECK_LE DOCTEST_CHECK_LE +#define REQUIRE_LE DOCTEST_REQUIRE_LE +#define WARN_UNARY DOCTEST_WARN_UNARY +#define CHECK_UNARY DOCTEST_CHECK_UNARY +#define REQUIRE_UNARY DOCTEST_REQUIRE_UNARY +#define WARN_UNARY_FALSE DOCTEST_WARN_UNARY_FALSE +#define CHECK_UNARY_FALSE DOCTEST_CHECK_UNARY_FALSE +#define REQUIRE_UNARY_FALSE DOCTEST_REQUIRE_UNARY_FALSE + +// KEPT FOR BACKWARDS COMPATIBILITY +#define FAST_WARN_EQ DOCTEST_FAST_WARN_EQ +#define FAST_CHECK_EQ DOCTEST_FAST_CHECK_EQ +#define FAST_REQUIRE_EQ DOCTEST_FAST_REQUIRE_EQ +#define FAST_WARN_NE DOCTEST_FAST_WARN_NE +#define FAST_CHECK_NE DOCTEST_FAST_CHECK_NE +#define FAST_REQUIRE_NE DOCTEST_FAST_REQUIRE_NE +#define FAST_WARN_GT DOCTEST_FAST_WARN_GT +#define FAST_CHECK_GT DOCTEST_FAST_CHECK_GT +#define FAST_REQUIRE_GT DOCTEST_FAST_REQUIRE_GT +#define FAST_WARN_LT DOCTEST_FAST_WARN_LT +#define FAST_CHECK_LT DOCTEST_FAST_CHECK_LT +#define FAST_REQUIRE_LT DOCTEST_FAST_REQUIRE_LT +#define FAST_WARN_GE DOCTEST_FAST_WARN_GE +#define FAST_CHECK_GE DOCTEST_FAST_CHECK_GE +#define FAST_REQUIRE_GE DOCTEST_FAST_REQUIRE_GE +#define FAST_WARN_LE DOCTEST_FAST_WARN_LE +#define FAST_CHECK_LE DOCTEST_FAST_CHECK_LE +#define FAST_REQUIRE_LE DOCTEST_FAST_REQUIRE_LE + +#define FAST_WARN_UNARY DOCTEST_FAST_WARN_UNARY +#define FAST_CHECK_UNARY DOCTEST_FAST_CHECK_UNARY +#define FAST_REQUIRE_UNARY DOCTEST_FAST_REQUIRE_UNARY +#define FAST_WARN_UNARY_FALSE DOCTEST_FAST_WARN_UNARY_FALSE +#define FAST_CHECK_UNARY_FALSE DOCTEST_FAST_CHECK_UNARY_FALSE +#define FAST_REQUIRE_UNARY_FALSE DOCTEST_FAST_REQUIRE_UNARY_FALSE + +#define TEST_CASE_TEMPLATE_INSTANTIATE DOCTEST_TEST_CASE_TEMPLATE_INSTANTIATE + +#endif // DOCTEST_CONFIG_NO_SHORT_MACRO_NAMES + +#if !defined(DOCTEST_CONFIG_DISABLE) + +// this is here to clear the 'current test suite' for the current translation unit - at the top +DOCTEST_TEST_SUITE_END(); + +// add stringification for primitive/fundamental types +namespace doctest { namespace detail { + DOCTEST_TYPE_TO_STRING_IMPL(bool) + DOCTEST_TYPE_TO_STRING_IMPL(float) + DOCTEST_TYPE_TO_STRING_IMPL(double) + DOCTEST_TYPE_TO_STRING_IMPL(long double) + DOCTEST_TYPE_TO_STRING_IMPL(char) + DOCTEST_TYPE_TO_STRING_IMPL(signed char) + DOCTEST_TYPE_TO_STRING_IMPL(unsigned char) +#if !DOCTEST_MSVC || defined(_NATIVE_WCHAR_T_DEFINED) + DOCTEST_TYPE_TO_STRING_IMPL(wchar_t) +#endif // not MSVC or wchar_t support enabled + DOCTEST_TYPE_TO_STRING_IMPL(short int) + DOCTEST_TYPE_TO_STRING_IMPL(unsigned short int) + DOCTEST_TYPE_TO_STRING_IMPL(int) + DOCTEST_TYPE_TO_STRING_IMPL(unsigned int) + DOCTEST_TYPE_TO_STRING_IMPL(long int) + DOCTEST_TYPE_TO_STRING_IMPL(unsigned long int) + DOCTEST_TYPE_TO_STRING_IMPL(long long int) + DOCTEST_TYPE_TO_STRING_IMPL(unsigned long long int) +}} // namespace doctest::detail + +#endif // DOCTEST_CONFIG_DISABLE + +DOCTEST_CLANG_SUPPRESS_WARNING_POP +DOCTEST_MSVC_SUPPRESS_WARNING_POP +DOCTEST_GCC_SUPPRESS_WARNING_POP + +#endif // DOCTEST_LIBRARY_INCLUDED + +#ifndef DOCTEST_SINGLE_HEADER +#define DOCTEST_SINGLE_HEADER +#endif // DOCTEST_SINGLE_HEADER + +#if defined(DOCTEST_CONFIG_IMPLEMENT) || !defined(DOCTEST_SINGLE_HEADER) + +#ifndef DOCTEST_SINGLE_HEADER +#include "doctest_fwd.h" +#endif // DOCTEST_SINGLE_HEADER + +DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wunused-macros") + +#ifndef DOCTEST_LIBRARY_IMPLEMENTATION +#define DOCTEST_LIBRARY_IMPLEMENTATION + +DOCTEST_CLANG_SUPPRESS_WARNING_POP + +DOCTEST_CLANG_SUPPRESS_WARNING_PUSH +DOCTEST_CLANG_SUPPRESS_WARNING("-Wunknown-pragmas") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wpadded") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wweak-vtables") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wglobal-constructors") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wexit-time-destructors") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-prototypes") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wsign-conversion") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wshorten-64-to-32") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-variable-declarations") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wswitch") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wswitch-enum") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wcovered-switch-default") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-noreturn") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wunused-local-typedef") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wdisabled-macro-expansion") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-braces") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wmissing-field-initializers") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wc++98-compat") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wc++98-compat-pedantic") +DOCTEST_CLANG_SUPPRESS_WARNING("-Wunused-member-function") + +DOCTEST_GCC_SUPPRESS_WARNING_PUSH +DOCTEST_GCC_SUPPRESS_WARNING("-Wunknown-pragmas") +DOCTEST_GCC_SUPPRESS_WARNING("-Wpragmas") +DOCTEST_GCC_SUPPRESS_WARNING("-Wconversion") +DOCTEST_GCC_SUPPRESS_WARNING("-Weffc++") +DOCTEST_GCC_SUPPRESS_WARNING("-Wsign-conversion") +DOCTEST_GCC_SUPPRESS_WARNING("-Wstrict-overflow") +DOCTEST_GCC_SUPPRESS_WARNING("-Wstrict-aliasing") +DOCTEST_GCC_SUPPRESS_WARNING("-Wmissing-field-initializers") +DOCTEST_GCC_SUPPRESS_WARNING("-Wmissing-braces") +DOCTEST_GCC_SUPPRESS_WARNING("-Wmissing-declarations") +DOCTEST_GCC_SUPPRESS_WARNING("-Wswitch") +DOCTEST_GCC_SUPPRESS_WARNING("-Wswitch-enum") +DOCTEST_GCC_SUPPRESS_WARNING("-Wswitch-default") +DOCTEST_GCC_SUPPRESS_WARNING("-Wunsafe-loop-optimizations") +DOCTEST_GCC_SUPPRESS_WARNING("-Wold-style-cast") +DOCTEST_GCC_SUPPRESS_WARNING("-Wunused-local-typedefs") +DOCTEST_GCC_SUPPRESS_WARNING("-Wuseless-cast") +DOCTEST_GCC_SUPPRESS_WARNING("-Wunused-function") +DOCTEST_GCC_SUPPRESS_WARNING("-Wmultiple-inheritance") +DOCTEST_GCC_SUPPRESS_WARNING("-Wnoexcept") +DOCTEST_GCC_SUPPRESS_WARNING("-Wsuggest-attribute") + +DOCTEST_MSVC_SUPPRESS_WARNING_PUSH +DOCTEST_MSVC_SUPPRESS_WARNING(4616) // invalid compiler warning +DOCTEST_MSVC_SUPPRESS_WARNING(4619) // invalid compiler warning +DOCTEST_MSVC_SUPPRESS_WARNING(4996) // The compiler encountered a deprecated declaration +DOCTEST_MSVC_SUPPRESS_WARNING(4267) // 'var' : conversion from 'x' to 'y', possible loss of data +DOCTEST_MSVC_SUPPRESS_WARNING(4706) // assignment within conditional expression +DOCTEST_MSVC_SUPPRESS_WARNING(4512) // 'class' : assignment operator could not be generated +DOCTEST_MSVC_SUPPRESS_WARNING(4127) // conditional expression is constant +DOCTEST_MSVC_SUPPRESS_WARNING(4530) // C++ exception handler used, but unwind semantics not enabled +DOCTEST_MSVC_SUPPRESS_WARNING(4577) // 'noexcept' used with no exception handling mode specified +DOCTEST_MSVC_SUPPRESS_WARNING(4774) // format string expected in argument is not a string literal +DOCTEST_MSVC_SUPPRESS_WARNING(4365) // conversion from 'int' to 'unsigned', signed/unsigned mismatch +DOCTEST_MSVC_SUPPRESS_WARNING(4820) // padding in structs +DOCTEST_MSVC_SUPPRESS_WARNING(4640) // construction of local static object is not thread-safe +DOCTEST_MSVC_SUPPRESS_WARNING(5039) // pointer to potentially throwing function passed to extern C +DOCTEST_MSVC_SUPPRESS_WARNING(5045) // Spectre mitigation stuff +DOCTEST_MSVC_SUPPRESS_WARNING(4626) // assignment operator was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(5027) // move assignment operator was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(5026) // move constructor was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(4625) // copy constructor was implicitly defined as deleted +DOCTEST_MSVC_SUPPRESS_WARNING(4800) // forcing value to bool 'true' or 'false' (performance warning) +// static analysis +DOCTEST_MSVC_SUPPRESS_WARNING(26439) // This kind of function may not throw. Declare it 'noexcept' +DOCTEST_MSVC_SUPPRESS_WARNING(26495) // Always initialize a member variable +DOCTEST_MSVC_SUPPRESS_WARNING(26451) // Arithmetic overflow ... +DOCTEST_MSVC_SUPPRESS_WARNING(26444) // Avoid unnamed objects with custom construction and dtor... +DOCTEST_MSVC_SUPPRESS_WARNING(26812) // Prefer 'enum class' over 'enum' + +DOCTEST_MAKE_STD_HEADERS_CLEAN_FROM_WARNINGS_ON_WALL_BEGIN + +// required includes - will go only in one translation unit! +#include +#include +#include +// borland (Embarcadero) compiler requires math.h and not cmath - https://github.com/onqtam/doctest/pull/37 +#ifdef __BORLANDC__ +#include +#endif // __BORLANDC__ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#ifdef DOCTEST_CONFIG_POSIX_SIGNALS +#include +#endif // DOCTEST_CONFIG_POSIX_SIGNALS +#include +#include +#include + +#ifdef DOCTEST_PLATFORM_MAC +#include +#include +#include +#endif // DOCTEST_PLATFORM_MAC + +#ifdef DOCTEST_PLATFORM_WINDOWS + +// defines for a leaner windows.h +#ifndef WIN32_LEAN_AND_MEAN +#define WIN32_LEAN_AND_MEAN +#endif // WIN32_LEAN_AND_MEAN +#ifndef NOMINMAX +#define NOMINMAX +#endif // NOMINMAX + +// not sure what AfxWin.h is for - here I do what Catch does +#ifdef __AFXDLL +#include +#else +#if defined(__MINGW32__) || defined(__MINGW64__) +#include +#else // MINGW +#include +#endif // MINGW +#endif +#include + +#else // DOCTEST_PLATFORM_WINDOWS + +#include +#include + +#endif // DOCTEST_PLATFORM_WINDOWS + +// this is a fix for https://github.com/onqtam/doctest/issues/348 +// https://mail.gnome.org/archives/xml/2012-January/msg00000.html +#if !defined(HAVE_UNISTD_H) && !defined(STDOUT_FILENO) +#define STDOUT_FILENO fileno(stdout) +#endif // HAVE_UNISTD_H + +DOCTEST_MAKE_STD_HEADERS_CLEAN_FROM_WARNINGS_ON_WALL_END + +// counts the number of elements in a C array +#define DOCTEST_COUNTOF(x) (sizeof(x) / sizeof(x[0])) + +#ifdef DOCTEST_CONFIG_DISABLE +#define DOCTEST_BRANCH_ON_DISABLED(if_disabled, if_not_disabled) if_disabled +#else // DOCTEST_CONFIG_DISABLE +#define DOCTEST_BRANCH_ON_DISABLED(if_disabled, if_not_disabled) if_not_disabled +#endif // DOCTEST_CONFIG_DISABLE + +#ifndef DOCTEST_CONFIG_OPTIONS_PREFIX +#define DOCTEST_CONFIG_OPTIONS_PREFIX "dt-" +#endif + +#ifndef DOCTEST_THREAD_LOCAL +#define DOCTEST_THREAD_LOCAL thread_local +#endif + +#ifdef DOCTEST_CONFIG_NO_UNPREFIXED_OPTIONS +#define DOCTEST_OPTIONS_PREFIX_DISPLAY DOCTEST_CONFIG_OPTIONS_PREFIX +#else +#define DOCTEST_OPTIONS_PREFIX_DISPLAY "" +#endif + +namespace doctest { + +bool is_running_in_test = false; + +namespace { + using namespace detail; + // case insensitive strcmp + int stricmp(const char* a, const char* b) { + for(;; a++, b++) { + const int d = tolower(*a) - tolower(*b); + if(d != 0 || !*a) + return d; + } + } + + template + String fpToString(T value, int precision) { + std::ostringstream oss; + oss << std::setprecision(precision) << std::fixed << value; + std::string d = oss.str(); + size_t i = d.find_last_not_of('0'); + if(i != std::string::npos && i != d.size() - 1) { + if(d[i] == '.') + i++; + d = d.substr(0, i + 1); + } + return d.c_str(); + } + + struct Endianness + { + enum Arch + { + Big, + Little + }; + + static Arch which() { + int x = 1; + // casting any data pointer to char* is allowed + auto ptr = reinterpret_cast(&x); + if(*ptr) + return Little; + return Big; + } + }; +} // namespace + +namespace detail { + void my_memcpy(void* dest, const void* src, unsigned num) { memcpy(dest, src, num); } + + String rawMemoryToString(const void* object, unsigned size) { + // Reverse order for little endian architectures + int i = 0, end = static_cast(size), inc = 1; + if(Endianness::which() == Endianness::Little) { + i = end - 1; + end = inc = -1; + } + + unsigned const char* bytes = static_cast(object); + std::ostringstream oss; + oss << "0x" << std::setfill('0') << std::hex; + for(; i != end; i += inc) + oss << std::setw(2) << static_cast(bytes[i]); + return oss.str().c_str(); + } + + DOCTEST_THREAD_LOCAL std::ostringstream g_oss; // NOLINT(cert-err58-cpp) + + std::ostream* getTlsOss() { + g_oss.clear(); // there shouldn't be anything worth clearing in the flags + g_oss.str(""); // the slow way of resetting a string stream + //g_oss.seekp(0); // optimal reset - as seen here: https://stackoverflow.com/a/624291/3162383 + return &g_oss; + } + + String getTlsOssResult() { + //g_oss << std::ends; // needed - as shown here: https://stackoverflow.com/a/624291/3162383 + return g_oss.str().c_str(); + } + +#ifndef DOCTEST_CONFIG_DISABLE + +namespace timer_large_integer +{ + +#if defined(DOCTEST_PLATFORM_WINDOWS) + typedef ULONGLONG type; +#else // DOCTEST_PLATFORM_WINDOWS + using namespace std; + typedef uint64_t type; +#endif // DOCTEST_PLATFORM_WINDOWS +} + +typedef timer_large_integer::type ticks_t; + +#ifdef DOCTEST_CONFIG_GETCURRENTTICKS + ticks_t getCurrentTicks() { return DOCTEST_CONFIG_GETCURRENTTICKS(); } +#elif defined(DOCTEST_PLATFORM_WINDOWS) + ticks_t getCurrentTicks() { + static LARGE_INTEGER hz = {0}, hzo = {0}; + if(!hz.QuadPart) { + QueryPerformanceFrequency(&hz); + QueryPerformanceCounter(&hzo); + } + LARGE_INTEGER t; + QueryPerformanceCounter(&t); + return ((t.QuadPart - hzo.QuadPart) * LONGLONG(1000000)) / hz.QuadPart; + } +#else // DOCTEST_PLATFORM_WINDOWS + ticks_t getCurrentTicks() { + timeval t; + gettimeofday(&t, nullptr); + return static_cast(t.tv_sec) * 1000000 + static_cast(t.tv_usec); + } +#endif // DOCTEST_PLATFORM_WINDOWS + + struct Timer + { + void start() { m_ticks = getCurrentTicks(); } + unsigned int getElapsedMicroseconds() const { + return static_cast(getCurrentTicks() - m_ticks); + } + //unsigned int getElapsedMilliseconds() const { + // return static_cast(getElapsedMicroseconds() / 1000); + //} + double getElapsedSeconds() const { return static_cast(getCurrentTicks() - m_ticks) / 1000000.0; } + + private: + ticks_t m_ticks = 0; + }; + + // this holds both parameters from the command line and runtime data for tests + struct ContextState : ContextOptions, TestRunStats, CurrentTestCaseStats + { + std::atomic numAssertsCurrentTest_atomic; + std::atomic numAssertsFailedCurrentTest_atomic; + + std::vector> filters = decltype(filters)(9); // 9 different filters + + std::vector reporters_currently_used; + + const TestCase* currentTest = nullptr; + + assert_handler ah = nullptr; + + Timer timer; + + std::vector stringifiedContexts; // logging from INFO() due to an exception + + // stuff for subcases + std::vector subcasesStack; + std::set subcasesPassed; + int subcasesCurrentMaxLevel; + bool should_reenter; + std::atomic shouldLogCurrentException; + + void resetRunData() { + numTestCases = 0; + numTestCasesPassingFilters = 0; + numTestSuitesPassingFilters = 0; + numTestCasesFailed = 0; + numAsserts = 0; + numAssertsFailed = 0; + numAssertsCurrentTest = 0; + numAssertsFailedCurrentTest = 0; + } + + void finalizeTestCaseData() { + seconds = timer.getElapsedSeconds(); + + // update the non-atomic counters + numAsserts += numAssertsCurrentTest_atomic; + numAssertsFailed += numAssertsFailedCurrentTest_atomic; + numAssertsCurrentTest = numAssertsCurrentTest_atomic; + numAssertsFailedCurrentTest = numAssertsFailedCurrentTest_atomic; + + if(numAssertsFailedCurrentTest) + failure_flags |= TestCaseFailureReason::AssertFailure; + + if(Approx(currentTest->m_timeout).epsilon(DBL_EPSILON) != 0 && + Approx(seconds).epsilon(DBL_EPSILON) > currentTest->m_timeout) + failure_flags |= TestCaseFailureReason::Timeout; + + if(currentTest->m_should_fail) { + if(failure_flags) { + failure_flags |= TestCaseFailureReason::ShouldHaveFailedAndDid; + } else { + failure_flags |= TestCaseFailureReason::ShouldHaveFailedButDidnt; + } + } else if(failure_flags && currentTest->m_may_fail) { + failure_flags |= TestCaseFailureReason::CouldHaveFailedAndDid; + } else if(currentTest->m_expected_failures > 0) { + if(numAssertsFailedCurrentTest == currentTest->m_expected_failures) { + failure_flags |= TestCaseFailureReason::FailedExactlyNumTimes; + } else { + failure_flags |= TestCaseFailureReason::DidntFailExactlyNumTimes; + } + } + + bool ok_to_fail = (TestCaseFailureReason::ShouldHaveFailedAndDid & failure_flags) || + (TestCaseFailureReason::CouldHaveFailedAndDid & failure_flags) || + (TestCaseFailureReason::FailedExactlyNumTimes & failure_flags); + + // if any subcase has failed - the whole test case has failed + if(failure_flags && !ok_to_fail) + numTestCasesFailed++; + } + }; + + ContextState* g_cs = nullptr; + + // used to avoid locks for the debug output + // TODO: figure out if this is indeed necessary/correct - seems like either there still + // could be a race or that there wouldn't be a race even if using the context directly + DOCTEST_THREAD_LOCAL bool g_no_colors; + +#endif // DOCTEST_CONFIG_DISABLE +} // namespace detail + +void String::setOnHeap() { *reinterpret_cast(&buf[last]) = 128; } +void String::setLast(unsigned in) { buf[last] = char(in); } + +void String::copy(const String& other) { + using namespace std; + if(other.isOnStack()) { + memcpy(buf, other.buf, len); + } else { + setOnHeap(); + data.size = other.data.size; + data.capacity = data.size + 1; + data.ptr = new char[data.capacity]; + memcpy(data.ptr, other.data.ptr, data.size + 1); + } +} + +String::String() { + buf[0] = '\0'; + setLast(); +} + +String::~String() { + if(!isOnStack()) + delete[] data.ptr; +} + +String::String(const char* in) + : String(in, strlen(in)) {} + +String::String(const char* in, unsigned in_size) { + using namespace std; + if(in_size <= last) { + memcpy(buf, in, in_size + 1); + setLast(last - in_size); + } else { + setOnHeap(); + data.size = in_size; + data.capacity = data.size + 1; + data.ptr = new char[data.capacity]; + memcpy(data.ptr, in, in_size + 1); + } +} + +String::String(const String& other) { copy(other); } + +String& String::operator=(const String& other) { + if(this != &other) { + if(!isOnStack()) + delete[] data.ptr; + + copy(other); + } + + return *this; +} + +String& String::operator+=(const String& other) { + const unsigned my_old_size = size(); + const unsigned other_size = other.size(); + const unsigned total_size = my_old_size + other_size; + using namespace std; + if(isOnStack()) { + if(total_size < len) { + // append to the current stack space + memcpy(buf + my_old_size, other.c_str(), other_size + 1); + setLast(last - total_size); + } else { + // alloc new chunk + char* temp = new char[total_size + 1]; + // copy current data to new location before writing in the union + memcpy(temp, buf, my_old_size); // skip the +1 ('\0') for speed + // update data in union + setOnHeap(); + data.size = total_size; + data.capacity = data.size + 1; + data.ptr = temp; + // transfer the rest of the data + memcpy(data.ptr + my_old_size, other.c_str(), other_size + 1); + } + } else { + if(data.capacity > total_size) { + // append to the current heap block + data.size = total_size; + memcpy(data.ptr + my_old_size, other.c_str(), other_size + 1); + } else { + // resize + data.capacity *= 2; + if(data.capacity <= total_size) + data.capacity = total_size + 1; + // alloc new chunk + char* temp = new char[data.capacity]; + // copy current data to new location before releasing it + memcpy(temp, data.ptr, my_old_size); // skip the +1 ('\0') for speed + // release old chunk + delete[] data.ptr; + // update the rest of the union members + data.size = total_size; + data.ptr = temp; + // transfer the rest of the data + memcpy(data.ptr + my_old_size, other.c_str(), other_size + 1); + } + } + + return *this; +} + +String String::operator+(const String& other) const { return String(*this) += other; } + +String::String(String&& other) { + using namespace std; + memcpy(buf, other.buf, len); + other.buf[0] = '\0'; + other.setLast(); +} + +String& String::operator=(String&& other) { + using namespace std; + if(this != &other) { + if(!isOnStack()) + delete[] data.ptr; + memcpy(buf, other.buf, len); + other.buf[0] = '\0'; + other.setLast(); + } + return *this; +} + +char String::operator[](unsigned i) const { + return const_cast(this)->operator[](i); // NOLINT +} + +char& String::operator[](unsigned i) { + if(isOnStack()) + return reinterpret_cast(buf)[i]; + return data.ptr[i]; +} + +DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wmaybe-uninitialized") +unsigned String::size() const { + if(isOnStack()) + return last - (unsigned(buf[last]) & 31); // using "last" would work only if "len" is 32 + return data.size; +} +DOCTEST_GCC_SUPPRESS_WARNING_POP + +unsigned String::capacity() const { + if(isOnStack()) + return len; + return data.capacity; +} + +int String::compare(const char* other, bool no_case) const { + if(no_case) + return doctest::stricmp(c_str(), other); + return std::strcmp(c_str(), other); +} + +int String::compare(const String& other, bool no_case) const { + return compare(other.c_str(), no_case); +} + +// clang-format off +bool operator==(const String& lhs, const String& rhs) { return lhs.compare(rhs) == 0; } +bool operator!=(const String& lhs, const String& rhs) { return lhs.compare(rhs) != 0; } +bool operator< (const String& lhs, const String& rhs) { return lhs.compare(rhs) < 0; } +bool operator> (const String& lhs, const String& rhs) { return lhs.compare(rhs) > 0; } +bool operator<=(const String& lhs, const String& rhs) { return (lhs != rhs) ? lhs.compare(rhs) < 0 : true; } +bool operator>=(const String& lhs, const String& rhs) { return (lhs != rhs) ? lhs.compare(rhs) > 0 : true; } +// clang-format on + +std::ostream& operator<<(std::ostream& s, const String& in) { return s << in.c_str(); } + +namespace { + void color_to_stream(std::ostream&, Color::Enum) DOCTEST_BRANCH_ON_DISABLED({}, ;) +} // namespace + +namespace Color { + std::ostream& operator<<(std::ostream& s, Color::Enum code) { + color_to_stream(s, code); + return s; + } +} // namespace Color + +// clang-format off +const char* assertString(assertType::Enum at) { + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4062) // enum 'x' in switch of enum 'y' is not handled + switch(at) { //!OCLINT missing default in switch statements + case assertType::DT_WARN : return "WARN"; + case assertType::DT_CHECK : return "CHECK"; + case assertType::DT_REQUIRE : return "REQUIRE"; + + case assertType::DT_WARN_FALSE : return "WARN_FALSE"; + case assertType::DT_CHECK_FALSE : return "CHECK_FALSE"; + case assertType::DT_REQUIRE_FALSE : return "REQUIRE_FALSE"; + + case assertType::DT_WARN_THROWS : return "WARN_THROWS"; + case assertType::DT_CHECK_THROWS : return "CHECK_THROWS"; + case assertType::DT_REQUIRE_THROWS : return "REQUIRE_THROWS"; + + case assertType::DT_WARN_THROWS_AS : return "WARN_THROWS_AS"; + case assertType::DT_CHECK_THROWS_AS : return "CHECK_THROWS_AS"; + case assertType::DT_REQUIRE_THROWS_AS : return "REQUIRE_THROWS_AS"; + + case assertType::DT_WARN_THROWS_WITH : return "WARN_THROWS_WITH"; + case assertType::DT_CHECK_THROWS_WITH : return "CHECK_THROWS_WITH"; + case assertType::DT_REQUIRE_THROWS_WITH : return "REQUIRE_THROWS_WITH"; + + case assertType::DT_WARN_THROWS_WITH_AS : return "WARN_THROWS_WITH_AS"; + case assertType::DT_CHECK_THROWS_WITH_AS : return "CHECK_THROWS_WITH_AS"; + case assertType::DT_REQUIRE_THROWS_WITH_AS : return "REQUIRE_THROWS_WITH_AS"; + + case assertType::DT_WARN_NOTHROW : return "WARN_NOTHROW"; + case assertType::DT_CHECK_NOTHROW : return "CHECK_NOTHROW"; + case assertType::DT_REQUIRE_NOTHROW : return "REQUIRE_NOTHROW"; + + case assertType::DT_WARN_EQ : return "WARN_EQ"; + case assertType::DT_CHECK_EQ : return "CHECK_EQ"; + case assertType::DT_REQUIRE_EQ : return "REQUIRE_EQ"; + case assertType::DT_WARN_NE : return "WARN_NE"; + case assertType::DT_CHECK_NE : return "CHECK_NE"; + case assertType::DT_REQUIRE_NE : return "REQUIRE_NE"; + case assertType::DT_WARN_GT : return "WARN_GT"; + case assertType::DT_CHECK_GT : return "CHECK_GT"; + case assertType::DT_REQUIRE_GT : return "REQUIRE_GT"; + case assertType::DT_WARN_LT : return "WARN_LT"; + case assertType::DT_CHECK_LT : return "CHECK_LT"; + case assertType::DT_REQUIRE_LT : return "REQUIRE_LT"; + case assertType::DT_WARN_GE : return "WARN_GE"; + case assertType::DT_CHECK_GE : return "CHECK_GE"; + case assertType::DT_REQUIRE_GE : return "REQUIRE_GE"; + case assertType::DT_WARN_LE : return "WARN_LE"; + case assertType::DT_CHECK_LE : return "CHECK_LE"; + case assertType::DT_REQUIRE_LE : return "REQUIRE_LE"; + + case assertType::DT_WARN_UNARY : return "WARN_UNARY"; + case assertType::DT_CHECK_UNARY : return "CHECK_UNARY"; + case assertType::DT_REQUIRE_UNARY : return "REQUIRE_UNARY"; + case assertType::DT_WARN_UNARY_FALSE : return "WARN_UNARY_FALSE"; + case assertType::DT_CHECK_UNARY_FALSE : return "CHECK_UNARY_FALSE"; + case assertType::DT_REQUIRE_UNARY_FALSE : return "REQUIRE_UNARY_FALSE"; + } + DOCTEST_MSVC_SUPPRESS_WARNING_POP + return ""; +} +// clang-format on + +const char* failureString(assertType::Enum at) { + if(at & assertType::is_warn) //!OCLINT bitwise operator in conditional + return "WARNING"; + if(at & assertType::is_check) //!OCLINT bitwise operator in conditional + return "ERROR"; + if(at & assertType::is_require) //!OCLINT bitwise operator in conditional + return "FATAL ERROR"; + return ""; +} + +DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wnull-dereference") +DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wnull-dereference") +// depending on the current options this will remove the path of filenames +const char* skipPathFromFilename(const char* file) { + if(getContextOptions()->no_path_in_filenames) { + auto back = std::strrchr(file, '\\'); + auto forward = std::strrchr(file, '/'); + if(back || forward) { + if(back > forward) + forward = back; + return forward + 1; + } + } + return file; +} +DOCTEST_CLANG_SUPPRESS_WARNING_POP +DOCTEST_GCC_SUPPRESS_WARNING_POP + +bool SubcaseSignature::operator<(const SubcaseSignature& other) const { + if(m_line != other.m_line) + return m_line < other.m_line; + if(std::strcmp(m_file, other.m_file) != 0) + return std::strcmp(m_file, other.m_file) < 0; + return m_name.compare(other.m_name) < 0; +} + +IContextScope::IContextScope() = default; +IContextScope::~IContextScope() = default; + +#ifdef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +String toString(char* in) { return toString(static_cast(in)); } +String toString(const char* in) { return String("\"") + (in ? in : "{null string}") + "\""; } +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING +String toString(bool in) { return in ? "true" : "false"; } +String toString(float in) { return fpToString(in, 5) + "f"; } +String toString(double in) { return fpToString(in, 10); } +String toString(double long in) { return fpToString(in, 15); } + +#define DOCTEST_TO_STRING_OVERLOAD(type, fmt) \ + String toString(type in) { \ + char buf[64]; \ + std::sprintf(buf, fmt, in); \ + return buf; \ + } + +DOCTEST_TO_STRING_OVERLOAD(char, "%d") +DOCTEST_TO_STRING_OVERLOAD(char signed, "%d") +DOCTEST_TO_STRING_OVERLOAD(char unsigned, "%u") +DOCTEST_TO_STRING_OVERLOAD(int short, "%d") +DOCTEST_TO_STRING_OVERLOAD(int short unsigned, "%u") +DOCTEST_TO_STRING_OVERLOAD(int, "%d") +DOCTEST_TO_STRING_OVERLOAD(unsigned, "%u") +DOCTEST_TO_STRING_OVERLOAD(int long, "%ld") +DOCTEST_TO_STRING_OVERLOAD(int long unsigned, "%lu") +DOCTEST_TO_STRING_OVERLOAD(int long long, "%lld") +DOCTEST_TO_STRING_OVERLOAD(int long long unsigned, "%llu") + +String toString(std::nullptr_t) { return "NULL"; } + +#if DOCTEST_MSVC >= DOCTEST_COMPILER(19, 20, 0) +// see this issue on why this is needed: https://github.com/onqtam/doctest/issues/183 +String toString(const std::string& in) { return in.c_str(); } +#endif // VS 2019 + +Approx::Approx(double value) + : m_epsilon(static_cast(std::numeric_limits::epsilon()) * 100) + , m_scale(1.0) + , m_value(value) {} + +Approx Approx::operator()(double value) const { + Approx approx(value); + approx.epsilon(m_epsilon); + approx.scale(m_scale); + return approx; +} + +Approx& Approx::epsilon(double newEpsilon) { + m_epsilon = newEpsilon; + return *this; +} +Approx& Approx::scale(double newScale) { + m_scale = newScale; + return *this; +} + +bool operator==(double lhs, const Approx& rhs) { + // Thanks to Richard Harris for his help refining this formula + return std::fabs(lhs - rhs.m_value) < + rhs.m_epsilon * (rhs.m_scale + std::max(std::fabs(lhs), std::fabs(rhs.m_value))); +} +bool operator==(const Approx& lhs, double rhs) { return operator==(rhs, lhs); } +bool operator!=(double lhs, const Approx& rhs) { return !operator==(lhs, rhs); } +bool operator!=(const Approx& lhs, double rhs) { return !operator==(rhs, lhs); } +bool operator<=(double lhs, const Approx& rhs) { return lhs < rhs.m_value || lhs == rhs; } +bool operator<=(const Approx& lhs, double rhs) { return lhs.m_value < rhs || lhs == rhs; } +bool operator>=(double lhs, const Approx& rhs) { return lhs > rhs.m_value || lhs == rhs; } +bool operator>=(const Approx& lhs, double rhs) { return lhs.m_value > rhs || lhs == rhs; } +bool operator<(double lhs, const Approx& rhs) { return lhs < rhs.m_value && lhs != rhs; } +bool operator<(const Approx& lhs, double rhs) { return lhs.m_value < rhs && lhs != rhs; } +bool operator>(double lhs, const Approx& rhs) { return lhs > rhs.m_value && lhs != rhs; } +bool operator>(const Approx& lhs, double rhs) { return lhs.m_value > rhs && lhs != rhs; } + +String toString(const Approx& in) { + return String("Approx( ") + doctest::toString(in.m_value) + " )"; +} +const ContextOptions* getContextOptions() { return DOCTEST_BRANCH_ON_DISABLED(nullptr, g_cs); } + +} // namespace doctest + +#ifdef DOCTEST_CONFIG_DISABLE +namespace doctest { +Context::Context(int, const char* const*) {} +Context::~Context() = default; +void Context::applyCommandLine(int, const char* const*) {} +void Context::addFilter(const char*, const char*) {} +void Context::clearFilters() {} +void Context::setOption(const char*, int) {} +void Context::setOption(const char*, const char*) {} +bool Context::shouldExit() { return false; } +void Context::setAsDefaultForAssertsOutOfTestCases() {} +void Context::setAssertHandler(detail::assert_handler) {} +int Context::run() { return 0; } + +IReporter::~IReporter() = default; + +int IReporter::get_num_active_contexts() { return 0; } +const IContextScope* const* IReporter::get_active_contexts() { return nullptr; } +int IReporter::get_num_stringified_contexts() { return 0; } +const String* IReporter::get_stringified_contexts() { return nullptr; } + +int registerReporter(const char*, int, IReporter*) { return 0; } + +} // namespace doctest +#else // DOCTEST_CONFIG_DISABLE + +#if !defined(DOCTEST_CONFIG_COLORS_NONE) +#if !defined(DOCTEST_CONFIG_COLORS_WINDOWS) && !defined(DOCTEST_CONFIG_COLORS_ANSI) +#ifdef DOCTEST_PLATFORM_WINDOWS +#define DOCTEST_CONFIG_COLORS_WINDOWS +#else // linux +#define DOCTEST_CONFIG_COLORS_ANSI +#endif // platform +#endif // DOCTEST_CONFIG_COLORS_WINDOWS && DOCTEST_CONFIG_COLORS_ANSI +#endif // DOCTEST_CONFIG_COLORS_NONE + +namespace doctest_detail_test_suite_ns { +// holds the current test suite +doctest::detail::TestSuite& getCurrentTestSuite() { + static doctest::detail::TestSuite data; + return data; +} +} // namespace doctest_detail_test_suite_ns + +namespace doctest { +namespace { + // the int (priority) is part of the key for automatic sorting - sadly one can register a + // reporter with a duplicate name and a different priority but hopefully that won't happen often :| + typedef std::map, reporterCreatorFunc> reporterMap; + + reporterMap& getReporters() { + static reporterMap data; + return data; + } + reporterMap& getListeners() { + static reporterMap data; + return data; + } +} // namespace +namespace detail { +#define DOCTEST_ITERATE_THROUGH_REPORTERS(function, ...) \ + for(auto& curr_rep : g_cs->reporters_currently_used) \ + curr_rep->function(__VA_ARGS__) + + bool checkIfShouldThrow(assertType::Enum at) { + if(at & assertType::is_require) //!OCLINT bitwise operator in conditional + return true; + + if((at & assertType::is_check) //!OCLINT bitwise operator in conditional + && getContextOptions()->abort_after > 0 && + (g_cs->numAssertsFailed + g_cs->numAssertsFailedCurrentTest_atomic) >= + getContextOptions()->abort_after) + return true; + + return false; + } + +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + DOCTEST_NORETURN void throwException() { + g_cs->shouldLogCurrentException = false; + throw TestFailureException(); + } // NOLINT(cert-err60-cpp) +#else // DOCTEST_CONFIG_NO_EXCEPTIONS + void throwException() {} +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS +} // namespace detail + +namespace { + using namespace detail; + // matching of a string against a wildcard mask (case sensitivity configurable) taken from + // https://www.codeproject.com/Articles/1088/Wildcard-string-compare-globbing + int wildcmp(const char* str, const char* wild, bool caseSensitive) { + const char* cp = str; + const char* mp = wild; + + while((*str) && (*wild != '*')) { + if((caseSensitive ? (*wild != *str) : (tolower(*wild) != tolower(*str))) && + (*wild != '?')) { + return 0; + } + wild++; + str++; + } + + while(*str) { + if(*wild == '*') { + if(!*++wild) { + return 1; + } + mp = wild; + cp = str + 1; + } else if((caseSensitive ? (*wild == *str) : (tolower(*wild) == tolower(*str))) || + (*wild == '?')) { + wild++; + str++; + } else { + wild = mp; //!OCLINT parameter reassignment + str = cp++; //!OCLINT parameter reassignment + } + } + + while(*wild == '*') { + wild++; + } + return !*wild; + } + + //// C string hash function (djb2) - taken from http://www.cse.yorku.ca/~oz/hash.html + //unsigned hashStr(unsigned const char* str) { + // unsigned long hash = 5381; + // char c; + // while((c = *str++)) + // hash = ((hash << 5) + hash) + c; // hash * 33 + c + // return hash; + //} + + // checks if the name matches any of the filters (and can be configured what to do when empty) + bool matchesAny(const char* name, const std::vector& filters, bool matchEmpty, + bool caseSensitive) { + if(filters.empty() && matchEmpty) + return true; + for(auto& curr : filters) + if(wildcmp(name, curr.c_str(), caseSensitive)) + return true; + return false; + } +} // namespace +namespace detail { + + Subcase::Subcase(const String& name, const char* file, int line) + : m_signature({name, file, line}) { + ContextState* s = g_cs; + + // check subcase filters + if(s->subcasesStack.size() < size_t(s->subcase_filter_levels)) { + if(!matchesAny(m_signature.m_name.c_str(), s->filters[6], true, s->case_sensitive)) + return; + if(matchesAny(m_signature.m_name.c_str(), s->filters[7], false, s->case_sensitive)) + return; + } + + // if a Subcase on the same level has already been entered + if(s->subcasesStack.size() < size_t(s->subcasesCurrentMaxLevel)) { + s->should_reenter = true; + return; + } + + // push the current signature to the stack so we can check if the + // current stack + the current new subcase have been traversed + s->subcasesStack.push_back(m_signature); + if(s->subcasesPassed.count(s->subcasesStack) != 0) { + // pop - revert to previous stack since we've already passed this + s->subcasesStack.pop_back(); + return; + } + + s->subcasesCurrentMaxLevel = s->subcasesStack.size(); + m_entered = true; + + DOCTEST_ITERATE_THROUGH_REPORTERS(subcase_start, m_signature); + } + + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4996) // std::uncaught_exception is deprecated in C++17 + DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + + Subcase::~Subcase() { + if(m_entered) { + // only mark the subcase stack as passed if no subcases have been skipped + if(g_cs->should_reenter == false) + g_cs->subcasesPassed.insert(g_cs->subcasesStack); + g_cs->subcasesStack.pop_back(); + +#if defined(__cpp_lib_uncaught_exceptions) && __cpp_lib_uncaught_exceptions >= 201411L + if(std::uncaught_exceptions() > 0 +#else + if(std::uncaught_exception() +#endif + && g_cs->shouldLogCurrentException) { + DOCTEST_ITERATE_THROUGH_REPORTERS( + test_case_exception, {"exception thrown in subcase - will translate later " + "when the whole test case has been exited (cannot " + "translate while there is an active exception)", + false}); + g_cs->shouldLogCurrentException = false; + } + DOCTEST_ITERATE_THROUGH_REPORTERS(subcase_end, DOCTEST_EMPTY); + } + } + + DOCTEST_CLANG_SUPPRESS_WARNING_POP + DOCTEST_GCC_SUPPRESS_WARNING_POP + DOCTEST_MSVC_SUPPRESS_WARNING_POP + + Subcase::operator bool() const { return m_entered; } + + Result::Result(bool passed, const String& decomposition) + : m_passed(passed) + , m_decomp(decomposition) {} + + ExpressionDecomposer::ExpressionDecomposer(assertType::Enum at) + : m_at(at) {} + + TestSuite& TestSuite::operator*(const char* in) { + m_test_suite = in; + // clear state + m_description = nullptr; + m_skip = false; + m_may_fail = false; + m_should_fail = false; + m_expected_failures = 0; + m_timeout = 0; + return *this; + } + + TestCase::TestCase(funcType test, const char* file, unsigned line, const TestSuite& test_suite, + const char* type, int template_id) { + m_file = file; + m_line = line; + m_name = nullptr; // will be later overridden in operator* + m_test_suite = test_suite.m_test_suite; + m_description = test_suite.m_description; + m_skip = test_suite.m_skip; + m_may_fail = test_suite.m_may_fail; + m_should_fail = test_suite.m_should_fail; + m_expected_failures = test_suite.m_expected_failures; + m_timeout = test_suite.m_timeout; + + m_test = test; + m_type = type; + m_template_id = template_id; + } + + TestCase::TestCase(const TestCase& other) + : TestCaseData() { + *this = other; + } + + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(26434) // hides a non-virtual function + DOCTEST_MSVC_SUPPRESS_WARNING(26437) // Do not slice + TestCase& TestCase::operator=(const TestCase& other) { + static_cast(*this) = static_cast(other); + + m_test = other.m_test; + m_type = other.m_type; + m_template_id = other.m_template_id; + m_full_name = other.m_full_name; + + if(m_template_id != -1) + m_name = m_full_name.c_str(); + return *this; + } + DOCTEST_MSVC_SUPPRESS_WARNING_POP + + TestCase& TestCase::operator*(const char* in) { + m_name = in; + // make a new name with an appended type for templated test case + if(m_template_id != -1) { + m_full_name = String(m_name) + m_type; + // redirect the name to point to the newly constructed full name + m_name = m_full_name.c_str(); + } + return *this; + } + + bool TestCase::operator<(const TestCase& other) const { + if(m_line != other.m_line) + return m_line < other.m_line; + const int file_cmp = m_file.compare(other.m_file); + if(file_cmp != 0) + return file_cmp < 0; + return m_template_id < other.m_template_id; + } +} // namespace detail +namespace { + using namespace detail; + // for sorting tests by file/line + bool fileOrderComparator(const TestCase* lhs, const TestCase* rhs) { + // this is needed because MSVC gives different case for drive letters + // for __FILE__ when evaluated in a header and a source file + const int res = lhs->m_file.compare(rhs->m_file, bool(DOCTEST_MSVC)); + if(res != 0) + return res < 0; + if(lhs->m_line != rhs->m_line) + return lhs->m_line < rhs->m_line; + return lhs->m_template_id < rhs->m_template_id; + } + + // for sorting tests by suite/file/line + bool suiteOrderComparator(const TestCase* lhs, const TestCase* rhs) { + const int res = std::strcmp(lhs->m_test_suite, rhs->m_test_suite); + if(res != 0) + return res < 0; + return fileOrderComparator(lhs, rhs); + } + + // for sorting tests by name/suite/file/line + bool nameOrderComparator(const TestCase* lhs, const TestCase* rhs) { + const int res = std::strcmp(lhs->m_name, rhs->m_name); + if(res != 0) + return res < 0; + return suiteOrderComparator(lhs, rhs); + } + + // all the registered tests + std::set& getRegisteredTests() { + static std::set data; + return data; + } + +#ifdef DOCTEST_CONFIG_COLORS_WINDOWS + HANDLE g_stdoutHandle; + WORD g_origFgAttrs; + WORD g_origBgAttrs; + bool g_attrsInitted = false; + + int colors_init() { + if(!g_attrsInitted) { + g_stdoutHandle = GetStdHandle(STD_OUTPUT_HANDLE); + g_attrsInitted = true; + CONSOLE_SCREEN_BUFFER_INFO csbiInfo; + GetConsoleScreenBufferInfo(g_stdoutHandle, &csbiInfo); + g_origFgAttrs = csbiInfo.wAttributes & ~(BACKGROUND_GREEN | BACKGROUND_RED | + BACKGROUND_BLUE | BACKGROUND_INTENSITY); + g_origBgAttrs = csbiInfo.wAttributes & ~(FOREGROUND_GREEN | FOREGROUND_RED | + FOREGROUND_BLUE | FOREGROUND_INTENSITY); + } + return 0; + } + + int dumy_init_console_colors = colors_init(); +#endif // DOCTEST_CONFIG_COLORS_WINDOWS + + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + void color_to_stream(std::ostream& s, Color::Enum code) { + ((void)s); // for DOCTEST_CONFIG_COLORS_NONE or DOCTEST_CONFIG_COLORS_WINDOWS + ((void)code); // for DOCTEST_CONFIG_COLORS_NONE +#ifdef DOCTEST_CONFIG_COLORS_ANSI + if(g_no_colors || + (isatty(STDOUT_FILENO) == false && getContextOptions()->force_colors == false)) + return; + + auto col = ""; + // clang-format off + switch(code) { //!OCLINT missing break in switch statement / unnecessary default statement in covered switch statement + case Color::Red: col = "[0;31m"; break; + case Color::Green: col = "[0;32m"; break; + case Color::Blue: col = "[0;34m"; break; + case Color::Cyan: col = "[0;36m"; break; + case Color::Yellow: col = "[0;33m"; break; + case Color::Grey: col = "[1;30m"; break; + case Color::LightGrey: col = "[0;37m"; break; + case Color::BrightRed: col = "[1;31m"; break; + case Color::BrightGreen: col = "[1;32m"; break; + case Color::BrightWhite: col = "[1;37m"; break; + case Color::Bright: // invalid + case Color::None: + case Color::White: + default: col = "[0m"; + } + // clang-format on + s << "\033" << col; +#endif // DOCTEST_CONFIG_COLORS_ANSI + +#ifdef DOCTEST_CONFIG_COLORS_WINDOWS + if(g_no_colors || + (isatty(fileno(stdout)) == false && getContextOptions()->force_colors == false)) + return; + +#define DOCTEST_SET_ATTR(x) SetConsoleTextAttribute(g_stdoutHandle, x | g_origBgAttrs) + + // clang-format off + switch (code) { + case Color::White: DOCTEST_SET_ATTR(FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE); break; + case Color::Red: DOCTEST_SET_ATTR(FOREGROUND_RED); break; + case Color::Green: DOCTEST_SET_ATTR(FOREGROUND_GREEN); break; + case Color::Blue: DOCTEST_SET_ATTR(FOREGROUND_BLUE); break; + case Color::Cyan: DOCTEST_SET_ATTR(FOREGROUND_BLUE | FOREGROUND_GREEN); break; + case Color::Yellow: DOCTEST_SET_ATTR(FOREGROUND_RED | FOREGROUND_GREEN); break; + case Color::Grey: DOCTEST_SET_ATTR(0); break; + case Color::LightGrey: DOCTEST_SET_ATTR(FOREGROUND_INTENSITY); break; + case Color::BrightRed: DOCTEST_SET_ATTR(FOREGROUND_INTENSITY | FOREGROUND_RED); break; + case Color::BrightGreen: DOCTEST_SET_ATTR(FOREGROUND_INTENSITY | FOREGROUND_GREEN); break; + case Color::BrightWhite: DOCTEST_SET_ATTR(FOREGROUND_INTENSITY | FOREGROUND_GREEN | FOREGROUND_RED | FOREGROUND_BLUE); break; + case Color::None: + case Color::Bright: // invalid + default: DOCTEST_SET_ATTR(g_origFgAttrs); + } + // clang-format on +#endif // DOCTEST_CONFIG_COLORS_WINDOWS + } + DOCTEST_CLANG_SUPPRESS_WARNING_POP + + std::vector& getExceptionTranslators() { + static std::vector data; + return data; + } + + String translateActiveException() { +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + String res; + auto& translators = getExceptionTranslators(); + for(auto& curr : translators) + if(curr->translate(res)) + return res; + // clang-format off + DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wcatch-value") + try { + throw; + } catch(std::exception& ex) { + return ex.what(); + } catch(std::string& msg) { + return msg.c_str(); + } catch(const char* msg) { + return msg; + } catch(...) { + return "unknown exception"; + } + DOCTEST_GCC_SUPPRESS_WARNING_POP +// clang-format on +#else // DOCTEST_CONFIG_NO_EXCEPTIONS + return ""; +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + } +} // namespace + +namespace detail { + // used by the macros for registering tests + int regTest(const TestCase& tc) { + getRegisteredTests().insert(tc); + return 0; + } + + // sets the current test suite + int setTestSuite(const TestSuite& ts) { + doctest_detail_test_suite_ns::getCurrentTestSuite() = ts; + return 0; + } + +#ifdef DOCTEST_IS_DEBUGGER_ACTIVE + bool isDebuggerActive() { return DOCTEST_IS_DEBUGGER_ACTIVE(); } +#else // DOCTEST_IS_DEBUGGER_ACTIVE +#ifdef DOCTEST_PLATFORM_MAC + // The following function is taken directly from the following technical note: + // https://developer.apple.com/library/archive/qa/qa1361/_index.html + // Returns true if the current process is being debugged (either + // running under the debugger or has a debugger attached post facto). + bool isDebuggerActive() { + int mib[4]; + kinfo_proc info; + size_t size; + // Initialize the flags so that, if sysctl fails for some bizarre + // reason, we get a predictable result. + info.kp_proc.p_flag = 0; + // Initialize mib, which tells sysctl the info we want, in this case + // we're looking for information about a specific process ID. + mib[0] = CTL_KERN; + mib[1] = KERN_PROC; + mib[2] = KERN_PROC_PID; + mib[3] = getpid(); + // Call sysctl. + size = sizeof(info); + if(sysctl(mib, DOCTEST_COUNTOF(mib), &info, &size, 0, 0) != 0) { + std::cerr << "\nCall to sysctl failed - unable to determine if debugger is active **\n"; + return false; + } + // We're being debugged if the P_TRACED flag is set. + return ((info.kp_proc.p_flag & P_TRACED) != 0); + } +#elif DOCTEST_MSVC || defined(__MINGW32__) || defined(__MINGW64__) + bool isDebuggerActive() { return ::IsDebuggerPresent() != 0; } +#else + bool isDebuggerActive() { return false; } +#endif // Platform +#endif // DOCTEST_IS_DEBUGGER_ACTIVE + + void registerExceptionTranslatorImpl(const IExceptionTranslator* et) { + if(std::find(getExceptionTranslators().begin(), getExceptionTranslators().end(), et) == + getExceptionTranslators().end()) + getExceptionTranslators().push_back(et); + } + +#ifdef DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + void toStream(std::ostream* s, char* in) { *s << in; } + void toStream(std::ostream* s, const char* in) { *s << in; } +#endif // DOCTEST_CONFIG_TREAT_CHAR_STAR_AS_STRING + void toStream(std::ostream* s, bool in) { *s << std::boolalpha << in << std::noboolalpha; } + void toStream(std::ostream* s, float in) { *s << in; } + void toStream(std::ostream* s, double in) { *s << in; } + void toStream(std::ostream* s, double long in) { *s << in; } + + void toStream(std::ostream* s, char in) { *s << in; } + void toStream(std::ostream* s, char signed in) { *s << in; } + void toStream(std::ostream* s, char unsigned in) { *s << in; } + void toStream(std::ostream* s, int short in) { *s << in; } + void toStream(std::ostream* s, int short unsigned in) { *s << in; } + void toStream(std::ostream* s, int in) { *s << in; } + void toStream(std::ostream* s, int unsigned in) { *s << in; } + void toStream(std::ostream* s, int long in) { *s << in; } + void toStream(std::ostream* s, int long unsigned in) { *s << in; } + void toStream(std::ostream* s, int long long in) { *s << in; } + void toStream(std::ostream* s, int long long unsigned in) { *s << in; } + + DOCTEST_THREAD_LOCAL std::vector g_infoContexts; // for logging with INFO() + + ContextScopeBase::ContextScopeBase() { + g_infoContexts.push_back(this); + } + + DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4996) // std::uncaught_exception is deprecated in C++17 + DOCTEST_GCC_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + + // destroy cannot be inlined into the destructor because that would mean calling stringify after + // ContextScope has been destroyed (base class destructors run after derived class destructors). + // Instead, ContextScope calls this method directly from its destructor. + void ContextScopeBase::destroy() { +#if defined(__cpp_lib_uncaught_exceptions) && __cpp_lib_uncaught_exceptions >= 201411L + if(std::uncaught_exceptions() > 0) { +#else + if(std::uncaught_exception()) { +#endif + std::ostringstream s; + this->stringify(&s); + g_cs->stringifiedContexts.push_back(s.str().c_str()); + } + g_infoContexts.pop_back(); + } + + DOCTEST_CLANG_SUPPRESS_WARNING_POP + DOCTEST_GCC_SUPPRESS_WARNING_POP + DOCTEST_MSVC_SUPPRESS_WARNING_POP +} // namespace detail +namespace { + using namespace detail; + +#if !defined(DOCTEST_CONFIG_POSIX_SIGNALS) && !defined(DOCTEST_CONFIG_WINDOWS_SEH) + struct FatalConditionHandler + { + void reset() {} + }; +#else // DOCTEST_CONFIG_POSIX_SIGNALS || DOCTEST_CONFIG_WINDOWS_SEH + + void reportFatal(const std::string&); + +#ifdef DOCTEST_PLATFORM_WINDOWS + + struct SignalDefs + { + DWORD id; + const char* name; + }; + // There is no 1-1 mapping between signals and windows exceptions. + // Windows can easily distinguish between SO and SigSegV, + // but SigInt, SigTerm, etc are handled differently. + SignalDefs signalDefs[] = { + {EXCEPTION_ILLEGAL_INSTRUCTION, "SIGILL - Illegal instruction signal"}, + {EXCEPTION_STACK_OVERFLOW, "SIGSEGV - Stack overflow"}, + {EXCEPTION_ACCESS_VIOLATION, "SIGSEGV - Segmentation violation signal"}, + {EXCEPTION_INT_DIVIDE_BY_ZERO, "Divide by zero error"}, + }; + + struct FatalConditionHandler + { + static LONG CALLBACK handleException(PEXCEPTION_POINTERS ExceptionInfo) { + for(size_t i = 0; i < DOCTEST_COUNTOF(signalDefs); ++i) { + if(ExceptionInfo->ExceptionRecord->ExceptionCode == signalDefs[i].id) { + reportFatal(signalDefs[i].name); + break; + } + } + // If its not an exception we care about, pass it along. + // This stops us from eating debugger breaks etc. + return EXCEPTION_CONTINUE_SEARCH; + } + + FatalConditionHandler() { + isSet = true; + // 32k seems enough for doctest to handle stack overflow, + // but the value was found experimentally, so there is no strong guarantee + guaranteeSize = 32 * 1024; + // Register an unhandled exception filter + previousTop = SetUnhandledExceptionFilter(handleException); + // Pass in guarantee size to be filled + SetThreadStackGuarantee(&guaranteeSize); + } + + static void reset() { + if(isSet) { + // Unregister handler and restore the old guarantee + SetUnhandledExceptionFilter(previousTop); + SetThreadStackGuarantee(&guaranteeSize); + previousTop = nullptr; + isSet = false; + } + } + + ~FatalConditionHandler() { reset(); } + + private: + static bool isSet; + static ULONG guaranteeSize; + static LPTOP_LEVEL_EXCEPTION_FILTER previousTop; + }; + + bool FatalConditionHandler::isSet = false; + ULONG FatalConditionHandler::guaranteeSize = 0; + LPTOP_LEVEL_EXCEPTION_FILTER FatalConditionHandler::previousTop = nullptr; + +#else // DOCTEST_PLATFORM_WINDOWS + + struct SignalDefs + { + int id; + const char* name; + }; + SignalDefs signalDefs[] = {{SIGINT, "SIGINT - Terminal interrupt signal"}, + {SIGILL, "SIGILL - Illegal instruction signal"}, + {SIGFPE, "SIGFPE - Floating point error signal"}, + {SIGSEGV, "SIGSEGV - Segmentation violation signal"}, + {SIGTERM, "SIGTERM - Termination request signal"}, + {SIGABRT, "SIGABRT - Abort (abnormal termination) signal"}}; + + struct FatalConditionHandler + { + static bool isSet; + static struct sigaction oldSigActions[DOCTEST_COUNTOF(signalDefs)]; + static stack_t oldSigStack; + static char altStackMem[4 * SIGSTKSZ]; + + static void handleSignal(int sig) { + const char* name = ""; + for(std::size_t i = 0; i < DOCTEST_COUNTOF(signalDefs); ++i) { + SignalDefs& def = signalDefs[i]; + if(sig == def.id) { + name = def.name; + break; + } + } + reset(); + reportFatal(name); + raise(sig); + } + + FatalConditionHandler() { + isSet = true; + stack_t sigStack; + sigStack.ss_sp = altStackMem; + sigStack.ss_size = sizeof(altStackMem); + sigStack.ss_flags = 0; + sigaltstack(&sigStack, &oldSigStack); + struct sigaction sa = {}; + sa.sa_handler = handleSignal; // NOLINT + sa.sa_flags = SA_ONSTACK; + for(std::size_t i = 0; i < DOCTEST_COUNTOF(signalDefs); ++i) { + sigaction(signalDefs[i].id, &sa, &oldSigActions[i]); + } + } + + ~FatalConditionHandler() { reset(); } + static void reset() { + if(isSet) { + // Set signals back to previous values -- hopefully nobody overwrote them in the meantime + for(std::size_t i = 0; i < DOCTEST_COUNTOF(signalDefs); ++i) { + sigaction(signalDefs[i].id, &oldSigActions[i], nullptr); + } + // Return the old stack + sigaltstack(&oldSigStack, nullptr); + isSet = false; + } + } + }; + + bool FatalConditionHandler::isSet = false; + struct sigaction FatalConditionHandler::oldSigActions[DOCTEST_COUNTOF(signalDefs)] = {}; + stack_t FatalConditionHandler::oldSigStack = {}; + char FatalConditionHandler::altStackMem[] = {}; + +#endif // DOCTEST_PLATFORM_WINDOWS +#endif // DOCTEST_CONFIG_POSIX_SIGNALS || DOCTEST_CONFIG_WINDOWS_SEH + +} // namespace + +namespace { + using namespace detail; + +#ifdef DOCTEST_PLATFORM_WINDOWS +#define DOCTEST_OUTPUT_DEBUG_STRING(text) ::OutputDebugStringA(text) +#else + // TODO: integration with XCode and other IDEs +#define DOCTEST_OUTPUT_DEBUG_STRING(text) // NOLINT(clang-diagnostic-unused-macros) +#endif // Platform + + void addAssert(assertType::Enum at) { + if((at & assertType::is_warn) == 0) //!OCLINT bitwise operator in conditional + g_cs->numAssertsCurrentTest_atomic++; + } + + void addFailedAssert(assertType::Enum at) { + if((at & assertType::is_warn) == 0) //!OCLINT bitwise operator in conditional + g_cs->numAssertsFailedCurrentTest_atomic++; + } + +#if defined(DOCTEST_CONFIG_POSIX_SIGNALS) || defined(DOCTEST_CONFIG_WINDOWS_SEH) + void reportFatal(const std::string& message) { + g_cs->failure_flags |= TestCaseFailureReason::Crash; + + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_exception, {message.c_str(), true}); + + while(g_cs->subcasesStack.size()) { + g_cs->subcasesStack.pop_back(); + DOCTEST_ITERATE_THROUGH_REPORTERS(subcase_end, DOCTEST_EMPTY); + } + + g_cs->finalizeTestCaseData(); + + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_end, *g_cs); + + DOCTEST_ITERATE_THROUGH_REPORTERS(test_run_end, *g_cs); + } +#endif // DOCTEST_CONFIG_POSIX_SIGNALS || DOCTEST_CONFIG_WINDOWS_SEH +} // namespace +namespace detail { + + ResultBuilder::ResultBuilder(assertType::Enum at, const char* file, int line, const char* expr, + const char* exception_type, const char* exception_string) { + m_test_case = g_cs->currentTest; + m_at = at; + m_file = file; + m_line = line; + m_expr = expr; + m_failed = true; + m_threw = false; + m_threw_as = false; + m_exception_type = exception_type; + m_exception_string = exception_string; +#if DOCTEST_MSVC + if(m_expr[0] == ' ') // this happens when variadic macros are disabled under MSVC + ++m_expr; +#endif // MSVC + } + + void ResultBuilder::setResult(const Result& res) { + m_decomp = res.m_decomp; + m_failed = !res.m_passed; + } + + void ResultBuilder::translateException() { + m_threw = true; + m_exception = translateActiveException(); + } + + bool ResultBuilder::log() { + if(m_at & assertType::is_throws) { //!OCLINT bitwise operator in conditional + m_failed = !m_threw; + } else if((m_at & assertType::is_throws_as) && (m_at & assertType::is_throws_with)) { //!OCLINT + m_failed = !m_threw_as || (m_exception != m_exception_string); + } else if(m_at & assertType::is_throws_as) { //!OCLINT bitwise operator in conditional + m_failed = !m_threw_as; + } else if(m_at & assertType::is_throws_with) { //!OCLINT bitwise operator in conditional + m_failed = m_exception != m_exception_string; + } else if(m_at & assertType::is_nothrow) { //!OCLINT bitwise operator in conditional + m_failed = m_threw; + } + + if(m_exception.size()) + m_exception = String("\"") + m_exception + "\""; + + if(is_running_in_test) { + addAssert(m_at); + DOCTEST_ITERATE_THROUGH_REPORTERS(log_assert, *this); + + if(m_failed) + addFailedAssert(m_at); + } else if(m_failed) { + failed_out_of_a_testing_context(*this); + } + + return m_failed && isDebuggerActive() && + !getContextOptions()->no_breaks; // break into debugger + } + + void ResultBuilder::react() const { + if(m_failed && checkIfShouldThrow(m_at)) + throwException(); + } + + void failed_out_of_a_testing_context(const AssertData& ad) { + if(g_cs->ah) + g_cs->ah(ad); + else + std::abort(); + } + + void decomp_assert(assertType::Enum at, const char* file, int line, const char* expr, + Result result) { + bool failed = !result.m_passed; + + // ################################################################################### + // IF THE DEBUGGER BREAKS HERE - GO 1 LEVEL UP IN THE CALLSTACK FOR THE FAILING ASSERT + // THIS IS THE EFFECT OF HAVING 'DOCTEST_CONFIG_SUPER_FAST_ASSERTS' DEFINED + // ################################################################################### + DOCTEST_ASSERT_OUT_OF_TESTS(result.m_decomp); + DOCTEST_ASSERT_IN_TESTS(result.m_decomp); + } + + MessageBuilder::MessageBuilder(const char* file, int line, assertType::Enum severity) { + m_stream = getTlsOss(); + m_file = file; + m_line = line; + m_severity = severity; + } + + IExceptionTranslator::IExceptionTranslator() = default; + IExceptionTranslator::~IExceptionTranslator() = default; + + bool MessageBuilder::log() { + m_string = getTlsOssResult(); + DOCTEST_ITERATE_THROUGH_REPORTERS(log_message, *this); + + const bool isWarn = m_severity & assertType::is_warn; + + // warn is just a message in this context so we don't treat it as an assert + if(!isWarn) { + addAssert(m_severity); + addFailedAssert(m_severity); + } + + return isDebuggerActive() && !getContextOptions()->no_breaks && !isWarn; // break + } + + void MessageBuilder::react() { + if(m_severity & assertType::is_require) //!OCLINT bitwise operator in conditional + throwException(); + } + + MessageBuilder::~MessageBuilder() = default; +} // namespace detail +namespace { + using namespace detail; + + template + DOCTEST_NORETURN void throw_exception(Ex const& e) { +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + throw e; +#else // DOCTEST_CONFIG_NO_EXCEPTIONS + std::cerr << "doctest will terminate because it needed to throw an exception.\n" + << "The message was: " << e.what() << '\n'; + std::terminate(); +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + } + +#ifndef DOCTEST_INTERNAL_ERROR +#define DOCTEST_INTERNAL_ERROR(msg) \ + throw_exception(std::logic_error( \ + __FILE__ ":" DOCTEST_TOSTR(__LINE__) ": Internal doctest error: " msg)) +#endif // DOCTEST_INTERNAL_ERROR + + // clang-format off + +// ================================================================================================= +// The following code has been taken verbatim from Catch2/include/internal/catch_xmlwriter.h/cpp +// This is done so cherry-picking bug fixes is trivial - even the style/formatting is untouched. +// ================================================================================================= + + class XmlEncode { + public: + enum ForWhat { ForTextNodes, ForAttributes }; + + XmlEncode( std::string const& str, ForWhat forWhat = ForTextNodes ); + + void encodeTo( std::ostream& os ) const; + + friend std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ); + + private: + std::string m_str; + ForWhat m_forWhat; + }; + + class XmlWriter { + public: + + class ScopedElement { + public: + ScopedElement( XmlWriter* writer ); + + ScopedElement( ScopedElement&& other ) DOCTEST_NOEXCEPT; + ScopedElement& operator=( ScopedElement&& other ) DOCTEST_NOEXCEPT; + + ~ScopedElement(); + + ScopedElement& writeText( std::string const& text, bool indent = true ); + + template + ScopedElement& writeAttribute( std::string const& name, T const& attribute ) { + m_writer->writeAttribute( name, attribute ); + return *this; + } + + private: + mutable XmlWriter* m_writer = nullptr; + }; + + XmlWriter( std::ostream& os = std::cout ); + ~XmlWriter(); + + XmlWriter( XmlWriter const& ) = delete; + XmlWriter& operator=( XmlWriter const& ) = delete; + + XmlWriter& startElement( std::string const& name ); + + ScopedElement scopedElement( std::string const& name ); + + XmlWriter& endElement(); + + XmlWriter& writeAttribute( std::string const& name, std::string const& attribute ); + + XmlWriter& writeAttribute( std::string const& name, const char* attribute ); + + XmlWriter& writeAttribute( std::string const& name, bool attribute ); + + template + XmlWriter& writeAttribute( std::string const& name, T const& attribute ) { + std::stringstream rss; + rss << attribute; + return writeAttribute( name, rss.str() ); + } + + XmlWriter& writeText( std::string const& text, bool indent = true ); + + //XmlWriter& writeComment( std::string const& text ); + + //void writeStylesheetRef( std::string const& url ); + + //XmlWriter& writeBlankLine(); + + void ensureTagClosed(); + + private: + + void writeDeclaration(); + + void newlineIfNecessary(); + + bool m_tagIsOpen = false; + bool m_needsNewline = false; + std::vector m_tags; + std::string m_indent; + std::ostream& m_os; + }; + +// ================================================================================================= +// The following code has been taken verbatim from Catch2/include/internal/catch_xmlwriter.h/cpp +// This is done so cherry-picking bug fixes is trivial - even the style/formatting is untouched. +// ================================================================================================= + +using uchar = unsigned char; + +namespace { + + size_t trailingBytes(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return 2; + } + if ((c & 0xF0) == 0xE0) { + return 3; + } + if ((c & 0xF8) == 0xF0) { + return 4; + } + DOCTEST_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + uint32_t headerValue(unsigned char c) { + if ((c & 0xE0) == 0xC0) { + return c & 0x1F; + } + if ((c & 0xF0) == 0xE0) { + return c & 0x0F; + } + if ((c & 0xF8) == 0xF0) { + return c & 0x07; + } + DOCTEST_INTERNAL_ERROR("Invalid multibyte utf-8 start byte encountered"); + } + + void hexEscapeChar(std::ostream& os, unsigned char c) { + std::ios_base::fmtflags f(os.flags()); + os << "\\x" + << std::uppercase << std::hex << std::setfill('0') << std::setw(2) + << static_cast(c); + os.flags(f); + } + +} // anonymous namespace + + XmlEncode::XmlEncode( std::string const& str, ForWhat forWhat ) + : m_str( str ), + m_forWhat( forWhat ) + {} + + void XmlEncode::encodeTo( std::ostream& os ) const { + // Apostrophe escaping not necessary if we always use " to write attributes + // (see: https://www.w3.org/TR/xml/#syntax) + + for( std::size_t idx = 0; idx < m_str.size(); ++ idx ) { + uchar c = m_str[idx]; + switch (c) { + case '<': os << "<"; break; + case '&': os << "&"; break; + + case '>': + // See: https://www.w3.org/TR/xml/#syntax + if (idx > 2 && m_str[idx - 1] == ']' && m_str[idx - 2] == ']') + os << ">"; + else + os << c; + break; + + case '\"': + if (m_forWhat == ForAttributes) + os << """; + else + os << c; + break; + + default: + // Check for control characters and invalid utf-8 + + // Escape control characters in standard ascii + // see https://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0 + if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) { + hexEscapeChar(os, c); + break; + } + + // Plain ASCII: Write it to stream + if (c < 0x7F) { + os << c; + break; + } + + // UTF-8 territory + // Check if the encoding is valid and if it is not, hex escape bytes. + // Important: We do not check the exact decoded values for validity, only the encoding format + // First check that this bytes is a valid lead byte: + // This means that it is not encoded as 1111 1XXX + // Or as 10XX XXXX + if (c < 0xC0 || + c >= 0xF8) { + hexEscapeChar(os, c); + break; + } + + auto encBytes = trailingBytes(c); + // Are there enough bytes left to avoid accessing out-of-bounds memory? + if (idx + encBytes - 1 >= m_str.size()) { + hexEscapeChar(os, c); + break; + } + // The header is valid, check data + // The next encBytes bytes must together be a valid utf-8 + // This means: bitpattern 10XX XXXX and the extracted value is sane (ish) + bool valid = true; + uint32_t value = headerValue(c); + for (std::size_t n = 1; n < encBytes; ++n) { + uchar nc = m_str[idx + n]; + valid &= ((nc & 0xC0) == 0x80); + value = (value << 6) | (nc & 0x3F); + } + + if ( + // Wrong bit pattern of following bytes + (!valid) || + // Overlong encodings + (value < 0x80) || + ( value < 0x800 && encBytes > 2) || // removed "0x80 <= value &&" because redundant + (0x800 < value && value < 0x10000 && encBytes > 3) || + // Encoded value out of range + (value >= 0x110000) + ) { + hexEscapeChar(os, c); + break; + } + + // If we got here, this is in fact a valid(ish) utf-8 sequence + for (std::size_t n = 0; n < encBytes; ++n) { + os << m_str[idx + n]; + } + idx += encBytes - 1; + break; + } + } + } + + std::ostream& operator << ( std::ostream& os, XmlEncode const& xmlEncode ) { + xmlEncode.encodeTo( os ); + return os; + } + + XmlWriter::ScopedElement::ScopedElement( XmlWriter* writer ) + : m_writer( writer ) + {} + + XmlWriter::ScopedElement::ScopedElement( ScopedElement&& other ) DOCTEST_NOEXCEPT + : m_writer( other.m_writer ){ + other.m_writer = nullptr; + } + XmlWriter::ScopedElement& XmlWriter::ScopedElement::operator=( ScopedElement&& other ) DOCTEST_NOEXCEPT { + if ( m_writer ) { + m_writer->endElement(); + } + m_writer = other.m_writer; + other.m_writer = nullptr; + return *this; + } + + + XmlWriter::ScopedElement::~ScopedElement() { + if( m_writer ) + m_writer->endElement(); + } + + XmlWriter::ScopedElement& XmlWriter::ScopedElement::writeText( std::string const& text, bool indent ) { + m_writer->writeText( text, indent ); + return *this; + } + + XmlWriter::XmlWriter( std::ostream& os ) : m_os( os ) + { + writeDeclaration(); + } + + XmlWriter::~XmlWriter() { + while( !m_tags.empty() ) + endElement(); + } + + XmlWriter& XmlWriter::startElement( std::string const& name ) { + ensureTagClosed(); + newlineIfNecessary(); + m_os << m_indent << '<' << name; + m_tags.push_back( name ); + m_indent += " "; + m_tagIsOpen = true; + return *this; + } + + XmlWriter::ScopedElement XmlWriter::scopedElement( std::string const& name ) { + ScopedElement scoped( this ); + startElement( name ); + return scoped; + } + + XmlWriter& XmlWriter::endElement() { + newlineIfNecessary(); + m_indent = m_indent.substr( 0, m_indent.size()-2 ); + if( m_tagIsOpen ) { + m_os << "/>"; + m_tagIsOpen = false; + } + else { + m_os << m_indent << ""; + } + m_os << std::endl; + m_tags.pop_back(); + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, std::string const& attribute ) { + if( !name.empty() && !attribute.empty() ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, const char* attribute ) { + if( !name.empty() && attribute && attribute[0] != '\0' ) + m_os << ' ' << name << "=\"" << XmlEncode( attribute, XmlEncode::ForAttributes ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeAttribute( std::string const& name, bool attribute ) { + m_os << ' ' << name << "=\"" << ( attribute ? "true" : "false" ) << '"'; + return *this; + } + + XmlWriter& XmlWriter::writeText( std::string const& text, bool indent ) { + if( !text.empty() ){ + bool tagWasOpen = m_tagIsOpen; + ensureTagClosed(); + if( tagWasOpen && indent ) + m_os << m_indent; + m_os << XmlEncode( text ); + m_needsNewline = true; + } + return *this; + } + + //XmlWriter& XmlWriter::writeComment( std::string const& text ) { + // ensureTagClosed(); + // m_os << m_indent << ""; + // m_needsNewline = true; + // return *this; + //} + + //void XmlWriter::writeStylesheetRef( std::string const& url ) { + // m_os << "\n"; + //} + + //XmlWriter& XmlWriter::writeBlankLine() { + // ensureTagClosed(); + // m_os << '\n'; + // return *this; + //} + + void XmlWriter::ensureTagClosed() { + if( m_tagIsOpen ) { + m_os << ">" << std::endl; + m_tagIsOpen = false; + } + } + + void XmlWriter::writeDeclaration() { + m_os << "\n"; + } + + void XmlWriter::newlineIfNecessary() { + if( m_needsNewline ) { + m_os << std::endl; + m_needsNewline = false; + } + } + +// ================================================================================================= +// End of copy-pasted code from Catch +// ================================================================================================= + + // clang-format on + + struct XmlReporter : public IReporter + { + XmlWriter xml; + std::mutex mutex; + + // caching pointers/references to objects of these types - safe to do + const ContextOptions& opt; + const TestCaseData* tc = nullptr; + + XmlReporter(const ContextOptions& co) + : xml(*co.cout) + , opt(co) {} + + void log_contexts() { + int num_contexts = get_num_active_contexts(); + if(num_contexts) { + auto contexts = get_active_contexts(); + std::stringstream ss; + for(int i = 0; i < num_contexts; ++i) { + contexts[i]->stringify(&ss); + xml.scopedElement("Info").writeText(ss.str()); + ss.str(""); + } + } + } + + unsigned line(unsigned l) const { return opt.no_line_numbers ? 0 : l; } + + void test_case_start_impl(const TestCaseData& in) { + bool open_ts_tag = false; + if(tc != nullptr) { // we have already opened a test suite + if(std::strcmp(tc->m_test_suite, in.m_test_suite) != 0) { + xml.endElement(); + open_ts_tag = true; + } + } + else { + open_ts_tag = true; // first test case ==> first test suite + } + + if(open_ts_tag) { + xml.startElement("TestSuite"); + xml.writeAttribute("name", in.m_test_suite); + } + + tc = ∈ + xml.startElement("TestCase") + .writeAttribute("name", in.m_name) + .writeAttribute("filename", skipPathFromFilename(in.m_file.c_str())) + .writeAttribute("line", line(in.m_line)) + .writeAttribute("description", in.m_description); + + if(Approx(in.m_timeout) != 0) + xml.writeAttribute("timeout", in.m_timeout); + if(in.m_may_fail) + xml.writeAttribute("may_fail", true); + if(in.m_should_fail) + xml.writeAttribute("should_fail", true); + } + + // ========================================================================================= + // WHAT FOLLOWS ARE OVERRIDES OF THE VIRTUAL METHODS OF THE REPORTER INTERFACE + // ========================================================================================= + + void report_query(const QueryData& in) override { + test_run_start(); + if(opt.list_reporters) { + for(auto& curr : getListeners()) + xml.scopedElement("Listener") + .writeAttribute("priority", curr.first.first) + .writeAttribute("name", curr.first.second); + for(auto& curr : getReporters()) + xml.scopedElement("Reporter") + .writeAttribute("priority", curr.first.first) + .writeAttribute("name", curr.first.second); + } else if(opt.count || opt.list_test_cases) { + for(unsigned i = 0; i < in.num_data; ++i) { + xml.scopedElement("TestCase").writeAttribute("name", in.data[i]->m_name) + .writeAttribute("testsuite", in.data[i]->m_test_suite) + .writeAttribute("filename", skipPathFromFilename(in.data[i]->m_file.c_str())) + .writeAttribute("line", line(in.data[i]->m_line)); + } + xml.scopedElement("OverallResultsTestCases") + .writeAttribute("unskipped", in.run_stats->numTestCasesPassingFilters); + } else if(opt.list_test_suites) { + for(unsigned i = 0; i < in.num_data; ++i) + xml.scopedElement("TestSuite").writeAttribute("name", in.data[i]->m_test_suite); + xml.scopedElement("OverallResultsTestCases") + .writeAttribute("unskipped", in.run_stats->numTestCasesPassingFilters); + xml.scopedElement("OverallResultsTestSuites") + .writeAttribute("unskipped", in.run_stats->numTestSuitesPassingFilters); + } + xml.endElement(); + } + + void test_run_start() override { + // remove .exe extension - mainly to have the same output on UNIX and Windows + std::string binary_name = skipPathFromFilename(opt.binary_name.c_str()); +#ifdef DOCTEST_PLATFORM_WINDOWS + if(binary_name.rfind(".exe") != std::string::npos) + binary_name = binary_name.substr(0, binary_name.length() - 4); +#endif // DOCTEST_PLATFORM_WINDOWS + + xml.startElement("doctest").writeAttribute("binary", binary_name); + if(opt.no_version == false) + xml.writeAttribute("version", DOCTEST_VERSION_STR); + + // only the consequential ones (TODO: filters) + xml.scopedElement("Options") + .writeAttribute("order_by", opt.order_by.c_str()) + .writeAttribute("rand_seed", opt.rand_seed) + .writeAttribute("first", opt.first) + .writeAttribute("last", opt.last) + .writeAttribute("abort_after", opt.abort_after) + .writeAttribute("subcase_filter_levels", opt.subcase_filter_levels) + .writeAttribute("case_sensitive", opt.case_sensitive) + .writeAttribute("no_throw", opt.no_throw) + .writeAttribute("no_skip", opt.no_skip); + } + + void test_run_end(const TestRunStats& p) override { + if(tc) // the TestSuite tag - only if there has been at least 1 test case + xml.endElement(); + + xml.scopedElement("OverallResultsAsserts") + .writeAttribute("successes", p.numAsserts - p.numAssertsFailed) + .writeAttribute("failures", p.numAssertsFailed); + + xml.startElement("OverallResultsTestCases") + .writeAttribute("successes", + p.numTestCasesPassingFilters - p.numTestCasesFailed) + .writeAttribute("failures", p.numTestCasesFailed); + if(opt.no_skipped_summary == false) + xml.writeAttribute("skipped", p.numTestCases - p.numTestCasesPassingFilters); + xml.endElement(); + + xml.endElement(); + } + + void test_case_start(const TestCaseData& in) override { + test_case_start_impl(in); + xml.ensureTagClosed(); + } + + void test_case_reenter(const TestCaseData&) override {} + + void test_case_end(const CurrentTestCaseStats& st) override { + xml.startElement("OverallResultsAsserts") + .writeAttribute("successes", + st.numAssertsCurrentTest - st.numAssertsFailedCurrentTest) + .writeAttribute("failures", st.numAssertsFailedCurrentTest); + if(opt.duration) + xml.writeAttribute("duration", st.seconds); + if(tc->m_expected_failures) + xml.writeAttribute("expected_failures", tc->m_expected_failures); + xml.endElement(); + + xml.endElement(); + } + + void test_case_exception(const TestCaseException& e) override { + std::lock_guard lock(mutex); + + xml.scopedElement("Exception") + .writeAttribute("crash", e.is_crash) + .writeText(e.error_string.c_str()); + } + + void subcase_start(const SubcaseSignature& in) override { + std::lock_guard lock(mutex); + + xml.startElement("SubCase") + .writeAttribute("name", in.m_name) + .writeAttribute("filename", skipPathFromFilename(in.m_file)) + .writeAttribute("line", line(in.m_line)); + xml.ensureTagClosed(); + } + + void subcase_end() override { xml.endElement(); } + + void log_assert(const AssertData& rb) override { + if(!rb.m_failed && !opt.success) + return; + + std::lock_guard lock(mutex); + + xml.startElement("Expression") + .writeAttribute("success", !rb.m_failed) + .writeAttribute("type", assertString(rb.m_at)) + .writeAttribute("filename", skipPathFromFilename(rb.m_file)) + .writeAttribute("line", line(rb.m_line)); + + xml.scopedElement("Original").writeText(rb.m_expr); + + if(rb.m_threw) + xml.scopedElement("Exception").writeText(rb.m_exception.c_str()); + + if(rb.m_at & assertType::is_throws_as) + xml.scopedElement("ExpectedException").writeText(rb.m_exception_type); + if(rb.m_at & assertType::is_throws_with) + xml.scopedElement("ExpectedExceptionString").writeText(rb.m_exception_string); + if((rb.m_at & assertType::is_normal) && !rb.m_threw) + xml.scopedElement("Expanded").writeText(rb.m_decomp.c_str()); + + log_contexts(); + + xml.endElement(); + } + + void log_message(const MessageData& mb) override { + std::lock_guard lock(mutex); + + xml.startElement("Message") + .writeAttribute("type", failureString(mb.m_severity)) + .writeAttribute("filename", skipPathFromFilename(mb.m_file)) + .writeAttribute("line", line(mb.m_line)); + + xml.scopedElement("Text").writeText(mb.m_string.c_str()); + + log_contexts(); + + xml.endElement(); + } + + void test_case_skipped(const TestCaseData& in) override { + if(opt.no_skipped_summary == false) { + test_case_start_impl(in); + xml.writeAttribute("skipped", "true"); + xml.endElement(); + } + } + }; + + DOCTEST_REGISTER_REPORTER("xml", 0, XmlReporter); + + void fulltext_log_assert_to_stream(std::ostream& s, const AssertData& rb) { + if((rb.m_at & (assertType::is_throws_as | assertType::is_throws_with)) == + 0) //!OCLINT bitwise operator in conditional + s << Color::Cyan << assertString(rb.m_at) << "( " << rb.m_expr << " ) " + << Color::None; + + if(rb.m_at & assertType::is_throws) { //!OCLINT bitwise operator in conditional + s << (rb.m_threw ? "threw as expected!" : "did NOT throw at all!") << "\n"; + } else if((rb.m_at & assertType::is_throws_as) && + (rb.m_at & assertType::is_throws_with)) { //!OCLINT + s << Color::Cyan << assertString(rb.m_at) << "( " << rb.m_expr << ", \"" + << rb.m_exception_string << "\", " << rb.m_exception_type << " ) " << Color::None; + if(rb.m_threw) { + if(!rb.m_failed) { + s << "threw as expected!\n"; + } else { + s << "threw a DIFFERENT exception! (contents: " << rb.m_exception << ")\n"; + } + } else { + s << "did NOT throw at all!\n"; + } + } else if(rb.m_at & + assertType::is_throws_as) { //!OCLINT bitwise operator in conditional + s << Color::Cyan << assertString(rb.m_at) << "( " << rb.m_expr << ", " + << rb.m_exception_type << " ) " << Color::None + << (rb.m_threw ? (rb.m_threw_as ? "threw as expected!" : + "threw a DIFFERENT exception: ") : + "did NOT throw at all!") + << Color::Cyan << rb.m_exception << "\n"; + } else if(rb.m_at & + assertType::is_throws_with) { //!OCLINT bitwise operator in conditional + s << Color::Cyan << assertString(rb.m_at) << "( " << rb.m_expr << ", \"" + << rb.m_exception_string << "\" ) " << Color::None + << (rb.m_threw ? (!rb.m_failed ? "threw as expected!" : + "threw a DIFFERENT exception: ") : + "did NOT throw at all!") + << Color::Cyan << rb.m_exception << "\n"; + } else if(rb.m_at & assertType::is_nothrow) { //!OCLINT bitwise operator in conditional + s << (rb.m_threw ? "THREW exception: " : "didn't throw!") << Color::Cyan + << rb.m_exception << "\n"; + } else { + s << (rb.m_threw ? "THREW exception: " : + (!rb.m_failed ? "is correct!\n" : "is NOT correct!\n")); + if(rb.m_threw) + s << rb.m_exception << "\n"; + else + s << " values: " << assertString(rb.m_at) << "( " << rb.m_decomp << " )\n"; + } + } + + // TODO: + // - log_contexts() + // - log_message() + // - respond to queries + // - honor remaining options + // - more attributes in tags + struct JUnitReporter : public IReporter + { + XmlWriter xml; + std::mutex mutex; + Timer timer; + std::vector deepestSubcaseStackNames; + + struct JUnitTestCaseData + { +DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") // gmtime + static std::string getCurrentTimestamp() { + // Beware, this is not reentrant because of backward compatibility issues + // Also, UTC only, again because of backward compatibility (%z is C++11) + time_t rawtime; + std::time(&rawtime); + auto const timeStampSize = sizeof("2017-01-16T17:06:45Z"); + + std::tm* timeInfo; + timeInfo = std::gmtime(&rawtime); + + char timeStamp[timeStampSize]; + const char* const fmt = "%Y-%m-%dT%H:%M:%SZ"; + + std::strftime(timeStamp, timeStampSize, fmt, timeInfo); + return std::string(timeStamp); + } +DOCTEST_CLANG_SUPPRESS_WARNING_POP + + struct JUnitTestMessage + { + JUnitTestMessage(const std::string& _message, const std::string& _type, const std::string& _details) + : message(_message), type(_type), details(_details) {} + + JUnitTestMessage(const std::string& _message, const std::string& _details) + : message(_message), type(), details(_details) {} + + std::string message, type, details; + }; + + struct JUnitTestCase + { + JUnitTestCase(const std::string& _classname, const std::string& _name) + : classname(_classname), name(_name), time(0), failures() {} + + std::string classname, name; + double time; + std::vector failures, errors; + }; + + void add(const std::string& classname, const std::string& name) { + testcases.emplace_back(classname, name); + } + + void appendSubcaseNamesToLastTestcase(std::vector nameStack) { + for(auto& curr: nameStack) + if(curr.size()) + testcases.back().name += std::string("/") + curr.c_str(); + } + + void addTime(double time) { + if(time < 1e-4) + time = 0; + testcases.back().time = time; + totalSeconds += time; + } + + void addFailure(const std::string& message, const std::string& type, const std::string& details) { + testcases.back().failures.emplace_back(message, type, details); + ++totalFailures; + } + + void addError(const std::string& message, const std::string& details) { + testcases.back().errors.emplace_back(message, details); + ++totalErrors; + } + + std::vector testcases; + double totalSeconds = 0; + int totalErrors = 0, totalFailures = 0; + }; + + JUnitTestCaseData testCaseData; + + // caching pointers/references to objects of these types - safe to do + const ContextOptions& opt; + const TestCaseData* tc = nullptr; + + JUnitReporter(const ContextOptions& co) + : xml(*co.cout) + , opt(co) {} + + unsigned line(unsigned l) const { return opt.no_line_numbers ? 0 : l; } + + // ========================================================================================= + // WHAT FOLLOWS ARE OVERRIDES OF THE VIRTUAL METHODS OF THE REPORTER INTERFACE + // ========================================================================================= + + void report_query(const QueryData&) override {} + + void test_run_start() override {} + + void test_run_end(const TestRunStats& p) override { + // remove .exe extension - mainly to have the same output on UNIX and Windows + std::string binary_name = skipPathFromFilename(opt.binary_name.c_str()); +#ifdef DOCTEST_PLATFORM_WINDOWS + if(binary_name.rfind(".exe") != std::string::npos) + binary_name = binary_name.substr(0, binary_name.length() - 4); +#endif // DOCTEST_PLATFORM_WINDOWS + xml.startElement("testsuites"); + xml.startElement("testsuite").writeAttribute("name", binary_name) + .writeAttribute("errors", testCaseData.totalErrors) + .writeAttribute("failures", testCaseData.totalFailures) + .writeAttribute("tests", p.numAsserts); + if(opt.no_time_in_output == false) { + xml.writeAttribute("time", testCaseData.totalSeconds); + xml.writeAttribute("timestamp", JUnitTestCaseData::getCurrentTimestamp()); + } + if(opt.no_version == false) + xml.writeAttribute("doctest_version", DOCTEST_VERSION_STR); + + for(const auto& testCase : testCaseData.testcases) { + xml.startElement("testcase") + .writeAttribute("classname", testCase.classname) + .writeAttribute("name", testCase.name); + if(opt.no_time_in_output == false) + xml.writeAttribute("time", testCase.time); + // This is not ideal, but it should be enough to mimic gtest's junit output. + xml.writeAttribute("status", "run"); + + for(const auto& failure : testCase.failures) { + xml.scopedElement("failure") + .writeAttribute("message", failure.message) + .writeAttribute("type", failure.type) + .writeText(failure.details, false); + } + + for(const auto& error : testCase.errors) { + xml.scopedElement("error") + .writeAttribute("message", error.message) + .writeText(error.details); + } + + xml.endElement(); + } + xml.endElement(); + xml.endElement(); + } + + void test_case_start(const TestCaseData& in) override { + testCaseData.add(skipPathFromFilename(in.m_file.c_str()), in.m_name); + timer.start(); + } + + void test_case_reenter(const TestCaseData& in) override { + testCaseData.addTime(timer.getElapsedSeconds()); + testCaseData.appendSubcaseNamesToLastTestcase(deepestSubcaseStackNames); + deepestSubcaseStackNames.clear(); + + timer.start(); + testCaseData.add(skipPathFromFilename(in.m_file.c_str()), in.m_name); + } + + void test_case_end(const CurrentTestCaseStats&) override { + testCaseData.addTime(timer.getElapsedSeconds()); + testCaseData.appendSubcaseNamesToLastTestcase(deepestSubcaseStackNames); + deepestSubcaseStackNames.clear(); + } + + void test_case_exception(const TestCaseException& e) override { + std::lock_guard lock(mutex); + testCaseData.addError("exception", e.error_string.c_str()); + } + + void subcase_start(const SubcaseSignature& in) override { + std::lock_guard lock(mutex); + deepestSubcaseStackNames.push_back(in.m_name); + } + + void subcase_end() override {} + + void log_assert(const AssertData& rb) override { + if(!rb.m_failed) // report only failures & ignore the `success` option + return; + + std::lock_guard lock(mutex); + + std::ostringstream os; + os << skipPathFromFilename(rb.m_file) << (opt.gnu_file_line ? ":" : "(") + << line(rb.m_line) << (opt.gnu_file_line ? ":" : "):") << std::endl; + + fulltext_log_assert_to_stream(os, rb); + testCaseData.addFailure(rb.m_decomp.c_str(), assertString(rb.m_at), os.str()); + } + + void log_message(const MessageData&) override {} + + void test_case_skipped(const TestCaseData&) override {} + }; + + DOCTEST_REGISTER_REPORTER("junit", 0, JUnitReporter); + + struct Whitespace + { + int nrSpaces; + explicit Whitespace(int nr) + : nrSpaces(nr) {} + }; + + std::ostream& operator<<(std::ostream& out, const Whitespace& ws) { + if(ws.nrSpaces != 0) + out << std::setw(ws.nrSpaces) << ' '; + return out; + } + + struct ConsoleReporter : public IReporter + { + std::ostream& s; + bool hasLoggedCurrentTestStart; + std::vector subcasesStack; + size_t currentSubcaseLevel; + std::mutex mutex; + + // caching pointers/references to objects of these types - safe to do + const ContextOptions& opt; + const TestCaseData* tc; + + ConsoleReporter(const ContextOptions& co) + : s(*co.cout) + , opt(co) {} + + ConsoleReporter(const ContextOptions& co, std::ostream& ostr) + : s(ostr) + , opt(co) {} + + // ========================================================================================= + // WHAT FOLLOWS ARE HELPERS USED BY THE OVERRIDES OF THE VIRTUAL METHODS OF THE INTERFACE + // ========================================================================================= + + void separator_to_stream() { + s << Color::Yellow + << "===============================================================================" + "\n"; + } + + const char* getSuccessOrFailString(bool success, assertType::Enum at, + const char* success_str) { + if(success) + return success_str; + return failureString(at); + } + + Color::Enum getSuccessOrFailColor(bool success, assertType::Enum at) { + return success ? Color::BrightGreen : + (at & assertType::is_warn) ? Color::Yellow : Color::Red; + } + + void successOrFailColoredStringToStream(bool success, assertType::Enum at, + const char* success_str = "SUCCESS") { + s << getSuccessOrFailColor(success, at) + << getSuccessOrFailString(success, at, success_str) << ": "; + } + + void log_contexts() { + int num_contexts = get_num_active_contexts(); + if(num_contexts) { + auto contexts = get_active_contexts(); + + s << Color::None << " logged: "; + for(int i = 0; i < num_contexts; ++i) { + s << (i == 0 ? "" : " "); + contexts[i]->stringify(&s); + s << "\n"; + } + } + + s << "\n"; + } + + // this was requested to be made virtual so users could override it + virtual void file_line_to_stream(const char* file, int line, + const char* tail = "") { + s << Color::LightGrey << skipPathFromFilename(file) << (opt.gnu_file_line ? ":" : "(") + << (opt.no_line_numbers ? 0 : line) // 0 or the real num depending on the option + << (opt.gnu_file_line ? ":" : "):") << tail; + } + + void logTestStart() { + if(hasLoggedCurrentTestStart) + return; + + separator_to_stream(); + file_line_to_stream(tc->m_file.c_str(), tc->m_line, "\n"); + if(tc->m_description) + s << Color::Yellow << "DESCRIPTION: " << Color::None << tc->m_description << "\n"; + if(tc->m_test_suite && tc->m_test_suite[0] != '\0') + s << Color::Yellow << "TEST SUITE: " << Color::None << tc->m_test_suite << "\n"; + if(strncmp(tc->m_name, " Scenario:", 11) != 0) + s << Color::Yellow << "TEST CASE: "; + s << Color::None << tc->m_name << "\n"; + + for(size_t i = 0; i < currentSubcaseLevel; ++i) { + if(subcasesStack[i].m_name[0] != '\0') + s << " " << subcasesStack[i].m_name << "\n"; + } + + if(currentSubcaseLevel != subcasesStack.size()) { + s << Color::Yellow << "\nDEEPEST SUBCASE STACK REACHED (DIFFERENT FROM THE CURRENT ONE):\n" << Color::None; + for(size_t i = 0; i < subcasesStack.size(); ++i) { + if(subcasesStack[i].m_name[0] != '\0') + s << " " << subcasesStack[i].m_name << "\n"; + } + } + + s << "\n"; + + hasLoggedCurrentTestStart = true; + } + + void printVersion() { + if(opt.no_version == false) + s << Color::Cyan << "[doctest] " << Color::None << "doctest version is \"" + << DOCTEST_VERSION_STR << "\"\n"; + } + + void printIntro() { + printVersion(); + s << Color::Cyan << "[doctest] " << Color::None + << "run with \"--" DOCTEST_OPTIONS_PREFIX_DISPLAY "help\" for options\n"; + } + + void printHelp() { + int sizePrefixDisplay = static_cast(strlen(DOCTEST_OPTIONS_PREFIX_DISPLAY)); + printVersion(); + // clang-format off + s << Color::Cyan << "[doctest]\n" << Color::None; + s << Color::Cyan << "[doctest] " << Color::None; + s << "boolean values: \"1/on/yes/true\" or \"0/off/no/false\"\n"; + s << Color::Cyan << "[doctest] " << Color::None; + s << "filter values: \"str1,str2,str3\" (comma separated strings)\n"; + s << Color::Cyan << "[doctest]\n" << Color::None; + s << Color::Cyan << "[doctest] " << Color::None; + s << "filters use wildcards for matching strings\n"; + s << Color::Cyan << "[doctest] " << Color::None; + s << "something passes a filter if any of the strings in a filter matches\n"; +#ifndef DOCTEST_CONFIG_NO_UNPREFIXED_OPTIONS + s << Color::Cyan << "[doctest]\n" << Color::None; + s << Color::Cyan << "[doctest] " << Color::None; + s << "ALL FLAGS, OPTIONS AND FILTERS ALSO AVAILABLE WITH A \"" DOCTEST_CONFIG_OPTIONS_PREFIX "\" PREFIX!!!\n"; +#endif + s << Color::Cyan << "[doctest]\n" << Color::None; + s << Color::Cyan << "[doctest] " << Color::None; + s << "Query flags - the program quits after them. Available:\n\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "?, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "help, -" DOCTEST_OPTIONS_PREFIX_DISPLAY "h " + << Whitespace(sizePrefixDisplay*0) << "prints this message\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "v, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "version " + << Whitespace(sizePrefixDisplay*1) << "prints the version\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "c, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "count " + << Whitespace(sizePrefixDisplay*1) << "prints the number of matching tests\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "ltc, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "list-test-cases " + << Whitespace(sizePrefixDisplay*1) << "lists all matching tests by name\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "lts, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "list-test-suites " + << Whitespace(sizePrefixDisplay*1) << "lists all matching test suites\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "lr, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "list-reporters " + << Whitespace(sizePrefixDisplay*1) << "lists all registered reporters\n\n"; + // ================================================================================== << 79 + s << Color::Cyan << "[doctest] " << Color::None; + s << "The available / options/filters are:\n\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "tc, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "test-case= " + << Whitespace(sizePrefixDisplay*1) << "filters tests by their name\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "tce, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "test-case-exclude= " + << Whitespace(sizePrefixDisplay*1) << "filters OUT tests by their name\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "sf, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "source-file= " + << Whitespace(sizePrefixDisplay*1) << "filters tests by their file\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "sfe, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "source-file-exclude= " + << Whitespace(sizePrefixDisplay*1) << "filters OUT tests by their file\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "ts, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "test-suite= " + << Whitespace(sizePrefixDisplay*1) << "filters tests by their test suite\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "tse, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "test-suite-exclude= " + << Whitespace(sizePrefixDisplay*1) << "filters OUT tests by their test suite\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "sc, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "subcase= " + << Whitespace(sizePrefixDisplay*1) << "filters subcases by their name\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "sce, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "subcase-exclude= " + << Whitespace(sizePrefixDisplay*1) << "filters OUT subcases by their name\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "r, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "reporters= " + << Whitespace(sizePrefixDisplay*1) << "reporters to use (console is default)\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "o, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "out= " + << Whitespace(sizePrefixDisplay*1) << "output filename\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "ob, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "order-by= " + << Whitespace(sizePrefixDisplay*1) << "how the tests should be ordered\n"; + s << Whitespace(sizePrefixDisplay*3) << " - by [file/suite/name/rand]\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "rs, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "rand-seed= " + << Whitespace(sizePrefixDisplay*1) << "seed for random ordering\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "f, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "first= " + << Whitespace(sizePrefixDisplay*1) << "the first test passing the filters to\n"; + s << Whitespace(sizePrefixDisplay*3) << " execute - for range-based execution\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "l, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "last= " + << Whitespace(sizePrefixDisplay*1) << "the last test passing the filters to\n"; + s << Whitespace(sizePrefixDisplay*3) << " execute - for range-based execution\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "aa, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "abort-after= " + << Whitespace(sizePrefixDisplay*1) << "stop after failed assertions\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "scfl,--" DOCTEST_OPTIONS_PREFIX_DISPLAY "subcase-filter-levels= " + << Whitespace(sizePrefixDisplay*1) << "apply filters for the first levels\n"; + s << Color::Cyan << "\n[doctest] " << Color::None; + s << "Bool options - can be used like flags and true is assumed. Available:\n\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "s, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "success= " + << Whitespace(sizePrefixDisplay*1) << "include successful assertions in output\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "cs, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "case-sensitive= " + << Whitespace(sizePrefixDisplay*1) << "filters being treated as case sensitive\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "e, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "exit= " + << Whitespace(sizePrefixDisplay*1) << "exits after the tests finish\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "d, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "duration= " + << Whitespace(sizePrefixDisplay*1) << "prints the time duration of each test\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nt, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-throw= " + << Whitespace(sizePrefixDisplay*1) << "skips exceptions-related assert checks\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "ne, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-exitcode= " + << Whitespace(sizePrefixDisplay*1) << "returns (or exits) always with success\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nr, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-run= " + << Whitespace(sizePrefixDisplay*1) << "skips all runtime doctest operations\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nv, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-version= " + << Whitespace(sizePrefixDisplay*1) << "omit the framework version in the output\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nc, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-colors= " + << Whitespace(sizePrefixDisplay*1) << "disables colors in output\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "fc, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "force-colors= " + << Whitespace(sizePrefixDisplay*1) << "use colors even when not in a tty\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nb, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-breaks= " + << Whitespace(sizePrefixDisplay*1) << "disables breakpoints in debuggers\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "ns, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-skip= " + << Whitespace(sizePrefixDisplay*1) << "don't skip test cases marked as skip\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "gfl, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "gnu-file-line= " + << Whitespace(sizePrefixDisplay*1) << ":n: vs (n): for line numbers in output\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "npf, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-path-filenames= " + << Whitespace(sizePrefixDisplay*1) << "only filenames and no paths in output\n"; + s << " -" DOCTEST_OPTIONS_PREFIX_DISPLAY "nln, --" DOCTEST_OPTIONS_PREFIX_DISPLAY "no-line-numbers= " + << Whitespace(sizePrefixDisplay*1) << "0 instead of real line numbers in output\n"; + // ================================================================================== << 79 + // clang-format on + + s << Color::Cyan << "\n[doctest] " << Color::None; + s << "for more information visit the project documentation\n\n"; + } + + void printRegisteredReporters() { + printVersion(); + auto printReporters = [this] (const reporterMap& reporters, const char* type) { + if(reporters.size()) { + s << Color::Cyan << "[doctest] " << Color::None << "listing all registered " << type << "\n"; + for(auto& curr : reporters) + s << "priority: " << std::setw(5) << curr.first.first + << " name: " << curr.first.second << "\n"; + } + }; + printReporters(getListeners(), "listeners"); + printReporters(getReporters(), "reporters"); + } + + void list_query_results() { + separator_to_stream(); + if(opt.count || opt.list_test_cases) { + s << Color::Cyan << "[doctest] " << Color::None + << "unskipped test cases passing the current filters: " + << g_cs->numTestCasesPassingFilters << "\n"; + } else if(opt.list_test_suites) { + s << Color::Cyan << "[doctest] " << Color::None + << "unskipped test cases passing the current filters: " + << g_cs->numTestCasesPassingFilters << "\n"; + s << Color::Cyan << "[doctest] " << Color::None + << "test suites with unskipped test cases passing the current filters: " + << g_cs->numTestSuitesPassingFilters << "\n"; + } + } + + // ========================================================================================= + // WHAT FOLLOWS ARE OVERRIDES OF THE VIRTUAL METHODS OF THE REPORTER INTERFACE + // ========================================================================================= + + void report_query(const QueryData& in) override { + if(opt.version) { + printVersion(); + } else if(opt.help) { + printHelp(); + } else if(opt.list_reporters) { + printRegisteredReporters(); + } else if(opt.count || opt.list_test_cases) { + if(opt.list_test_cases) { + s << Color::Cyan << "[doctest] " << Color::None + << "listing all test case names\n"; + separator_to_stream(); + } + + for(unsigned i = 0; i < in.num_data; ++i) + s << Color::None << in.data[i]->m_name << "\n"; + + separator_to_stream(); + + s << Color::Cyan << "[doctest] " << Color::None + << "unskipped test cases passing the current filters: " + << g_cs->numTestCasesPassingFilters << "\n"; + + } else if(opt.list_test_suites) { + s << Color::Cyan << "[doctest] " << Color::None << "listing all test suites\n"; + separator_to_stream(); + + for(unsigned i = 0; i < in.num_data; ++i) + s << Color::None << in.data[i]->m_test_suite << "\n"; + + separator_to_stream(); + + s << Color::Cyan << "[doctest] " << Color::None + << "unskipped test cases passing the current filters: " + << g_cs->numTestCasesPassingFilters << "\n"; + s << Color::Cyan << "[doctest] " << Color::None + << "test suites with unskipped test cases passing the current filters: " + << g_cs->numTestSuitesPassingFilters << "\n"; + } + } + + void test_run_start() override { printIntro(); } + + void test_run_end(const TestRunStats& p) override { + separator_to_stream(); + s << std::dec; + + const bool anythingFailed = p.numTestCasesFailed > 0 || p.numAssertsFailed > 0; + s << Color::Cyan << "[doctest] " << Color::None << "test cases: " << std::setw(6) + << p.numTestCasesPassingFilters << " | " + << ((p.numTestCasesPassingFilters == 0 || anythingFailed) ? Color::None : + Color::Green) + << std::setw(6) << p.numTestCasesPassingFilters - p.numTestCasesFailed << " passed" + << Color::None << " | " << (p.numTestCasesFailed > 0 ? Color::Red : Color::None) + << std::setw(6) << p.numTestCasesFailed << " failed" << Color::None << " | "; + if(opt.no_skipped_summary == false) { + const int numSkipped = p.numTestCases - p.numTestCasesPassingFilters; + s << (numSkipped == 0 ? Color::None : Color::Yellow) << std::setw(6) << numSkipped + << " skipped" << Color::None; + } + s << "\n"; + s << Color::Cyan << "[doctest] " << Color::None << "assertions: " << std::setw(6) + << p.numAsserts << " | " + << ((p.numAsserts == 0 || anythingFailed) ? Color::None : Color::Green) + << std::setw(6) << (p.numAsserts - p.numAssertsFailed) << " passed" << Color::None + << " | " << (p.numAssertsFailed > 0 ? Color::Red : Color::None) << std::setw(6) + << p.numAssertsFailed << " failed" << Color::None << " |\n"; + s << Color::Cyan << "[doctest] " << Color::None + << "Status: " << (p.numTestCasesFailed > 0 ? Color::Red : Color::Green) + << ((p.numTestCasesFailed > 0) ? "FAILURE!" : "SUCCESS!") << Color::None << std::endl; + } + + void test_case_start(const TestCaseData& in) override { + hasLoggedCurrentTestStart = false; + tc = ∈ + subcasesStack.clear(); + currentSubcaseLevel = 0; + } + + void test_case_reenter(const TestCaseData&) override { + subcasesStack.clear(); + } + + void test_case_end(const CurrentTestCaseStats& st) override { + // log the preamble of the test case only if there is something + // else to print - something other than that an assert has failed + if(opt.duration || + (st.failure_flags && st.failure_flags != TestCaseFailureReason::AssertFailure)) + logTestStart(); + + if(opt.duration) + s << Color::None << std::setprecision(6) << std::fixed << st.seconds + << " s: " << tc->m_name << "\n"; + + if(st.failure_flags & TestCaseFailureReason::Timeout) + s << Color::Red << "Test case exceeded time limit of " << std::setprecision(6) + << std::fixed << tc->m_timeout << "!\n"; + + if(st.failure_flags & TestCaseFailureReason::ShouldHaveFailedButDidnt) { + s << Color::Red << "Should have failed but didn't! Marking it as failed!\n"; + } else if(st.failure_flags & TestCaseFailureReason::ShouldHaveFailedAndDid) { + s << Color::Yellow << "Failed as expected so marking it as not failed\n"; + } else if(st.failure_flags & TestCaseFailureReason::CouldHaveFailedAndDid) { + s << Color::Yellow << "Allowed to fail so marking it as not failed\n"; + } else if(st.failure_flags & TestCaseFailureReason::DidntFailExactlyNumTimes) { + s << Color::Red << "Didn't fail exactly " << tc->m_expected_failures + << " times so marking it as failed!\n"; + } else if(st.failure_flags & TestCaseFailureReason::FailedExactlyNumTimes) { + s << Color::Yellow << "Failed exactly " << tc->m_expected_failures + << " times as expected so marking it as not failed!\n"; + } + if(st.failure_flags & TestCaseFailureReason::TooManyFailedAsserts) { + s << Color::Red << "Aborting - too many failed asserts!\n"; + } + s << Color::None; // lgtm [cpp/useless-expression] + } + + void test_case_exception(const TestCaseException& e) override { + logTestStart(); + + file_line_to_stream(tc->m_file.c_str(), tc->m_line, " "); + successOrFailColoredStringToStream(false, e.is_crash ? assertType::is_require : + assertType::is_check); + s << Color::Red << (e.is_crash ? "test case CRASHED: " : "test case THREW exception: ") + << Color::Cyan << e.error_string << "\n"; + + int num_stringified_contexts = get_num_stringified_contexts(); + if(num_stringified_contexts) { + auto stringified_contexts = get_stringified_contexts(); + s << Color::None << " logged: "; + for(int i = num_stringified_contexts; i > 0; --i) { + s << (i == num_stringified_contexts ? "" : " ") + << stringified_contexts[i - 1] << "\n"; + } + } + s << "\n" << Color::None; + } + + void subcase_start(const SubcaseSignature& subc) override { + std::lock_guard lock(mutex); + subcasesStack.push_back(subc); + ++currentSubcaseLevel; + hasLoggedCurrentTestStart = false; + } + + void subcase_end() override { + std::lock_guard lock(mutex); + --currentSubcaseLevel; + hasLoggedCurrentTestStart = false; + } + + void log_assert(const AssertData& rb) override { + if(!rb.m_failed && !opt.success) + return; + + std::lock_guard lock(mutex); + + logTestStart(); + + file_line_to_stream(rb.m_file, rb.m_line, " "); + successOrFailColoredStringToStream(!rb.m_failed, rb.m_at); + + fulltext_log_assert_to_stream(s, rb); + + log_contexts(); + } + + void log_message(const MessageData& mb) override { + std::lock_guard lock(mutex); + + logTestStart(); + + file_line_to_stream(mb.m_file, mb.m_line, " "); + s << getSuccessOrFailColor(false, mb.m_severity) + << getSuccessOrFailString(mb.m_severity & assertType::is_warn, mb.m_severity, + "MESSAGE") << ": "; + s << Color::None << mb.m_string << "\n"; + log_contexts(); + } + + void test_case_skipped(const TestCaseData&) override {} + }; + + DOCTEST_REGISTER_REPORTER("console", 0, ConsoleReporter); + +#ifdef DOCTEST_PLATFORM_WINDOWS + struct DebugOutputWindowReporter : public ConsoleReporter + { + DOCTEST_THREAD_LOCAL static std::ostringstream oss; + + DebugOutputWindowReporter(const ContextOptions& co) + : ConsoleReporter(co, oss) {} + +#define DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(func, type, arg) \ + void func(type arg) override { \ + bool with_col = g_no_colors; \ + g_no_colors = false; \ + ConsoleReporter::func(arg); \ + DOCTEST_OUTPUT_DEBUG_STRING(oss.str().c_str()); \ + oss.str(""); \ + g_no_colors = with_col; \ + } + + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_run_start, DOCTEST_EMPTY, DOCTEST_EMPTY) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_run_end, const TestRunStats&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_case_start, const TestCaseData&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_case_reenter, const TestCaseData&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_case_end, const CurrentTestCaseStats&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_case_exception, const TestCaseException&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(subcase_start, const SubcaseSignature&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(subcase_end, DOCTEST_EMPTY, DOCTEST_EMPTY) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(log_assert, const AssertData&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(log_message, const MessageData&, in) + DOCTEST_DEBUG_OUTPUT_REPORTER_OVERRIDE(test_case_skipped, const TestCaseData&, in) + }; + + DOCTEST_THREAD_LOCAL std::ostringstream DebugOutputWindowReporter::oss; +#endif // DOCTEST_PLATFORM_WINDOWS + + // the implementation of parseOption() + bool parseOptionImpl(int argc, const char* const* argv, const char* pattern, String* value) { + // going from the end to the beginning and stopping on the first occurrence from the end + for(int i = argc; i > 0; --i) { + auto index = i - 1; + auto temp = std::strstr(argv[index], pattern); + if(temp && (value || strlen(temp) == strlen(pattern))) { //!OCLINT prefer early exits and continue + // eliminate matches in which the chars before the option are not '-' + bool noBadCharsFound = true; + auto curr = argv[index]; + while(curr != temp) { + if(*curr++ != '-') { + noBadCharsFound = false; + break; + } + } + if(noBadCharsFound && argv[index][0] == '-') { + if(value) { + // parsing the value of an option + temp += strlen(pattern); + const unsigned len = strlen(temp); + if(len) { + *value = temp; + return true; + } + } else { + // just a flag - no value + return true; + } + } + } + } + return false; + } + + // parses an option and returns the string after the '=' character + bool parseOption(int argc, const char* const* argv, const char* pattern, String* value = nullptr, + const String& defaultVal = String()) { + if(value) + *value = defaultVal; +#ifndef DOCTEST_CONFIG_NO_UNPREFIXED_OPTIONS + // offset (normally 3 for "dt-") to skip prefix + if(parseOptionImpl(argc, argv, pattern + strlen(DOCTEST_CONFIG_OPTIONS_PREFIX), value)) + return true; +#endif // DOCTEST_CONFIG_NO_UNPREFIXED_OPTIONS + return parseOptionImpl(argc, argv, pattern, value); + } + + // locates a flag on the command line + bool parseFlag(int argc, const char* const* argv, const char* pattern) { + return parseOption(argc, argv, pattern); + } + + // parses a comma separated list of words after a pattern in one of the arguments in argv + bool parseCommaSepArgs(int argc, const char* const* argv, const char* pattern, + std::vector& res) { + String filtersString; + if(parseOption(argc, argv, pattern, &filtersString)) { + // tokenize with "," as a separator + // cppcheck-suppress strtokCalled + DOCTEST_CLANG_SUPPRESS_WARNING_WITH_PUSH("-Wdeprecated-declarations") + auto pch = std::strtok(filtersString.c_str(), ","); // modifies the string + while(pch != nullptr) { + if(strlen(pch)) + res.push_back(pch); + // uses the strtok() internal state to go to the next token + // cppcheck-suppress strtokCalled + pch = std::strtok(nullptr, ","); + } + DOCTEST_CLANG_SUPPRESS_WARNING_POP + return true; + } + return false; + } + + enum optionType + { + option_bool, + option_int + }; + + // parses an int/bool option from the command line + bool parseIntOption(int argc, const char* const* argv, const char* pattern, optionType type, + int& res) { + String parsedValue; + if(!parseOption(argc, argv, pattern, &parsedValue)) + return false; + + if(type == 0) { + // boolean + const char positive[][5] = {"1", "true", "on", "yes"}; // 5 - strlen("true") + 1 + const char negative[][6] = {"0", "false", "off", "no"}; // 6 - strlen("false") + 1 + + // if the value matches any of the positive/negative possibilities + for(unsigned i = 0; i < 4; i++) { + if(parsedValue.compare(positive[i], true) == 0) { + res = 1; //!OCLINT parameter reassignment + return true; + } + if(parsedValue.compare(negative[i], true) == 0) { + res = 0; //!OCLINT parameter reassignment + return true; + } + } + } else { + // integer + // TODO: change this to use std::stoi or something else! currently it uses undefined behavior - assumes '0' on failed parse... + int theInt = std::atoi(parsedValue.c_str()); // NOLINT + if(theInt != 0) { + res = theInt; //!OCLINT parameter reassignment + return true; + } + } + return false; + } +} // namespace + +Context::Context(int argc, const char* const* argv) + : p(new detail::ContextState) { + parseArgs(argc, argv, true); + if(argc) + p->binary_name = argv[0]; +} + +Context::~Context() { + if(g_cs == p) + g_cs = nullptr; + delete p; +} + +void Context::applyCommandLine(int argc, const char* const* argv) { + parseArgs(argc, argv); + if(argc) + p->binary_name = argv[0]; +} + +// parses args +void Context::parseArgs(int argc, const char* const* argv, bool withDefaults) { + using namespace detail; + + // clang-format off + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "source-file=", p->filters[0]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "sf=", p->filters[0]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "source-file-exclude=",p->filters[1]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "sfe=", p->filters[1]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "test-suite=", p->filters[2]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "ts=", p->filters[2]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "test-suite-exclude=", p->filters[3]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "tse=", p->filters[3]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "test-case=", p->filters[4]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "tc=", p->filters[4]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "test-case-exclude=", p->filters[5]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "tce=", p->filters[5]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "subcase=", p->filters[6]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "sc=", p->filters[6]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "subcase-exclude=", p->filters[7]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "sce=", p->filters[7]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "reporters=", p->filters[8]); + parseCommaSepArgs(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "r=", p->filters[8]); + // clang-format on + + int intRes = 0; + String strRes; + +#define DOCTEST_PARSE_AS_BOOL_OR_FLAG(name, sname, var, default) \ + if(parseIntOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX name "=", option_bool, intRes) || \ + parseIntOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX sname "=", option_bool, intRes)) \ + p->var = !!intRes; \ + else if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX name) || \ + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX sname)) \ + p->var = true; \ + else if(withDefaults) \ + p->var = default + +#define DOCTEST_PARSE_INT_OPTION(name, sname, var, default) \ + if(parseIntOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX name "=", option_int, intRes) || \ + parseIntOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX sname "=", option_int, intRes)) \ + p->var = intRes; \ + else if(withDefaults) \ + p->var = default + +#define DOCTEST_PARSE_STR_OPTION(name, sname, var, default) \ + if(parseOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX name "=", &strRes, default) || \ + parseOption(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX sname "=", &strRes, default) || \ + withDefaults) \ + p->var = strRes + + // clang-format off + DOCTEST_PARSE_STR_OPTION("out", "o", out, ""); + DOCTEST_PARSE_STR_OPTION("order-by", "ob", order_by, "file"); + DOCTEST_PARSE_INT_OPTION("rand-seed", "rs", rand_seed, 0); + + DOCTEST_PARSE_INT_OPTION("first", "f", first, 0); + DOCTEST_PARSE_INT_OPTION("last", "l", last, UINT_MAX); + + DOCTEST_PARSE_INT_OPTION("abort-after", "aa", abort_after, 0); + DOCTEST_PARSE_INT_OPTION("subcase-filter-levels", "scfl", subcase_filter_levels, INT_MAX); + + DOCTEST_PARSE_AS_BOOL_OR_FLAG("success", "s", success, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("case-sensitive", "cs", case_sensitive, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("exit", "e", exit, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("duration", "d", duration, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-throw", "nt", no_throw, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-exitcode", "ne", no_exitcode, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-run", "nr", no_run, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-version", "nv", no_version, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-colors", "nc", no_colors, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("force-colors", "fc", force_colors, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-breaks", "nb", no_breaks, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-skip", "ns", no_skip, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("gnu-file-line", "gfl", gnu_file_line, !bool(DOCTEST_MSVC)); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-path-filenames", "npf", no_path_in_filenames, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-line-numbers", "nln", no_line_numbers, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-skipped-summary", "nss", no_skipped_summary, false); + DOCTEST_PARSE_AS_BOOL_OR_FLAG("no-time-in-output", "ntio", no_time_in_output, false); + // clang-format on + + if(withDefaults) { + p->help = false; + p->version = false; + p->count = false; + p->list_test_cases = false; + p->list_test_suites = false; + p->list_reporters = false; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "help") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "h") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "?")) { + p->help = true; + p->exit = true; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "version") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "v")) { + p->version = true; + p->exit = true; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "count") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "c")) { + p->count = true; + p->exit = true; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "list-test-cases") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "ltc")) { + p->list_test_cases = true; + p->exit = true; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "list-test-suites") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "lts")) { + p->list_test_suites = true; + p->exit = true; + } + if(parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "list-reporters") || + parseFlag(argc, argv, DOCTEST_CONFIG_OPTIONS_PREFIX "lr")) { + p->list_reporters = true; + p->exit = true; + } +} + +// allows the user to add procedurally to the filters from the command line +void Context::addFilter(const char* filter, const char* value) { setOption(filter, value); } + +// allows the user to clear all filters from the command line +void Context::clearFilters() { + for(auto& curr : p->filters) + curr.clear(); +} + +// allows the user to override procedurally the int/bool options from the command line +void Context::setOption(const char* option, int value) { + setOption(option, toString(value).c_str()); +} + +// allows the user to override procedurally the string options from the command line +void Context::setOption(const char* option, const char* value) { + auto argv = String("-") + option + "=" + value; + auto lvalue = argv.c_str(); + parseArgs(1, &lvalue); +} + +// users should query this in their main() and exit the program if true +bool Context::shouldExit() { return p->exit; } + +void Context::setAsDefaultForAssertsOutOfTestCases() { g_cs = p; } + +void Context::setAssertHandler(detail::assert_handler ah) { p->ah = ah; } + +// the main function that does all the filtering and test running +int Context::run() { + using namespace detail; + + // save the old context state in case such was setup - for using asserts out of a testing context + auto old_cs = g_cs; + // this is the current contest + g_cs = p; + is_running_in_test = true; + + g_no_colors = p->no_colors; + p->resetRunData(); + + // stdout by default + p->cout = &std::cout; + p->cerr = &std::cerr; + + // or to a file if specified + std::fstream fstr; + if(p->out.size()) { + fstr.open(p->out.c_str(), std::fstream::out); + p->cout = &fstr; + } + + auto cleanup_and_return = [&]() { + if(fstr.is_open()) + fstr.close(); + + // restore context + g_cs = old_cs; + is_running_in_test = false; + + // we have to free the reporters which were allocated when the run started + for(auto& curr : p->reporters_currently_used) + delete curr; + p->reporters_currently_used.clear(); + + if(p->numTestCasesFailed && !p->no_exitcode) + return EXIT_FAILURE; + return EXIT_SUCCESS; + }; + + // setup default reporter if none is given through the command line + if(p->filters[8].empty()) + p->filters[8].push_back("console"); + + // check to see if any of the registered reporters has been selected + for(auto& curr : getReporters()) { + if(matchesAny(curr.first.second.c_str(), p->filters[8], false, p->case_sensitive)) + p->reporters_currently_used.push_back(curr.second(*g_cs)); + } + + // TODO: check if there is nothing in reporters_currently_used + + // prepend all listeners + for(auto& curr : getListeners()) + p->reporters_currently_used.insert(p->reporters_currently_used.begin(), curr.second(*g_cs)); + +#ifdef DOCTEST_PLATFORM_WINDOWS + if(isDebuggerActive()) + p->reporters_currently_used.push_back(new DebugOutputWindowReporter(*g_cs)); +#endif // DOCTEST_PLATFORM_WINDOWS + + // handle version, help and no_run + if(p->no_run || p->version || p->help || p->list_reporters) { + DOCTEST_ITERATE_THROUGH_REPORTERS(report_query, QueryData()); + + return cleanup_and_return(); + } + + std::vector testArray; + for(auto& curr : getRegisteredTests()) + testArray.push_back(&curr); + p->numTestCases = testArray.size(); + + // sort the collected records + if(!testArray.empty()) { + if(p->order_by.compare("file", true) == 0) { + std::sort(testArray.begin(), testArray.end(), fileOrderComparator); + } else if(p->order_by.compare("suite", true) == 0) { + std::sort(testArray.begin(), testArray.end(), suiteOrderComparator); + } else if(p->order_by.compare("name", true) == 0) { + std::sort(testArray.begin(), testArray.end(), nameOrderComparator); + } else if(p->order_by.compare("rand", true) == 0) { + std::srand(p->rand_seed); + + // random_shuffle implementation + const auto first = &testArray[0]; + for(size_t i = testArray.size() - 1; i > 0; --i) { + int idxToSwap = std::rand() % (i + 1); // NOLINT + + const auto temp = first[i]; + + first[i] = first[idxToSwap]; + first[idxToSwap] = temp; + } + } + } + + std::set testSuitesPassingFilt; + + bool query_mode = p->count || p->list_test_cases || p->list_test_suites; + std::vector queryResults; + + if(!query_mode) + DOCTEST_ITERATE_THROUGH_REPORTERS(test_run_start, DOCTEST_EMPTY); + + // invoke the registered functions if they match the filter criteria (or just count them) + for(auto& curr : testArray) { + const auto& tc = *curr; + + bool skip_me = false; + if(tc.m_skip && !p->no_skip) + skip_me = true; + + if(!matchesAny(tc.m_file.c_str(), p->filters[0], true, p->case_sensitive)) + skip_me = true; + if(matchesAny(tc.m_file.c_str(), p->filters[1], false, p->case_sensitive)) + skip_me = true; + if(!matchesAny(tc.m_test_suite, p->filters[2], true, p->case_sensitive)) + skip_me = true; + if(matchesAny(tc.m_test_suite, p->filters[3], false, p->case_sensitive)) + skip_me = true; + if(!matchesAny(tc.m_name, p->filters[4], true, p->case_sensitive)) + skip_me = true; + if(matchesAny(tc.m_name, p->filters[5], false, p->case_sensitive)) + skip_me = true; + + if(!skip_me) + p->numTestCasesPassingFilters++; + + // skip the test if it is not in the execution range + if((p->last < p->numTestCasesPassingFilters && p->first <= p->last) || + (p->first > p->numTestCasesPassingFilters)) + skip_me = true; + + if(skip_me) { + if(!query_mode) + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_skipped, tc); + continue; + } + + // do not execute the test if we are to only count the number of filter passing tests + if(p->count) + continue; + + // print the name of the test and don't execute it + if(p->list_test_cases) { + queryResults.push_back(&tc); + continue; + } + + // print the name of the test suite if not done already and don't execute it + if(p->list_test_suites) { + if((testSuitesPassingFilt.count(tc.m_test_suite) == 0) && tc.m_test_suite[0] != '\0') { + queryResults.push_back(&tc); + testSuitesPassingFilt.insert(tc.m_test_suite); + p->numTestSuitesPassingFilters++; + } + continue; + } + + // execute the test if it passes all the filtering + { + p->currentTest = &tc; + + p->failure_flags = TestCaseFailureReason::None; + p->seconds = 0; + + // reset atomic counters + p->numAssertsFailedCurrentTest_atomic = 0; + p->numAssertsCurrentTest_atomic = 0; + + p->subcasesPassed.clear(); + + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_start, tc); + + p->timer.start(); + + bool run_test = true; + + do { + // reset some of the fields for subcases (except for the set of fully passed ones) + p->should_reenter = false; + p->subcasesCurrentMaxLevel = 0; + p->subcasesStack.clear(); + + p->shouldLogCurrentException = true; + + // reset stuff for logging with INFO() + p->stringifiedContexts.clear(); + +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + try { +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + FatalConditionHandler fatalConditionHandler; // Handle signals + // execute the test + tc.m_test(); + fatalConditionHandler.reset(); +#ifndef DOCTEST_CONFIG_NO_EXCEPTIONS + } catch(const TestFailureException&) { + p->failure_flags |= TestCaseFailureReason::AssertFailure; + } catch(...) { + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_exception, + {translateActiveException(), false}); + p->failure_flags |= TestCaseFailureReason::Exception; + } +#endif // DOCTEST_CONFIG_NO_EXCEPTIONS + + // exit this loop if enough assertions have failed - even if there are more subcases + if(p->abort_after > 0 && + p->numAssertsFailed + p->numAssertsFailedCurrentTest_atomic >= p->abort_after) { + run_test = false; + p->failure_flags |= TestCaseFailureReason::TooManyFailedAsserts; + } + + if(p->should_reenter && run_test) + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_reenter, tc); + if(!p->should_reenter) + run_test = false; + } while(run_test); + + p->finalizeTestCaseData(); + + DOCTEST_ITERATE_THROUGH_REPORTERS(test_case_end, *g_cs); + + p->currentTest = nullptr; + + // stop executing tests if enough assertions have failed + if(p->abort_after > 0 && p->numAssertsFailed >= p->abort_after) + break; + } + } + + if(!query_mode) { + DOCTEST_ITERATE_THROUGH_REPORTERS(test_run_end, *g_cs); + } else { + QueryData qdata; + qdata.run_stats = g_cs; + qdata.data = queryResults.data(); + qdata.num_data = unsigned(queryResults.size()); + DOCTEST_ITERATE_THROUGH_REPORTERS(report_query, qdata); + } + + // see these issues on the reasoning for this: + // - https://github.com/onqtam/doctest/issues/143#issuecomment-414418903 + // - https://github.com/onqtam/doctest/issues/126 + auto DOCTEST_FIX_FOR_MACOS_LIBCPP_IOSFWD_STRING_LINK_ERRORS = []() DOCTEST_NOINLINE + { std::cout << std::string(); }; + DOCTEST_FIX_FOR_MACOS_LIBCPP_IOSFWD_STRING_LINK_ERRORS(); + + return cleanup_and_return(); +} + +IReporter::~IReporter() = default; + +int IReporter::get_num_active_contexts() { return detail::g_infoContexts.size(); } +const IContextScope* const* IReporter::get_active_contexts() { + return get_num_active_contexts() ? &detail::g_infoContexts[0] : nullptr; +} + +int IReporter::get_num_stringified_contexts() { return detail::g_cs->stringifiedContexts.size(); } +const String* IReporter::get_stringified_contexts() { + return get_num_stringified_contexts() ? &detail::g_cs->stringifiedContexts[0] : nullptr; +} + +namespace detail { + void registerReporterImpl(const char* name, int priority, reporterCreatorFunc c, bool isReporter) { + if(isReporter) + getReporters().insert(reporterMap::value_type(reporterMap::key_type(priority, name), c)); + else + getListeners().insert(reporterMap::value_type(reporterMap::key_type(priority, name), c)); + } +} // namespace detail + +} // namespace doctest + +#endif // DOCTEST_CONFIG_DISABLE + +#ifdef DOCTEST_CONFIG_IMPLEMENT_WITH_MAIN +DOCTEST_MSVC_SUPPRESS_WARNING_WITH_PUSH(4007) // 'function' : must be 'attribute' - see issue #182 +int main(int argc, char** argv) { return doctest::Context(argc, argv).run(); } +DOCTEST_MSVC_SUPPRESS_WARNING_POP +#endif // DOCTEST_CONFIG_IMPLEMENT_WITH_MAIN + +DOCTEST_CLANG_SUPPRESS_WARNING_POP +DOCTEST_MSVC_SUPPRESS_WARNING_POP +DOCTEST_GCC_SUPPRESS_WARNING_POP + +#endif // DOCTEST_LIBRARY_IMPLEMENTATION +#endif // DOCTEST_CONFIG_IMPLEMENT diff --git a/unittest/test_main.cpp b/unittest/test_main.cpp new file mode 100644 index 0000000..f62715f --- /dev/null +++ b/unittest/test_main.cpp @@ -0,0 +1,2 @@ +#define DOCTEST_CONFIG_IMPLEMENT_WITH_MAIN +#include "doctest.h" \ No newline at end of file diff --git a/unittest/test_read_fasta.cpp b/unittest/test_read_fasta.cpp new file mode 100644 index 0000000..dffc3e3 --- /dev/null +++ b/unittest/test_read_fasta.cpp @@ -0,0 +1,26 @@ +#include "doctest.h" +#include + +#include + +TEST_CASE("No fasta file"){ + CHECK_THROWS_AS(ReadFasta("not-a-file"), std::runtime_error); +} + +//TODO: Test for modifiers reading correctly +TEST_CASE("Read Fasta"){ + FastaInput fasta; + CHECK_NOTHROW(fasta=ReadFasta("../test-data/dna-reference.fasta")); + + CHECK(fasta.sequences.size()==30'000); + CHECK(fasta.modifiers.size()==30'000); + CHECK(fasta.headers.size()==30'000); + CHECK(fasta.maximum_sequence_length==579); + CHECK(fasta.sequence_count()==30'000); + CHECK(fasta.sequences.at(5)=="CGCACAAATCAGAAGCTCCGGGTGGCAAACACAGCTAAATAGTTGTAATTATGGAATATAGAAAAATGTTCGATTGTCGTTATGAGGATTATGAGCGCCTCAAAGCCCCCCCACCGCAAAAAGGCCCTGTGTTCGCCCCTCTCCACCCATCCATCGCATGGCCCAACGAAGCGGATATCGCTCCGGAATCCTCCTACGAAAAACTTCTGTAAAAAGAACAAAACCGGAAATCCACTTGGGAACGCGAAACCCCAGCTTCGCATATTGACCCAGAAGATCAACAGTAGAATTTGTGGCAACGGAACAACGTCCCGGAACTTCTCCTGAACCAAAACAACTTCACTGTTCGATTCCCCGCACCATTACATGATGCAGCGTTCCCGGTGTGTCAAGTCTCGCTCCTCGTGGCATATGGCTCTCTTGTCTTTTGCTTTTCAAAAGCTGCCTGCACAAATCGTTTATTCCTCACTGCAAAATACAATTTTCTACGCTATTGCACTGCGTCCCCTCAGGCTCACTCTCAGGCTCAATAATGACAGAAAATTCAGCGGTAAATGGATGGAATCATACGTATGTGAA"); +} + +TEST_CASE("Read Pair"){ + const auto input_data = ReadFastaQueryTargetPair("../test-data/dna-reference.fasta", "../test-data/dna-query.fasta"); + CHECK(input_data.sequence_count()==30'000); +} \ No newline at end of file diff --git a/unittest/test_timer.cpp b/unittest/test_timer.cpp new file mode 100644 index 0000000..582eedc --- /dev/null +++ b/unittest/test_timer.cpp @@ -0,0 +1,14 @@ +#include "doctest.h" +#include + +#include +#include + +TEST_CASE("Timer Start Stop"){ + Timer timer; + timer.start(); + std::this_thread::sleep_for(std::chrono::milliseconds(200)); + timer.stop(); + + CHECK(std::abs(timer.getSeconds()-0.2)<0.01); +} From 37edf612ff0d91e0efb0ee32318c42be633742f4 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 16:32:22 -0600 Subject: [PATCH 16/47] Clean up and test getMaxLength() --- include/gpu_bsw/driver.hpp | 4 ++-- include/gpu_bsw/utils.hpp | 2 +- src/utils.cpp | 17 ++++++++--------- unittest/test_read_fasta.cpp | 2 ++ 4 files changed, 13 insertions(+), 12 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index c19503e..a5b009f 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -53,8 +53,8 @@ void kernel_driver( const short openGap, const short extendGap ){ - unsigned maxContigSize = getMaxLength(contigs); - unsigned maxReadSize = getMaxLength(reads); + const auto maxContigSize = getMaxLength(contigs); + const auto maxReadSize = getMaxLength(reads); unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length //These scores are used only by the DNA kernel diff --git a/include/gpu_bsw/utils.hpp b/include/gpu_bsw/utils.hpp index c8bc4f8..322e1e5 100644 --- a/include/gpu_bsw/utils.hpp +++ b/include/gpu_bsw/utils.hpp @@ -21,6 +21,6 @@ gpuAssert(cudaError_t code, const char* file, int line, bool abort = true) } } -unsigned getMaxLength (std::vector v); +size_t getMaxLength(const std::vector &v); int get_new_min_length(short* alAend, short* alBend, int blocksLaunched); #endif \ No newline at end of file diff --git a/src/utils.cpp b/src/utils.cpp index ed095ad..6bb44b6 100644 --- a/src/utils.cpp +++ b/src/utils.cpp @@ -1,16 +1,15 @@ +#include #include -unsigned getMaxLength (std::vector v) -{ - unsigned maxLength = 0; - for(auto str : v){ - if(maxLength < str.length()){ - maxLength = str.length(); - } - } - return maxLength; +size_t getMaxLength(const std::vector &v){ + const auto maxi = std::max_element(v.begin(), v.end(), + [](const auto &a, const auto &b) { return a.size()size(); } + + int get_new_min_length(short* alAend, short* alBend, int blocksLaunched){ int newMin = 1000; int maxA = 0; diff --git a/unittest/test_read_fasta.cpp b/unittest/test_read_fasta.cpp index dffc3e3..cc982c6 100644 --- a/unittest/test_read_fasta.cpp +++ b/unittest/test_read_fasta.cpp @@ -1,5 +1,6 @@ #include "doctest.h" #include +#include #include @@ -16,6 +17,7 @@ TEST_CASE("Read Fasta"){ CHECK(fasta.modifiers.size()==30'000); CHECK(fasta.headers.size()==30'000); CHECK(fasta.maximum_sequence_length==579); + CHECK(getMaxLength(fasta.sequences)==579); CHECK(fasta.sequence_count()==30'000); CHECK(fasta.sequences.at(5)=="CGCACAAATCAGAAGCTCCGGGTGGCAAACACAGCTAAATAGTTGTAATTATGGAATATAGAAAAATGTTCGATTGTCGTTATGAGGATTATGAGCGCCTCAAAGCCCCCCCACCGCAAAAAGGCCCTGTGTTCGCCCCTCTCCACCCATCCATCGCATGGCCCAACGAAGCGGATATCGCTCCGGAATCCTCCTACGAAAAACTTCTGTAAAAAGAACAAAACCGGAAATCCACTTGGGAACGCGAAACCCCAGCTTCGCATATTGACCCAGAAGATCAACAGTAGAATTTGTGGCAACGGAACAACGTCCCGGAACTTCTCCTGAACCAAAACAACTTCACTGTTCGATTCCCCGCACCATTACATGATGCAGCGTTCCCGGTGTGTCAAGTCTCGCTCCTCGTGGCATATGGCTCTCTTGTCTTTTGCTTTTCAAAAGCTGCCTGCACAAATCGTTTATTCCTCACTGCAAAATACAATTTTCTACGCTATTGCACTGCGTCCCCTCAGGCTCACTCTCAGGCTCAATAATGACAGAAAATTCAGCGGTAAATGGATGGAATCATACGTATGTGAA"); } From 3f68a9538a3a15eccebbde1ab82720ddfd43b18c Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 17:07:01 -0600 Subject: [PATCH 17/47] Use std::array in main.cpp --- evaluation/main.cpp | 15 ++++++++++----- 1 file changed, 10 insertions(+), 5 deletions(-) diff --git a/evaluation/main.cpp b/evaluation/main.cpp index b35c19a..6930b0b 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -2,13 +2,14 @@ #include #include +#include #include #include #include #include #include -constexpr short blosum62[] = { +constexpr std::array blosum62 = { // A R N D C Q E G H I L K M F P S T W Y V B Z X * 4, -1, -2, -2, 0, -1, -1, 0, -2, -1, -1, -1, -1, -2, -1, 1, 0, -3, -2, 0, -2, -1, 0, -4, // A -1, 5, 0, -2, -3, 1, 0, -2, 0, -3, -2, 2, -1, -3, -2, -1, -1, -3, -2, -3, -1, 0, -1, -4, // R @@ -38,7 +39,7 @@ constexpr short blosum62[] = { -constexpr short blosum50[] = {// 24 x 24 table +constexpr std::array blosum50 = {// 24 x 24 table // A R N D C Q E G H I L K M F P S T W Y V B Z X * 5, -2, -1, -2, -1, -1, -1, 0, -2, -1, -2, -1, -1, -3, -1, 1, 0, -3, -2, 0, -2, -1, -1, -5, // A -2, 7, -1, -2, -4, 1, 0, -3, 0, -4, -3, 3, -2, -3, -3, -1, -1, -3, -1, -3, -1, 0, -1, -5, // R @@ -69,7 +70,11 @@ constexpr short blosum50[] = {// 24 x 24 table int main(int argc, char* argv[]){ - const short match_mismatch_scores[] = {1, -3, -3, -1}; + constexpr std::array match_mismatch_scores = {1, -3}; + + //Prevent compiler warnings + (void)blosum62; + (void)blosum50; if(argc!=5){ std::cerr<<"Syntax: "< "<(input_data.a.sequences, input_data.b.sequences, &results, blosum62, -6, -1); + gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, blosum62.data(), -6, -1); } else if(in_arg == "dna") { - gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, match_mismatch_scores, -3, -1); + gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, match_mismatch_scores.data(), -3, -1); } else { std::cerr<<"Data type must be 'aa' or 'dna'!"< Date: Fri, 10 Jul 2020 17:07:07 -0600 Subject: [PATCH 18/47] Initialize pointers to nullptr --- include/gpu_bsw/alignments.hpp | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/include/gpu_bsw/alignments.hpp b/include/gpu_bsw/alignments.hpp index f0846e4..6da0d2b 100644 --- a/include/gpu_bsw/alignments.hpp +++ b/include/gpu_bsw/alignments.hpp @@ -2,14 +2,14 @@ #define ALIGNMENTS_HPP class gpu_alignments{ - public: - short* ref_start_gpu; - short* ref_end_gpu; - short* query_start_gpu; - short* query_end_gpu; - short* scores_gpu; - unsigned* offset_ref_gpu; - unsigned* offset_query_gpu; + public: + short* ref_start_gpu = nullptr; + short* ref_end_gpu = nullptr; + short* query_start_gpu = nullptr; + short* query_end_gpu = nullptr; + short* scores_gpu = nullptr; + unsigned* offset_ref_gpu = nullptr; + unsigned* offset_query_gpu = nullptr; gpu_alignments(int max_alignments); ~gpu_alignments(); From 2f735b5bf9162a77290d0a5e41f3a027b1423407 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 17:17:41 -0600 Subject: [PATCH 19/47] Clean up some integer types warnings and use std::array for streams --- include/gpu_bsw/driver.hpp | 28 ++++++++++++++-------------- src/driver.cpp | 6 +++--- 2 files changed, 17 insertions(+), 17 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index a5b009f..f49e888 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -20,7 +20,7 @@ #include #include -#define NSTREAMS 2 +constexpr int NSTREAMS = 2; namespace gpu_bsw_driver { @@ -36,9 +36,9 @@ namespace gpu_bsw_driver { void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments); void free_alignments(gpu_bsw_driver::alignment_results *alignments); -void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); -void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); -void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda); +void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda); +void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda); +void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda); @@ -91,15 +91,15 @@ void kernel_driver( #pragma omp parallel { - int my_cpu_id = omp_get_thread_num(); + const int my_cpu_id = omp_get_thread_num(); cudaSetDevice(my_cpu_id); int myGPUid; cudaGetDevice(&myGPUid); Timer timer_cpu; - cudaStream_t streams_cuda[NSTREAMS]; - for(int stm = 0; stm < NSTREAMS; stm++){ - cudaStreamCreate(&streams_cuda[stm]); + std::array streams_cuda; + for(auto &stream: streams_cuda){ + cudaStreamCreate(&stream); } int BLOCKS_l = alignmentsPerDevice; @@ -146,7 +146,7 @@ void kernel_driver( for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) { timer_packing.start(); - int blocksLaunched = 0; + size_t blocksLaunched; std::vector::const_iterator beginAVec; std::vector::const_iterator endAVec; std::vector::const_iterator beginBVec; @@ -171,14 +171,14 @@ void kernel_driver( std::vector sequencesA(beginAVec, endAVec); std::vector sequencesB(beginBVec, endBVec); unsigned running_sum = 0; - int sequences_per_stream = (blocksLaunched) / NSTREAMS; - int sequences_stream_leftover = (blocksLaunched) % NSTREAMS; + const auto sequences_per_stream = (blocksLaunched) / NSTREAMS; + const auto sequences_stream_leftover = (blocksLaunched) % NSTREAMS; unsigned half_length_A = 0; unsigned half_length_B = 0; timer_cpu.start(); - for(int i = 0; i < sequencesA.size(); i++) + for(size_t i = 0; i < sequencesA.size(); i++) { running_sum +=sequencesA[i].size(); offsetA_h[i] = running_sum;//sequencesA[i].size(); @@ -190,7 +190,7 @@ void kernel_driver( unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; running_sum = 0; - for(int i = 0; i < sequencesB.size(); i++) + for(size_t i = 0; i < sequencesB.size(); i++) { running_sum +=sequencesB[i].size(); offsetB_h[i] = running_sum; //sequencesB[i].size(); @@ -206,7 +206,7 @@ void kernel_driver( unsigned offsetSumA = 0; unsigned offsetSumB = 0; - for(int i = 0; i < sequencesA.size(); i++) + for(size_t i = 0; i < sequencesA.size(); i++) { char* seqptrA = strA + offsetSumA; memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); diff --git a/src/driver.cpp b/src/driver.cpp index 2b87904..4d6dd52 100644 --- a/src/driver.cpp +++ b/src/driver.cpp @@ -17,7 +17,7 @@ void free_alignments(gpu_bsw_driver::alignment_results *alignments){ } void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, -unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ +unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu, offsetA_h, (sequences_per_stream) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[0])); @@ -42,7 +42,7 @@ unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequen } -void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ +void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ cudaErrchk(cudaMemcpyAsync(alAend, gpu_data->ref_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); cudaErrchk(cudaMemcpyAsync(alAend + sequences_per_stream, gpu_data->ref_end_gpu + sequences_per_stream, @@ -53,7 +53,7 @@ void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* a cudaMemcpyDeviceToHost, streams_cuda[1])); } -void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, cudaStream_t* streams_cuda){ +void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ cudaErrchk(cudaMemcpyAsync(alAbeg, gpu_data->ref_start_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); cudaErrchk(cudaMemcpyAsync(alAbeg + sequences_per_stream, gpu_data->ref_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), From 0cbe8242d158b6a87d1c979c7a27373fc9f67543 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 17:54:26 -0600 Subject: [PATCH 20/47] Switch to using type-safe and count-safe memory allocations --- include/gpu_bsw/driver.hpp | 58 +++++++++++++++----------------------- include/gpu_bsw/utils.hpp | 25 ++++++++++++++++ src/alignments.cpp | 14 ++++----- src/driver.cpp | 10 +++---- 4 files changed, 60 insertions(+), 47 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index f49e888..343ac6e 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -58,8 +58,8 @@ void kernel_driver( unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length //These scores are used only by the DNA kernel - const short matchScore = scoring_matrix[0]; - const short misMatchScore = scoring_matrix[1]; + const auto matchScore = scoring_matrix[0]; + const auto misMatchScore = scoring_matrix[1]; //This matrix is used only by the RNA kernel constexpr short encoding_matrix[] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0, @@ -114,31 +114,24 @@ void kernel_driver( short *d_encoding_matrix, *d_scoring_matrix; if(DT==DataType::RNA){ - cudaErrchk(cudaMalloc(&d_encoding_matrix, ENCOD_MAT_SIZE * sizeof(short))); - cudaErrchk(cudaMalloc(&d_scoring_matrix, SCORE_MAT_SIZE * sizeof(short))); - cudaErrchk(cudaMemcpy(d_encoding_matrix, encoding_matrix, ENCOD_MAT_SIZE * sizeof(short), cudaMemcpyHostToDevice)); - cudaErrchk(cudaMemcpy(d_scoring_matrix, scoring_matrix, SCORE_MAT_SIZE * sizeof(short), cudaMemcpyHostToDevice)); + d_encoding_matrix = DeviceMalloc(ENCOD_MAT_SIZE, encoding_matrix); + d_scoring_matrix = DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); } - short* alAbeg = alignments->ref_begin + my_cpu_id * alignmentsPerDevice; - short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; - short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; - short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results - short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; + short* alAbeg = alignments->ref_begin + my_cpu_id * alignmentsPerDevice; + short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; + short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; + short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results + short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - unsigned* offsetA_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetA_h, sizeof(int)*(stringsPerIt + leftOvers)); - unsigned* offsetB_h;// = new unsigned[stringsPerIt + leftOvers]; - cudaMallocHost(&offsetB_h, sizeof(int)*(stringsPerIt + leftOvers)); + unsigned *const offsetA_h = PageLockedMalloc(stringsPerIt + leftOvers); + unsigned *const offsetB_h = PageLockedMalloc(stringsPerIt + leftOvers); - char *strA_d, *strB_d; - cudaErrchk(cudaMalloc(&strA_d, maxContigSize * (stringsPerIt + leftOvers) * sizeof(char))); - cudaErrchk(cudaMalloc(&strB_d, maxReadSize *(stringsPerIt + leftOvers)* sizeof(char))); + char *const strA_d = DeviceMalloc(maxContigSize * (stringsPerIt + leftOvers)); + char *const strB_d = DeviceMalloc(maxReadSize * (stringsPerIt + leftOvers)); - char* strA; - cudaMallocHost(&strA, sizeof(char)*maxContigSize * (stringsPerIt + leftOvers)); - char* strB; - cudaMallocHost(&strB, sizeof(char)* maxReadSize *(stringsPerIt + leftOvers)); + char *const strA = PageLockedMalloc(maxContigSize * (stringsPerIt + leftOvers)); + char *const strB = PageLockedMalloc(maxReadSize * (stringsPerIt + leftOvers)); Timer timer_packing; @@ -153,18 +146,18 @@ void kernel_driver( std::vector::const_iterator endBVec; if(perGPUIts == its - 1) { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt) + leftOvers; // so that each openmp thread has a copy of strings it needs to align + beginAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + endAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt + leftOvers; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + endBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt + leftOvers; // so that each openmp thread has a copy of strings it needs to align blocksLaunched = stringsPerIt + leftOvers; } else { - beginAVec = contigs.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endAVec = contigs.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + ((alignmentsPerDevice * my_cpu_id) + perGPUIts * stringsPerIt); - endBVec = reads.begin() + (alignmentsPerDevice * my_cpu_id) + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + beginAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + endAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align + beginBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + endBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align blocksLaunched = stringsPerIt; } @@ -310,11 +303,6 @@ void kernel_driver( <<"Total Execution Time (seconds) = "< +T* PageLockedMalloc(const size_t count){ + T *temp; + cudaErrchk(cudaMallocHost(&temp, count*sizeof(T))); + return temp; +} + +//Allocate `count` items on device memory +template +T* DeviceMalloc(const size_t count){ + T *temp; + cudaErrchk(cudaMalloc(&temp, count*sizeof(T))); + return temp; +} + +//Allocate `count` items on device memory +template +T* DeviceMalloc(const size_t count, const T *const host_data){ + T *temp; + cudaErrchk(cudaMalloc(&temp, count*sizeof(T))); + cudaErrchk(cudaMemcpy(temp, host_data, count*sizeof(T), cudaMemcpyHostToDevice)); + return temp; +} + size_t getMaxLength(const std::vector &v); int get_new_min_length(short* alAend, short* alBend, int blocksLaunched); #endif \ No newline at end of file diff --git a/src/alignments.cpp b/src/alignments.cpp index 1172e2b..0e05ee2 100644 --- a/src/alignments.cpp +++ b/src/alignments.cpp @@ -2,13 +2,13 @@ #include gpu_alignments::gpu_alignments(int max_alignments){ - cudaErrchk(cudaMalloc(&offset_query_gpu, (max_alignments) * sizeof(int))); - cudaErrchk(cudaMalloc(&offset_ref_gpu, (max_alignments) * sizeof(int))); - cudaErrchk(cudaMalloc(&ref_start_gpu, (max_alignments) * sizeof(short))); - cudaErrchk(cudaMalloc(&ref_end_gpu, (max_alignments) * sizeof(short))); - cudaErrchk(cudaMalloc(&query_end_gpu, (max_alignments) * sizeof(short))); - cudaErrchk(cudaMalloc(&query_start_gpu, (max_alignments) * sizeof(short))); - cudaErrchk(cudaMalloc(&scores_gpu, (max_alignments) * sizeof(short))); + offset_query_gpu = DeviceMalloc(max_alignments); + offset_ref_gpu = DeviceMalloc(max_alignments); + ref_start_gpu = DeviceMalloc(max_alignments); + ref_end_gpu = DeviceMalloc(max_alignments); + query_end_gpu = DeviceMalloc(max_alignments); + query_start_gpu = DeviceMalloc(max_alignments); + scores_gpu = DeviceMalloc(max_alignments); } gpu_alignments::~gpu_alignments(){ diff --git a/src/driver.cpp b/src/driver.cpp index 4d6dd52..1eeaa5b 100644 --- a/src/driver.cpp +++ b/src/driver.cpp @@ -1,11 +1,11 @@ #include void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments){ - cudaMallocHost(&(alignments->ref_begin), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->ref_end), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->query_begin), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->query_end), sizeof(short)*max_alignments); - cudaMallocHost(&(alignments->top_scores), sizeof(short)*max_alignments); + alignments->ref_begin = PageLockedMalloc(max_alignments); + alignments->ref_end = PageLockedMalloc(max_alignments); + alignments->query_begin = PageLockedMalloc(max_alignments); + alignments->query_end = PageLockedMalloc(max_alignments); + alignments->top_scores = PageLockedMalloc(max_alignments); } void free_alignments(gpu_bsw_driver::alignment_results *alignments){ From 584ec688e8a2027146bcac946f13525d418b93de Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 10 Jul 2020 18:04:32 -0600 Subject: [PATCH 21/47] Simplify calculation for segments assigned to each GPU --- include/gpu_bsw/driver.hpp | 28 ++++++++++------------------ 1 file changed, 10 insertions(+), 18 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 343ac6e..0b475d2 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -139,26 +139,18 @@ void kernel_driver( for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) { timer_packing.start(); - size_t blocksLaunched; - std::vector::const_iterator beginAVec; - std::vector::const_iterator endAVec; - std::vector::const_iterator beginBVec; - std::vector::const_iterator endBVec; + size_t blocksLaunched = stringsPerIt; + + // so that each openmp thread has a copy of strings it needs to align + auto beginAVec = contigs.cbegin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + auto endAVec = contigs.cbegin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; + auto beginBVec = reads.cbegin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; + auto endBVec = reads.cbegin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; if(perGPUIts == its - 1) { - beginAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - endAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt + leftOvers; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - endBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt + leftOvers; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt + leftOvers; - } - else - { - beginAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - endAVec = contigs.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - beginBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - endBVec = reads.begin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; // so that each openmp thread has a copy of strings it needs to align - blocksLaunched = stringsPerIt; + blocksLaunched += leftOvers; + endAVec += leftOvers; + endBVec += leftOvers; } std::vector sequencesA(beginAVec, endAVec); From 8ae37379c8d9a4c1b5c56966672aaf61ca076db7 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Sat, 11 Jul 2020 09:42:07 -0600 Subject: [PATCH 22/47] Add the PageLockedString class --- CMakeLists.txt | 1 + include/gpu_bsw/driver.hpp | 22 ++++------- include/gpu_bsw/page_locked_string.hpp | 37 ++++++++++++++++++ unittest/test_page_locked_string.cpp | 54 ++++++++++++++++++++++++++ 4 files changed, 100 insertions(+), 14 deletions(-) create mode 100644 include/gpu_bsw/page_locked_string.hpp create mode 100644 unittest/test_page_locked_string.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index bb05917..caa945a 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -19,6 +19,7 @@ set(sources ) set(test_sources + unittest/test_page_locked_string.cpp unittest/test_main.cpp unittest/test_read_fasta.cpp unittest/test_timer.cpp diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 0b475d2..9a6be4f 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -4,6 +4,7 @@ #include #include #include +#include #include #include @@ -130,8 +131,8 @@ void kernel_driver( char *const strA_d = DeviceMalloc(maxContigSize * (stringsPerIt + leftOvers)); char *const strB_d = DeviceMalloc(maxReadSize * (stringsPerIt + leftOvers)); - char *const strA = PageLockedMalloc(maxContigSize * (stringsPerIt + leftOvers)); - char *const strB = PageLockedMalloc(maxReadSize * (stringsPerIt + leftOvers)); + auto strA = PageLockedString(maxContigSize * (stringsPerIt + leftOvers)); + auto strB = PageLockedString(maxReadSize * (stringsPerIt + leftOvers)); Timer timer_packing; @@ -188,22 +189,17 @@ void kernel_driver( timer_cpu.stop(); - unsigned offsetSumA = 0; - unsigned offsetSumB = 0; - + strA.clear(); + strB.clear(); for(size_t i = 0; i < sequencesA.size(); i++) { - char* seqptrA = strA + offsetSumA; - memcpy(seqptrA, sequencesA[i].c_str(), sequencesA[i].size()); - char* seqptrB = strB + offsetSumB; - memcpy(seqptrB, sequencesB[i].c_str(), sequencesB[i].size()); - offsetSumA += sequencesA[i].size(); - offsetSumB += sequencesB[i].size(); + strA += sequencesA.at(i); + strB += sequencesB.at(i); } timer_packing.stop(); - asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA, strA_d, strB, strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); + asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA.data(), strA_d, strB.data(), strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; unsigned totShmem = 3 * (minSize + 1) * sizeof(short); unsigned alignmentPad = 4 + (4 - totShmem % 4); @@ -277,8 +273,6 @@ void kernel_driver( cudaErrchk(cudaFree(strB_d)); cudaFreeHost(offsetA_h); cudaFreeHost(offsetB_h); - cudaFreeHost(strA); - cudaFreeHost(strB); for(int i = 0; i < NSTREAMS; i++) cudaStreamDestroy(streams_cuda[i]); diff --git a/include/gpu_bsw/page_locked_string.hpp b/include/gpu_bsw/page_locked_string.hpp new file mode 100644 index 0000000..66f0a7c --- /dev/null +++ b/include/gpu_bsw/page_locked_string.hpp @@ -0,0 +1,37 @@ +#pragma once + +#include + +#include "utils.hpp" + +class PageLockedString { + public: + PageLockedString(size_t capacity) : _str(PageLockedMalloc(capacity)), _capacity(capacity) {} + + ~PageLockedString(){ + if(_str) + cudaErrchk(cudaFreeHost(_str)); + } + + PageLockedString& operator+=(const std::string &o){ + if(_size+o.size()>_capacity) + throw std::runtime_error("Appending to the PageLockedString would go above its capacity!"); + memcpy(&_str[_size], o.c_str(), o.size()); + _size += o.size(); + return *this; + } + + char* data() const { return _str; } + size_t size() const { return _size; } + size_t size_left()const { return _capacity-_size; } + bool empty() const { return _size==0; } + bool full() const { return _size==_capacity; } + std::string str() const { return std::string(_str, _str+_size); } + size_t capacity() const { return _capacity; } + void clear() { _size=0; } + + private: + char *const _str = nullptr; + const size_t _capacity = 0; + size_t _size = 0; +}; \ No newline at end of file diff --git a/unittest/test_page_locked_string.cpp b/unittest/test_page_locked_string.cpp new file mode 100644 index 0000000..c76e259 --- /dev/null +++ b/unittest/test_page_locked_string.cpp @@ -0,0 +1,54 @@ +#include "doctest.h" +#include + +#include + +TEST_CASE("PageLockedString"){ + PageLockedString pls(20); + CHECK(pls.capacity()==20); + CHECK(pls.empty()); + CHECK(!pls.full()); + CHECK(pls.size()==0); + CHECK(pls.size_left()==20); + CHECK(pls.str()==""); + + pls += "testing"; + CHECK(pls.capacity()==20); + CHECK(!pls.empty()); + CHECK(!pls.full()); + CHECK(pls.size()==7); + CHECK(pls.size_left()==13); + CHECK(pls.str()=="testing"); + + pls += "andagain"; + CHECK(pls.capacity()==20); + CHECK(!pls.empty()); + CHECK(!pls.full()); + CHECK(pls.size()==15); + CHECK(pls.size_left()==5); + CHECK(pls.str()=="testingandagain"); + + CHECK_THROWS_AS(pls += "toolong", std::runtime_error); + CHECK(pls.capacity()==20); + CHECK(!pls.empty()); + CHECK(!pls.full()); + CHECK(pls.size()==15); + CHECK(pls.size_left()==5); + CHECK(pls.str()=="testingandagain"); + + pls += "done."; + CHECK(pls.capacity()==20); + CHECK(!pls.empty()); + CHECK(pls.full()); + CHECK(pls.size()==20); + CHECK(pls.size_left()==0); + CHECK(pls.str()=="testingandagaindone."); + + pls.clear(); + CHECK(pls.capacity()==20); + CHECK(pls.empty()); + CHECK(!pls.full()); + CHECK(pls.size()==0); + CHECK(pls.size_left()==20); + CHECK(pls.str()==""); +} \ No newline at end of file From 0e64e36776785ad9a1efa64069b90414d7e667ca Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 09:21:57 -0600 Subject: [PATCH 23/47] Check that kernels executed and compile for all GPU target types --- CMakeLists.txt | 9 ++++++++- include/gpu_bsw/driver.hpp | 9 ++++++++- 2 files changed, 16 insertions(+), 2 deletions(-) diff --git a/CMakeLists.txt b/CMakeLists.txt index caa945a..e583dc7 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -34,8 +34,15 @@ PROPERTIES add_library(gpu_bsw ${sources}) target_include_directories(gpu_bsw PUBLIC include) target_link_libraries(gpu_bsw PUBLIC OpenMP::OpenMP_CXX) -target_compile_options(gpu_bsw PUBLIC $<$:-gencode arch=compute_70,code=sm_70;-Xcompiler=-Wall,-Wextra>) #target_link_libraries(program_gpu PUBLIC timemory OpenMP::OpenMP_CXX) +target_compile_options(gpu_bsw PUBLIC + $<$:-gencode=arch=compute_50,code=sm_50> + $<$:-gencode=arch=compute_52,code=sm_52> + $<$:-gencode=arch=compute_60,code=sm_60> + $<$:-gencode=arch=compute_61,code=sm_61> + $<$:-gencode=arch=compute_70,code=sm_70> + $<$:-Xcompiler=-Wall,-Wextra> +) get_property(LANGUAGES GLOBAL PROPERTY ENABLED_LANGUAGES) if(CMAKE_CUDA_COMPILER AND "CUDA" IN_LIST LANGUAGES) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 9a6be4f..531c9a2 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -212,20 +212,24 @@ void kernel_driver( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); gpu_bsw::sequence_aa_kernel<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); } else if(DT==DataType::DNA){ gpu_bsw::sequence_dna_kernel<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); + cudaErrchk(cudaGetLastError()); gpu_bsw::sequence_dna_kernel<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); + cudaErrchk(cudaGetLastError()); } // copyin back end index so that we can find new min @@ -242,21 +246,24 @@ void kernel_driver( gpu_bsw::sequence_aa_reverse<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); gpu_bsw::sequence_aa_reverse<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); } else if(DT==DataType::DNA) { gpu_bsw::sequence_dna_reverse<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); + cudaErrchk(cudaGetLastError()); gpu_bsw::sequence_dna_reverse<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); - + cudaErrchk(cudaGetLastError()); } asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); From 7bf6291adf934e138eaee40aec900073d0bd1967 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 10:04:29 -0600 Subject: [PATCH 24/47] Templated reverse kernels --- CMakeLists.txt | 1 - include/gpu_bsw/driver.hpp | 38 +- include/gpu_bsw/kernel.hpp | 884 +++++++++++++++++++++++++++-- src/kernel.cpp | 1074 ------------------------------------ 4 files changed, 846 insertions(+), 1151 deletions(-) delete mode 100644 src/kernel.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index e583dc7..509449d 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -13,7 +13,6 @@ find_package(OpenMP REQUIRED) set(sources src/utils.cpp src/alignments.cpp - src/kernel.cpp src/driver.cpp src/read_fasta.cpp ) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 531c9a2..cf69973 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -111,13 +111,14 @@ void kernel_driver( unsigned stringsPerIt = BLOCKS_l / its; gpu_alignments gpu_data(stringsPerIt + leftOvers); // gpu mallocs - //These matrix pointers are only used by the RNA kernel - short *d_encoding_matrix, *d_scoring_matrix; + short *d_scoring_matrix; + //This matrix is only used by the RNA kernel + short *d_encoding_matrix; if(DT==DataType::RNA){ d_encoding_matrix = DeviceMalloc(ENCOD_MAT_SIZE, encoding_matrix); - d_scoring_matrix = DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); } + d_scoring_matrix = DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); short* alAbeg = alignments->ref_begin + my_cpu_id * alignmentsPerDevice; short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; @@ -242,29 +243,16 @@ void kernel_driver( int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths timer_cpu.stop(); - if(DT==DataType::RNA){ - gpu_bsw::sequence_aa_reverse<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); - - gpu_bsw::sequence_aa_reverse<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); - } else if(DT==DataType::DNA) { - gpu_bsw::sequence_dna_reverse<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); - cudaErrchk(cudaGetLastError()); + gpu_bsw::sequence_reverse
<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); - gpu_bsw::sequence_dna_reverse<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); - cudaErrchk(cudaGetLastError()); - } + gpu_bsw::sequence_reverse
<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 8098959..a229393 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -16,31 +16,447 @@ enum class DataType { }; namespace gpu_bsw{ -__device__ short -warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, unsigned lengthSeqB); -__device__ short -warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, unsigned lengthSeqB); +static __inline__ __device__ short +warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) +{ + constexpr int warpSize = 32; + short myMax = val; + short newInd = 0; + short newInd2 = 0; + short ind = myIndex; + short ind2 = myIndex2; + unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x + // unsigned newmask; + for(int offset = warpSize / 2; offset > 0; offset /= 2) + { + int tempVal = __shfl_down_sync(mask, val, offset); + val = max(val,tempVal); + newInd = __shfl_down_sync(mask, ind, offset); + newInd2 = __shfl_down_sync(mask, ind2, offset); + + // if(threadIdx.x == 0)printf("index1:%d, index2:%d, max:%d\n", newInd, newInd2, val); + if(val != myMax) + { + ind = newInd; + ind2 = newInd2; + myMax = val; + } + else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results + // with SSW to get the smallest alignment with highest score. Theoreticaly + // all the alignmnts with same score are same. + { + if(newInd2 > ind2){ + ind = newInd; + ind2 = newInd2; + + } + } + } + myIndex = ind; + myIndex2 = ind2; + val = myMax; + return val; +} + +static __inline__ __device__ short +warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) +{ + constexpr int warpSize = 32; + short myMax = 0; + short newInd = 0; + short newInd2 = 0; + short ind = myIndex; + short ind2 = myIndex2; + myMax = val; + unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x + // unsigned newmask; + for(int offset = warpSize / 2; offset > 0; offset /= 2) + { + + int tempVal = __shfl_down_sync(mask, val, offset); + val = max(val,tempVal); + newInd = __shfl_down_sync(mask, ind, offset); + newInd2 = __shfl_down_sync(mask, ind2, offset); + if(val != myMax) + { + ind = newInd; + ind2 = newInd2; + myMax = val; + } + else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results + // with SSW to get the smallest alignment with highest score. Theoreticaly + // all the alignmnts with same score are same. + { + if(newInd < ind){ + ind = newInd; + ind2 = newInd2; + } + } + } + myIndex = ind; + myIndex2 = ind2; + val = myMax; + return val; +} -__device__ short -warpReduceMax(short val, unsigned lengthSeqB); -__device__ short -blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB); -__device__ short -blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB); +static __device__ short +blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) +{ + const int laneId = threadIdx.x % 32; + const int warpId = threadIdx.x / 32; + __shared__ short locTots[32]; + __shared__ short locInds[32]; + __shared__ short locInds2[32]; + short myInd = myIndex; + short myInd2 = myIndex2; + myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); -__device__ short -blockShuffleReduce(short val, unsigned lengthSeqB); + __syncthreads(); + if(laneId == 0) + locTots[warpId] = myVal; + if(laneId == 0) + locInds[warpId] = myInd; + if(laneId == 0) + locInds2[warpId] = myInd2; + __syncthreads(); + unsigned check = + ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats + // float check = ((float)blockDim.x / 32); + if(threadIdx.x < check) /////******////// + { + myVal = locTots[threadIdx.x]; + myInd = locInds[threadIdx.x]; + myInd2 = locInds2[threadIdx.x]; + } + else + { + myVal = 0; + myInd = -1; + myInd2 = -1; + } + __syncthreads(); -__device__ __host__ short -findMax(short array[], int length, int* ind); + if(warpId == 0) + { + myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); + myIndex = myInd; + myIndex2 = myInd2; + } + __syncthreads(); + return myVal; +} + +static __device__ short +blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) +{ + const int laneId = threadIdx.x % 32; + const int warpId = threadIdx.x / 32; + __shared__ short locTots[32]; + __shared__ short locInds[32]; + __shared__ short locInds2[32]; + short myInd = myIndex; + short myInd2 = myIndex2; + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + + __syncthreads(); + if(laneId == 0) + locTots[warpId] = myVal; + if(laneId == 0) + locInds[warpId] = myInd; + if(laneId == 0) + locInds2[warpId] = myInd2; + __syncthreads(); + unsigned check = + ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats + // float check = ((float)blockDim.x / 32); + if(threadIdx.x < check) /////******////// + { + myVal = locTots[threadIdx.x]; + myInd = locInds[threadIdx.x]; + myInd2 = locInds2[threadIdx.x]; + } + else + { + myVal = 0; + myInd = -1; + myInd2 = -1; + } + __syncthreads(); + + if(warpId == 0) + { + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + myIndex = myInd; + myIndex2 = myInd2; + } + __syncthreads(); + return myVal; +} -__device__ __host__ short -findMaxFour(short first, short second, short third, short fourth); + +__inline__ __device__ __host__ short +findMaxFour(const short first, const short second, const short third, const short fourth) +{ + short maxScore = 0; + + maxScore = max(first,second); + maxScore = max(maxScore, third); + maxScore = max(maxScore, fourth); + + return maxScore; +} + + + +template __global__ void +sequence_reverse( + char *const seqA_array, + char *const seqB_array, + unsigned *const prefix_lengthA, + unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; + // local pointers + char* seqA; + char* seqB; + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; + char* longer_seq; + + //Only used by DNA sequencing + const short matchScore = scoring_matrix[0]; + const short misMatchScore = scoring_matrix[1]; + + // setting up block local sequences and their lengths. + if(block_Id == 0) + { + seqA = seqA_array; + seqB = seqB_array; + } + else + { + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } + + int newlengthSeqA = seqA_align_end[block_Id]; + int newlengthSeqB = seqB_align_end[block_Id]; + + unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; + unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; + char myColumnChar; + + is_valid = &is_valid_array[0]; //reset is_valid array for second iter + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); + __syncthreads(); // this is required because shmem writes + + + //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before + if(newlengthSeqA < newlengthSeqB) + { + if(thread_Id < newlengthSeqA) + { + myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once + longer_seq = seqB; + } + } + else + { + if(thread_Id < newlengthSeqB) + { + myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; + longer_seq = seqA; + } + } + + __syncthreads(); // this is required because sequence has been re-written in shmem + + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; + + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; + + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; + + //Used only by RNA. Has a length of 1 for DNA because length 0 is not allowed. + __shared__ short sh_aa_encoding[(DT==DataType::RNA)?ENCOD_MAT_SIZE:1];// length = 91 + __shared__ short sh_aa_scoring [(DT==DataType::RNA)?SCORE_MAT_SIZE:1]; + + if(DT==DataType::RNA){ + int max_threads = blockDim.x; + + for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ + sh_aa_scoring[p] = scoring_matrix[p]; + } + for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ + sh_aa_encoding[p] = encoding_matrix[p]; + } + } + + __syncthreads(); // this is required because shmem has been updated + for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) + { + is_valid = is_valid - (diag < minSize || diag >= maxSize); + + _temp_Val = _prev_H; + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; + + _curr_H = 0; + + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; + + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; + + if(laneId == 31) + { + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } + + if(diag>= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } + + __syncthreads(); + + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + + short eVal=0; + short heVal = 0; + + if(diag >= maxSize) + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + } + + if(diag >= maxSize) + { + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } + + if(warpId == 0 && laneId == 0) + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H =0; + + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } + + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + + short diag_score; + if(DT==DataType::DNA){ + diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); + } else { + short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; + short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + + diag_score = final_prev_prev_H + add_score; + } + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } + __syncthreads(); + } + __syncthreads(); + + thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + if(thread_Id == 0) + { + if(newlengthSeqA < newlengthSeqB) + { + seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB + seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA + } + else + { + seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA + seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB + } + } + __syncthreads(); +} + + + +inline __global__ void sequence_dna_kernel( char *const seqA_array, char *const seqB_array, @@ -55,26 +471,202 @@ sequence_dna_kernel( const short misMatchScore, const short startGap, const short extendGap -); +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; -__global__ void -sequence_dna_reverse( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short matchScore, - const short misMatchScore, - const short startGap, - const short extendGap -); + unsigned lengthSeqA; + unsigned lengthSeqB; + // local pointers + char* seqA; + char* seqB; + char* longer_seq; -__global__ void + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; + + // setting up block local sequences and their lengths. + if(block_Id == 0) + { + lengthSeqA = prefix_lengthA[0]; + lengthSeqB = prefix_lengthB[0]; + seqA = seqA_array; + seqB = seqB_array; + } + else + { + lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; + lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } + + // what is the max length and what is the min length + unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; + unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; + + // shared memory space for storing longer of the two strings + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); + + char myColumnChar; + // the shorter of the two strings is stored in thread registers + if(lengthSeqA < lengthSeqB) + { + if(thread_Id < lengthSeqA) + myColumnChar = seqA[thread_Id]; // read only once + longer_seq = seqB; + } + else + { + if(thread_Id < lengthSeqB) + myColumnChar = seqB[thread_Id]; + longer_seq = seqA; + } + + __syncthreads(); // this is required here so that complete sequence has been copied to shared memory + + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; + + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; + + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; + + + __syncthreads(); // to make sure all shmem allocations have been initialized + + for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) + { // iterate for the number of anti-diagonals + + is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + + _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; + _curr_H = 0; + + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; + + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; + + if(laneId == 31) + { // if you are the last thread in your warp then spill your values to shmem + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } + + if(diag >= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } + + __syncthreads(); // this is needed so that all the shmem writes are completed. + + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + short eVal=0, heVal = 0; + + if(diag >= maxSize) // when the previous thread has phased out, get value from shmem + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } + + if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H = 0; + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } + + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + + short diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } + __syncthreads(); // why do I need this? commenting it out breaks it + } + __syncthreads(); + + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + + if(thread_Id == 0) + { + if(lengthSeqA < lengthSeqB) + { + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + else + { + seqA_align_end[block_Id] = thread_max_i; + seqB_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + } +} + + + +inline __global__ void sequence_aa_kernel( char *const seqA_array, char *const seqB_array, @@ -89,24 +681,214 @@ sequence_aa_kernel( const short extendGap, const short *const scoring_matrix, const short *const encoding_matrix -); +){ + int block_Id = blockIdx.x; + int thread_Id = threadIdx.x; + short laneId = threadIdx.x%32; + short warpId = threadIdx.x/32; -__global__ void -sequence_aa_reverse( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short startGap, - const short extendGap, - const short *const scoring_matrix, - const short *const encoding_matrix -); + unsigned lengthSeqA; + unsigned lengthSeqB; + // local pointers + char* seqA; + char* seqB; + char* longer_seq; + + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; + + // setting up block local sequences and their lengths. + if(block_Id == 0) + { + lengthSeqA = prefix_lengthA[0]; + lengthSeqB = prefix_lengthB[0]; + seqA = seqA_array; + seqB = seqB_array; + } + else + { + lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; + lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; + } + + // what is the max length and what is the min length + unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; + unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; + + // shared memory space for storing longer of the two strings + memset(is_valid, 0, minSize); + is_valid += minSize; + memset(is_valid, 1, minSize); + is_valid += minSize; + memset(is_valid, 0, minSize); + + char myColumnChar; + // the shorter of the two strings is stored in thread registers + if(lengthSeqA < lengthSeqB) + { + if(thread_Id < lengthSeqA) + myColumnChar = seqA[thread_Id]; // read only once + longer_seq = seqB; + } + else + { + if(thread_Id < lengthSeqB) + myColumnChar = seqB[thread_Id]; + longer_seq = seqA; + } + + __syncthreads(); // this is required here so that complete sequence has been copied to shared memory + + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + + //initializing registers for storing diagonal values for three recent most diagonals (separate tables for + //H, E and F) + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; + + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; + + __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; + + __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 + __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; + + int max_threads = blockDim.x; + for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ + sh_aa_scoring[p] = scoring_matrix[p]; + } + for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ + sh_aa_encoding[p] = encoding_matrix[p]; + } + + __syncthreads(); // to make sure all shmem allocations have been initialized + + for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) + { // iterate for the number of anti-diagonals + + is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + + _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration + _prev_H = _curr_H; + _curr_H = _prev_prev_H; + _prev_prev_H = _temp_Val; + _curr_H = 0; + + _temp_Val = _prev_E; + _prev_E = _curr_E; + _curr_E = _prev_prev_E; + _prev_prev_E = _temp_Val; + _curr_E = 0; + + _temp_Val = _prev_F; + _prev_F = _curr_F; + _curr_F = _prev_prev_F; + _prev_prev_F = _temp_Val; + _curr_F = 0; + + if(laneId == 31) + { // if you are the last thread in your warp then spill your values to shmem + sh_prev_E[warpId] = _prev_E; + sh_prev_H[warpId] = _prev_H; + sh_prev_prev_H[warpId] = _prev_prev_H; + } + + if(diag >= maxSize) + { // if you are invalid in this iteration, spill your values to shmem + local_spill_prev_E[thread_Id] = _prev_E; + local_spill_prev_H[thread_Id] = _prev_H; + local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + } + + __syncthreads(); // this is needed so that all the shmem writes are completed. + + if(is_valid[thread_Id] && thread_Id < minSize) + { + unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + short fVal = _prev_F + extendGap; + short hfVal = _prev_H + startGap; + short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + short eVal=0, heVal = 0; + + if(diag >= maxSize) // when the previous thread has phased out, get value from shmem + { + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + } + else + { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + } + + if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined + { + eVal = 0; + heVal = 0; + } + _curr_F = (fVal > hfVal) ? fVal : hfVal; + _curr_E = (eVal > heVal) ? eVal : heVal; + + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + short final_prev_prev_H = 0; + if(diag >= maxSize) + { + final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; + } + else + { + final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; + } + + if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + + short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix + short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + + short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + + short diag_score = final_prev_prev_H + add_score; + + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + i++; + } + __syncthreads(); // why do I need this? commenting it out breaks it + } + __syncthreads(); + + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + + if(thread_Id == 0) + { + if(lengthSeqA < lengthSeqB) + { + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + else + { + seqA_align_end[block_Id] = thread_max_i; + seqB_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + } +} } #endif diff --git a/src/kernel.cpp b/src/kernel.cpp deleted file mode 100644 index cfb4480..0000000 --- a/src/kernel.cpp +++ /dev/null @@ -1,1074 +0,0 @@ -#include - -__inline__ __device__ short -gpu_bsw::warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) -{ - constexpr int warpSize = 32; - short myMax = val; - short newInd = 0; - short newInd2 = 0; - short ind = myIndex; - short ind2 = myIndex2; - unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x - // unsigned newmask; - for(int offset = warpSize / 2; offset > 0; offset /= 2) - { - int tempVal = __shfl_down_sync(mask, val, offset); - val = max(val,tempVal); - newInd = __shfl_down_sync(mask, ind, offset); - newInd2 = __shfl_down_sync(mask, ind2, offset); - - // if(threadIdx.x == 0)printf("index1:%d, index2:%d, max:%d\n", newInd, newInd2, val); - if(val != myMax) - { - ind = newInd; - ind2 = newInd2; - myMax = val; - } - else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results - // with SSW to get the smallest alignment with highest score. Theoreticaly - // all the alignmnts with same score are same. - { - if(newInd2 > ind2){ - ind = newInd; - ind2 = newInd2; - - } - } - } - myIndex = ind; - myIndex2 = ind2; - val = myMax; - return val; -} - -__inline__ __device__ short -gpu_bsw::warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) -{ - constexpr int warpSize = 32; - short myMax = 0; - short newInd = 0; - short newInd2 = 0; - short ind = myIndex; - short ind2 = myIndex2; - myMax = val; - unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x - // unsigned newmask; - for(int offset = warpSize / 2; offset > 0; offset /= 2) - { - - int tempVal = __shfl_down_sync(mask, val, offset); - val = max(val,tempVal); - newInd = __shfl_down_sync(mask, ind, offset); - newInd2 = __shfl_down_sync(mask, ind2, offset); - if(val != myMax) - { - ind = newInd; - ind2 = newInd2; - myMax = val; - } - else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results - // with SSW to get the smallest alignment with highest score. Theoreticaly - // all the alignmnts with same score are same. - { - if(newInd < ind){ - ind = newInd; - ind2 = newInd2; - } - } - } - myIndex = ind; - myIndex2 = ind2; - val = myMax; - return val; -} - - - -__device__ short -gpu_bsw::blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) -{ - const int laneId = threadIdx.x % 32; - const int warpId = threadIdx.x / 32; - __shared__ short locTots[32]; - __shared__ short locInds[32]; - __shared__ short locInds2[32]; - short myInd = myIndex; - short myInd2 = myIndex2; - myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); - - __syncthreads(); - if(laneId == 0) - locTots[warpId] = myVal; - if(laneId == 0) - locInds[warpId] = myInd; - if(laneId == 0) - locInds2[warpId] = myInd2; - __syncthreads(); - unsigned check = - ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats - // float check = ((float)blockDim.x / 32); - if(threadIdx.x < check) /////******////// - { - myVal = locTots[threadIdx.x]; - myInd = locInds[threadIdx.x]; - myInd2 = locInds2[threadIdx.x]; - } - else - { - myVal = 0; - myInd = -1; - myInd2 = -1; - } - __syncthreads(); - - if(warpId == 0) - { - myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); - myIndex = myInd; - myIndex2 = myInd2; - } - __syncthreads(); - return myVal; -} - -__device__ short -gpu_bsw::blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) -{ - const int laneId = threadIdx.x % 32; - const int warpId = threadIdx.x / 32; - __shared__ short locTots[32]; - __shared__ short locInds[32]; - __shared__ short locInds2[32]; - short myInd = myIndex; - short myInd2 = myIndex2; - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); - - __syncthreads(); - if(laneId == 0) - locTots[warpId] = myVal; - if(laneId == 0) - locInds[warpId] = myInd; - if(laneId == 0) - locInds2[warpId] = myInd2; - __syncthreads(); - unsigned check = - ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats - // float check = ((float)blockDim.x / 32); - if(threadIdx.x < check) /////******////// - { - myVal = locTots[threadIdx.x]; - myInd = locInds[threadIdx.x]; - myInd2 = locInds2[threadIdx.x]; - } - else - { - myVal = 0; - myInd = -1; - myInd2 = -1; - } - __syncthreads(); - - if(warpId == 0) - { - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); - myIndex = myInd; - myIndex2 = myInd2; - } - __syncthreads(); - return myVal; -} - - - -__device__ __host__ short -gpu_bsw::findMaxFour(const short first, const short second, const short third, const short fourth) -{ - short maxScore = 0; - - maxScore = max(first,second); - maxScore = max(maxScore, third); - maxScore = max(maxScore, fourth); - - return maxScore; -} - -__global__ void -gpu_bsw::sequence_dna_kernel( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short matchScore, - const short misMatchScore, - const short startGap, - const short extendGap -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - - unsigned lengthSeqA; - unsigned lengthSeqB; - // local pointers - char* seqA; - char* seqB; - char* longer_seq; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - // what is the max length and what is the min length - unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; - - // shared memory space for storing longer of the two strings - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - - char myColumnChar; - // the shorter of the two strings is stored in thread registers - if(lengthSeqA < lengthSeqB) - { - if(thread_Id < lengthSeqA) - myColumnChar = seqA[thread_Id]; // read only once - longer_seq = seqB; - } - else - { - if(thread_Id < lengthSeqB) - myColumnChar = seqB[thread_Id]; - longer_seq = seqA; - } - - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - - __syncthreads(); // to make sure all shmem allocations have been initialized - - for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) - { // iterate for the number of anti-diagonals - - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); // this is needed so that all the shmem writes are completed. - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0, heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); // why do I need this? commenting it out breaks it - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - - if(thread_Id == 0) - { - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - } -} - - - -__global__ void -gpu_bsw::sequence_dna_reverse( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short matchScore, - const short misMatchScore, - const short startGap, - const short extendGap -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - // local pointers - char* seqA; - char* seqB; - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - char* longer_seq; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - seqA = seqA_array; - seqB = seqB_array; - } - else - { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - int newlengthSeqA = seqA_align_end[block_Id]; - int newlengthSeqB = seqB_align_end[block_Id]; - - unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; - unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; - char myColumnChar; - - is_valid = &is_valid_array[0]; //reset is_valid array for second iter - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes - - - //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before - if(newlengthSeqA < newlengthSeqB) - { - if(thread_Id < newlengthSeqA) - { - myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once - longer_seq = seqB; - } - } - else - { - if(thread_Id < newlengthSeqB) - { - myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; - longer_seq = seqA; - } - } - - __syncthreads(); // this is required because sequence has been re-written in shmem - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - __syncthreads(); // this is required because shmem has been updated - for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) - { - is_valid = is_valid - (diag < minSize || diag >= maxSize); - - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag>= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - - short eVal=0; - short heVal = 0; - - if(diag >= maxSize) - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - } - - if(diag >= maxSize) - { - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H =0; - - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - if(thread_Id == 0) - { - if(newlengthSeqA < newlengthSeqB) - { - seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB - seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA - } - else - { - seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA - seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB - } - } - __syncthreads(); -} - - - -__global__ void -gpu_bsw::sequence_aa_kernel( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short startGap, - const short extendGap, - const short *const scoring_matrix, - const short *const encoding_matrix -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - - unsigned lengthSeqA; - unsigned lengthSeqB; - // local pointers - char* seqA; - char* seqB; - char* longer_seq; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - // what is the max length and what is the min length - unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; - - // shared memory space for storing longer of the two strings - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - - char myColumnChar; - // the shorter of the two strings is stored in thread registers - if(lengthSeqA < lengthSeqB) - { - if(thread_Id < lengthSeqA) - myColumnChar = seqA[thread_Id]; // read only once - longer_seq = seqB; - } - else - { - if(thread_Id < lengthSeqB) - myColumnChar = seqB[thread_Id]; - longer_seq = seqA; - } - - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 - __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; - - int max_threads = blockDim.x; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ - sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; - } - - __syncthreads(); // to make sure all shmem allocations have been initialized - - for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) - { // iterate for the number of anti-diagonals - - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); // this is needed so that all the shmem writes are completed. - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0, heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - - short diag_score = final_prev_prev_H + add_score; - - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); // why do I need this? commenting it out breaks it - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - - if(thread_Id == 0) - { - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - } -} - - - -__global__ void -gpu_bsw::sequence_aa_reverse( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short startGap, - const short extendGap, - const short *const scoring_matrix, - const short *const encoding_matrix -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - // local pointers - char* seqA; - char* seqB; - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - char* longer_seq; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - seqA = seqA_array; - seqB = seqB_array; - } - else - { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - int newlengthSeqA = seqA_align_end[block_Id]; - int newlengthSeqB = seqB_align_end[block_Id]; - - unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; - unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; - char myColumnChar; - - is_valid = &is_valid_array[0]; //reset is_valid array for second iter - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes - - - //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before - if(newlengthSeqA < newlengthSeqB) - { - if(thread_Id < newlengthSeqA) - { - myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once - longer_seq = seqB; - } - } - else - { - if(thread_Id < newlengthSeqB) - { - myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; - longer_seq = seqA; - } - } - - __syncthreads(); // this is required because sequence has been re-written in shmem - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 - __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; - - int max_threads = blockDim.x; - - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ - sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; - } - - __syncthreads(); // this is required because shmem has been updated - for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) - { - is_valid = is_valid - (diag < minSize || diag >= maxSize); - - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag>= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - - short eVal=0; - short heVal = 0; - - if(diag >= maxSize) - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - } - - if(diag >= maxSize) - { - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H =0; - - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - - short diag_score = final_prev_prev_H + add_score; - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - if(thread_Id == 0) - { - if(newlengthSeqA < newlengthSeqB) - { - seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB - seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA - } - else - { - seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA - seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB - } - } - __syncthreads(); -} \ No newline at end of file From 7783396b5857b85b21602819dee87e1dd93b45e6 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 12:26:39 -0600 Subject: [PATCH 25/47] Merge warpReduceMax_with_index and warpReduceMax_with_index_reverse --- include/gpu_bsw/kernel.hpp | 66 ++++++++------------------------------ 1 file changed, 14 insertions(+), 52 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index a229393..fe3849e 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -17,63 +17,25 @@ enum class DataType { namespace gpu_bsw{ -static __inline__ __device__ short -warpReduceMax_with_index_reverse(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) -{ - constexpr int warpSize = 32; - short myMax = val; - short newInd = 0; - short newInd2 = 0; - short ind = myIndex; - short ind2 = myIndex2; - unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x - // unsigned newmask; - for(int offset = warpSize / 2; offset > 0; offset /= 2) - { - int tempVal = __shfl_down_sync(mask, val, offset); - val = max(val,tempVal); - newInd = __shfl_down_sync(mask, ind, offset); - newInd2 = __shfl_down_sync(mask, ind2, offset); - - // if(threadIdx.x == 0)printf("index1:%d, index2:%d, max:%d\n", newInd, newInd2, val); - if(val != myMax) - { - ind = newInd; - ind2 = newInd2; - myMax = val; - } - else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results - // with SSW to get the smallest alignment with highest score. Theoreticaly - // all the alignmnts with same score are same. - { - if(newInd2 > ind2){ - ind = newInd; - ind2 = newInd2; - - } - } - } - myIndex = ind; - myIndex2 = ind2; - val = myMax; - return val; -} +enum class ReduceDirection { + FORWARD, + REVERSE +}; +template static __inline__ __device__ short warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) { constexpr int warpSize = 32; - short myMax = 0; + short myMax = val; short newInd = 0; short newInd2 = 0; short ind = myIndex; short ind2 = myIndex2; - myMax = val; unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x // unsigned newmask; for(int offset = warpSize / 2; offset > 0; offset /= 2) { - int tempVal = __shfl_down_sync(mask, val, offset); val = max(val,tempVal); newInd = __shfl_down_sync(mask, ind, offset); @@ -88,10 +50,10 @@ warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsig // with SSW to get the smallest alignment with highest score. Theoreticaly // all the alignmnts with same score are same. { - if(newInd < ind){ - ind = newInd; - ind2 = newInd2; - } + if((DIR==ReduceDirection::REVERSE && newInd2 > ind2) || (DIR==ReduceDirection::FORWARD && newInd < ind)){ + ind = newInd; + ind2 = newInd2; + } } } myIndex = ind; @@ -112,7 +74,7 @@ blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myInde __shared__ short locInds2[32]; short myInd = myIndex; short myInd2 = myIndex2; - myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); if(laneId == 0) @@ -141,7 +103,7 @@ blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myInde if(warpId == 0) { - myVal = warpReduceMax_with_index_reverse(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); myIndex = myInd; myIndex2 = myInd2; } @@ -159,7 +121,7 @@ blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsi __shared__ short locInds2[32]; short myInd = myIndex; short myInd2 = myIndex2; - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); if(laneId == 0) @@ -188,7 +150,7 @@ blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsi if(warpId == 0) { - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); myIndex = myInd; myIndex2 = myInd2; } From 36be82d90c5dd0424f78129d606c4027286e8545 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 12:30:44 -0600 Subject: [PATCH 26/47] Merge blockShuffleReduce_with_index_reverse and blockShuffleReduce_with_index --- include/gpu_bsw/kernel.hpp | 58 ++++---------------------------------- 1 file changed, 6 insertions(+), 52 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index fe3849e..75d035b 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -64,53 +64,7 @@ warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsig -static __device__ short -blockShuffleReduce_with_index_reverse(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) -{ - const int laneId = threadIdx.x % 32; - const int warpId = threadIdx.x / 32; - __shared__ short locTots[32]; - __shared__ short locInds[32]; - __shared__ short locInds2[32]; - short myInd = myIndex; - short myInd2 = myIndex2; - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); - - __syncthreads(); - if(laneId == 0) - locTots[warpId] = myVal; - if(laneId == 0) - locInds[warpId] = myInd; - if(laneId == 0) - locInds2[warpId] = myInd2; - __syncthreads(); - unsigned check = - ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats - // float check = ((float)blockDim.x / 32); - if(threadIdx.x < check) /////******////// - { - myVal = locTots[threadIdx.x]; - myInd = locInds[threadIdx.x]; - myInd2 = locInds2[threadIdx.x]; - } - else - { - myVal = 0; - myInd = -1; - myInd2 = -1; - } - __syncthreads(); - - if(warpId == 0) - { - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); - myIndex = myInd; - myIndex2 = myInd2; - } - __syncthreads(); - return myVal; -} - +template static __device__ short blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) { @@ -121,7 +75,7 @@ blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsi __shared__ short locInds2[32]; short myInd = myIndex; short myInd2 = myIndex2; - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); if(laneId == 0) @@ -150,7 +104,7 @@ blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsi if(warpId == 0) { - myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); + myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); myIndex = myInd; myIndex2 = myInd2; } @@ -399,7 +353,7 @@ sequence_reverse( } __syncthreads(); - thread_max = blockShuffleReduce_with_index_reverse(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values if(thread_Id == 0) { if(newlengthSeqA < newlengthSeqB) @@ -607,7 +561,7 @@ sequence_dna_kernel( } __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values if(thread_Id == 0) { @@ -833,7 +787,7 @@ sequence_aa_kernel( } __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values if(thread_Id == 0) { From fdf2b78e22197efb8236187733866c2119b67580 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 12:51:39 -0600 Subject: [PATCH 27/47] Merge sequence_dna_kernel and sequence_aa_kernel --- include/gpu_bsw/driver.hpp | 41 ++---- include/gpu_bsw/kernel.hpp | 254 ++++--------------------------------- 2 files changed, 40 insertions(+), 255 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index cf69973..f170123 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -58,10 +58,6 @@ void kernel_driver( const auto maxReadSize = getMaxLength(reads); unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length - //These scores are used only by the DNA kernel - const auto matchScore = scoring_matrix[0]; - const auto misMatchScore = scoring_matrix[1]; - //This matrix is used only by the RNA kernel constexpr short encoding_matrix[] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0, 0,0,0,0,0,0,0,0,0,0,0,0,0,0, @@ -205,33 +201,20 @@ void kernel_driver( unsigned totShmem = 3 * (minSize + 1) * sizeof(short); unsigned alignmentPad = 4 + (4 - totShmem % 4); size_t ShmemBytes = totShmem + alignmentPad; - if(ShmemBytes > 48000) - cudaFuncSetAttribute(gpu_bsw::sequence_dna_kernel, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - if(DT==DataType::RNA){ - gpu_bsw::sequence_aa_kernel<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, - openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); + if(ShmemBytes > 48000 && DT==DataType::DNA) + cudaFuncSetAttribute(gpu_bsw::sequence_kernel
, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - gpu_bsw::sequence_aa_kernel<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); - } else if(DT==DataType::DNA){ - gpu_bsw::sequence_dna_kernel<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, matchScore, misMatchScore, openGap, extendGap); - cudaErrchk(cudaGetLastError()); + gpu_bsw::sequence_kernel
<<>>( + strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, + gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, + openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); - gpu_bsw::sequence_dna_kernel<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, matchScore, misMatchScore, openGap, extendGap); - cudaErrchk(cudaGetLastError()); - } + gpu_bsw::sequence_kernel
<<>>( + strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, + gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, + gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); + cudaErrchk(cudaGetLastError()); // copyin back end index so that we can find new min asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 75d035b..15b5f54 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -372,218 +372,9 @@ sequence_reverse( +template inline __global__ void -sequence_dna_kernel( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short matchScore, - const short misMatchScore, - const short startGap, - const short extendGap -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - - unsigned lengthSeqA; - unsigned lengthSeqB; - // local pointers - char* seqA; - char* seqB; - char* longer_seq; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - - // what is the max length and what is the min length - unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; - - // shared memory space for storing longer of the two strings - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - - char myColumnChar; - // the shorter of the two strings is stored in thread registers - if(lengthSeqA < lengthSeqB) - { - if(thread_Id < lengthSeqA) - myColumnChar = seqA[thread_Id]; // read only once - longer_seq = seqB; - } - else - { - if(thread_Id < lengthSeqB) - myColumnChar = seqB[thread_Id]; - longer_seq = seqA; - } - - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - - __syncthreads(); // to make sure all shmem allocations have been initialized - - for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) - { // iterate for the number of anti-diagonals - - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); // this is needed so that all the shmem writes are completed. - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0, heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); // why do I need this? commenting it out breaks it - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - - if(thread_Id == 0) - { - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - } -} - - - -inline __global__ void -sequence_aa_kernel( +sequence_kernel( char *const seqA_array, char *const seqB_array, unsigned *const prefix_lengthA, @@ -593,8 +384,8 @@ sequence_aa_kernel( short *const seqB_align_begin, short *const seqB_align_end, short *const top_scores, - const short startGap, - const short extendGap, + const short startGap, + const short extendGap, const short *const scoring_matrix, const short *const encoding_matrix ){ @@ -603,6 +394,10 @@ sequence_aa_kernel( short laneId = threadIdx.x%32; short warpId = threadIdx.x/32; + //Only used by DNA sequencing + const short matchScore = scoring_matrix[0]; + const short misMatchScore = scoring_matrix[1]; + unsigned lengthSeqA; unsigned lengthSeqB; // local pointers @@ -677,15 +472,18 @@ sequence_aa_kernel( __shared__ short local_spill_prev_H[1024]; __shared__ short local_spill_prev_prev_H[1024]; - __shared__ short sh_aa_encoding[ENCOD_MAT_SIZE];// length = 91 - __shared__ short sh_aa_scoring[SCORE_MAT_SIZE]; + //Used only by RNA. Has a length of 1 for DNA because length 0 is not allowed. + __shared__ short sh_aa_encoding[(DT==DataType::RNA)?ENCOD_MAT_SIZE:1];// length = 91 + __shared__ short sh_aa_scoring [(DT==DataType::RNA)?SCORE_MAT_SIZE:1]; - int max_threads = blockDim.x; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ - sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; + if(DT==DataType::RNA){ + int max_threads = blockDim.x; + for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ + sh_aa_scoring[p] = scoring_matrix[p]; + } + for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ + sh_aa_encoding[p] = encoding_matrix[p]; + } } __syncthreads(); // to make sure all shmem allocations have been initialized @@ -770,13 +568,17 @@ sequence_aa_kernel( if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + short diag_score; + if(DT==DataType::DNA){ + diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); + } else { + short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix + short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short diag_score = final_prev_prev_H + add_score; + short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + diag_score = final_prev_prev_H + add_score; + } _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; From 8aa14b0c8116d26d304a289a7dbf2f082195af51 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 13:05:40 -0600 Subject: [PATCH 28/47] Make sequence_kernel and sequence_kernel_reverse more analogous --- include/gpu_bsw/kernel.hpp | 67 ++++++++++++++++++++------------------ 1 file changed, 35 insertions(+), 32 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 15b5f54..38adc13 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -149,16 +149,18 @@ sequence_reverse( int thread_Id = threadIdx.x; short laneId = threadIdx.x%32; short warpId = threadIdx.x/32; + + //Only used by DNA sequencing + const short matchScore = scoring_matrix[0]; + const short misMatchScore = scoring_matrix[1]; + // local pointers char* seqA; char* seqB; - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; char* longer_seq; - //Only used by DNA sequencing - const short matchScore = scoring_matrix[0]; - const short misMatchScore = scoring_matrix[1]; + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; // setting up block local sequences and their lengths. if(block_Id == 0) @@ -180,6 +182,8 @@ sequence_reverse( char myColumnChar; is_valid = &is_valid_array[0]; //reset is_valid array for second iter + +// shared memory space for storing longer of the two strings memset(is_valid, 0, minSize); is_valid += minSize; memset(is_valid, 1, minSize); @@ -206,7 +210,7 @@ sequence_reverse( } } - __syncthreads(); // this is required because sequence has been re-written in shmem + __syncthreads(); // this is required here so that complete sequence has been copied to shared memory int i = 1; short thread_max = 0; // to maintain the thread max score @@ -234,7 +238,6 @@ sequence_reverse( if(DT==DataType::RNA){ int max_threads = blockDim.x; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ sh_aa_scoring[p] = scoring_matrix[p]; } @@ -243,16 +246,19 @@ sequence_reverse( } } - __syncthreads(); // this is required because shmem has been updated + __syncthreads(); // to make sure all shmem allocations have been initialized + + // iterate for the number of anti-diagonals for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) { - is_valid = is_valid - (diag < minSize || diag >= maxSize); + is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + + // value exchange happens here to setup registers for next iteration _temp_Val = _prev_H; _prev_H = _curr_H; _curr_H = _prev_prev_H; _prev_prev_H = _temp_Val; - _curr_H = 0; _temp_Val = _prev_E; @@ -268,20 +274,20 @@ sequence_reverse( _curr_F = 0; if(laneId == 31) - { + { // if you are the last thread in your warp then spill your values to shmem sh_prev_E[warpId] = _prev_E; sh_prev_H[warpId] = _prev_H; sh_prev_prev_H[warpId] = _prev_prev_H; } - if(diag>= maxSize) + if(diag >= maxSize) { // if you are invalid in this iteration, spill your values to shmem local_spill_prev_E[thread_Id] = _prev_E; local_spill_prev_H[thread_Id] = _prev_H; local_spill_prev_prev_H[thread_Id] = _prev_prev_H; } - __syncthreads(); + __syncthreads(); // this is needed so that all the shmem writes are completed. if(is_valid[thread_Id] && thread_Id < minSize) { @@ -290,37 +296,30 @@ sequence_reverse( short hfVal = _prev_H + startGap; short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0; short heVal = 0; - if(diag >= maxSize) + if(diag >= maxSize) // when the previous thread has phased out, get value from shmem { eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - } - - if(diag >= maxSize) - { heVal = local_spill_prev_H[thread_Id - 1]+ startGap; } else { + eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; } - if(warpId == 0 && laneId == 0) + if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined { eVal = 0; heVal = 0; } _curr_F = (fVal > hfVal) ? fVal : hfVal; _curr_E = (eVal > heVal) ? eVal : heVal; + short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H =0; + short final_prev_prev_H = 0; if(diag >= maxSize) { @@ -337,7 +336,7 @@ sequence_reverse( if(DT==DataType::DNA){ diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); } else { - short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; + short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; //encoding_matrix short mat_index_r = sh_aa_encoding[(int)myColumnChar]; short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical @@ -349,11 +348,12 @@ sequence_reverse( thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; i++; } - __syncthreads(); + __syncthreads(); // why do I need this? commenting it out breaks it } __syncthreads(); thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + if(thread_Id == 0) { if(newlengthSeqA < newlengthSeqB) @@ -488,12 +488,14 @@ sequence_kernel( __syncthreads(); // to make sure all shmem allocations have been initialized + // iterate for the number of anti-diagonals for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) - { // iterate for the number of anti-diagonals + { is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - _temp_Val = _prev_H; // value exchange happens here to setup registers for next iteration + // value exchange happens here to setup registers for next iteration + _temp_Val = _prev_H; _prev_H = _curr_H; _curr_H = _prev_prev_H; _prev_prev_H = _temp_Val; @@ -534,7 +536,8 @@ sequence_kernel( short hfVal = _prev_H + startGap; short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0, heVal = 0; + short eVal=0; + short heVal = 0; if(diag >= maxSize) // when the previous thread has phased out, get value from shmem { @@ -557,6 +560,7 @@ sequence_kernel( short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); short final_prev_prev_H = 0; + if(diag >= maxSize) { final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; @@ -572,9 +576,8 @@ sequence_kernel( if(DT==DataType::DNA){ diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); } else { - short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]];//encoding_matrix + short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]]; //encoding_matrix short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical diag_score = final_prev_prev_H + add_score; From 187af225ef9a26428358a15be63244eb2d502d84 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 14:33:07 -0600 Subject: [PATCH 29/47] Merge sequence_forward and sequence_reverse --- include/gpu_bsw/driver.hpp | 10 +- include/gpu_bsw/kernel.hpp | 339 ++++++++----------------------------- 2 files changed, 74 insertions(+), 275 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index f170123..df9bcc3 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -202,15 +202,15 @@ void kernel_driver( unsigned alignmentPad = 4 + (4 - totShmem % 4); size_t ShmemBytes = totShmem + alignmentPad; if(ShmemBytes > 48000 && DT==DataType::DNA) - cudaFuncSetAttribute(gpu_bsw::sequence_kernel
, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - gpu_bsw::sequence_kernel
<<>>( + gpu_bsw::sequence_process<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); cudaErrchk(cudaGetLastError()); - gpu_bsw::sequence_kernel
<<>>( + gpu_bsw::sequence_process<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); @@ -226,12 +226,12 @@ void kernel_driver( int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths timer_cpu.stop(); - gpu_bsw::sequence_reverse
<<>>( + gpu_bsw::sequence_process<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); cudaErrchk(cudaGetLastError()); - gpu_bsw::sequence_reverse
<<>>( + gpu_bsw::sequence_process<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 38adc13..bb11058 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -15,14 +15,14 @@ enum class DataType { RNA }; -namespace gpu_bsw{ - -enum class ReduceDirection { +enum class Direction { FORWARD, REVERSE }; -template +namespace gpu_bsw{ + +template static __inline__ __device__ short warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) { @@ -50,7 +50,7 @@ warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsig // with SSW to get the smallest alignment with highest score. Theoreticaly // all the alignmnts with same score are same. { - if((DIR==ReduceDirection::REVERSE && newInd2 > ind2) || (DIR==ReduceDirection::FORWARD && newInd < ind)){ + if((DIR==Direction::REVERSE && newInd2 > ind2) || (DIR==Direction::FORWARD && newInd < ind)){ ind = newInd; ind2 = newInd2; } @@ -64,7 +64,7 @@ warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsig -template +template static __device__ short blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) { @@ -128,9 +128,9 @@ findMaxFour(const short first, const short second, const short third, const shor -template -__global__ void -sequence_reverse( +template +inline __global__ void +sequence_process( char *const seqA_array, char *const seqB_array, unsigned *const prefix_lengthA, @@ -154,6 +154,9 @@ sequence_reverse( const short matchScore = scoring_matrix[0]; const short misMatchScore = scoring_matrix[1]; + unsigned lengthSeqA; + unsigned lengthSeqB; + // local pointers char* seqA; char* seqB; @@ -174,256 +177,23 @@ sequence_reverse( seqB = seqB_array + prefix_lengthB[block_Id - 1]; } - int newlengthSeqA = seqA_align_end[block_Id]; - int newlengthSeqB = seqB_align_end[block_Id]; - - unsigned maxSize = newlengthSeqA > newlengthSeqB ? newlengthSeqA : newlengthSeqB; - unsigned minSize = newlengthSeqA < newlengthSeqB ? newlengthSeqA : newlengthSeqB; - char myColumnChar; - - is_valid = &is_valid_array[0]; //reset is_valid array for second iter - -// shared memory space for storing longer of the two strings - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes - - - //check if the new length of A is larger than B, if so then place the B string in registers and A in myLocString, make sure we dont do redundant copy by checking which string is located in myLocString before - if(newlengthSeqA < newlengthSeqB) - { - if(thread_Id < newlengthSeqA) + if(DIR==Direction::FORWARD){ + if(block_Id == 0) { - myColumnChar = seqA[(newlengthSeqA - 1) - thread_Id]; // read only once - longer_seq = seqB; - } - } - else - { - if(thread_Id < newlengthSeqB) - { - myColumnChar = seqB[(newlengthSeqB - 1) - thread_Id]; - longer_seq = seqA; - } - } - - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; - - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; - - __shared__ short local_spill_prev_E[1024];// each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; - - //Used only by RNA. Has a length of 1 for DNA because length 0 is not allowed. - __shared__ short sh_aa_encoding[(DT==DataType::RNA)?ENCOD_MAT_SIZE:1];// length = 91 - __shared__ short sh_aa_scoring [(DT==DataType::RNA)?SCORE_MAT_SIZE:1]; - - if(DT==DataType::RNA){ - int max_threads = blockDim.x; - for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ - sh_aa_scoring[p] = scoring_matrix[p]; - } - for(int p = thread_Id; p < ENCOD_MAT_SIZE; p+=max_threads){ - sh_aa_encoding[p] = encoding_matrix[p]; - } - } - - __syncthreads(); // to make sure all shmem allocations have been initialized - - // iterate for the number of anti-diagonals - for(int diag = 0; diag < newlengthSeqA + newlengthSeqB - 1; diag++) - { - - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true - - // value exchange happens here to setup registers for next iteration - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; - - if(laneId == 31) - { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; - } - - if(diag >= maxSize) - { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; - } - - __syncthreads(); // this is needed so that all the shmem writes are completed. - - if(is_valid[thread_Id] && thread_Id < minSize) - { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0; - short heVal = 0; - - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem - { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; - } - else - { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; - } - - if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined - { - eVal = 0; - heVal = 0; - } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; - - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); - short final_prev_prev_H = 0; - - if(diag >= maxSize) - { - final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; - } - else - { - final_prev_prev_H =(warpId !=0 && laneId == 0)?sh_prev_prev_H[warpId-1]:testShufll; - } - - if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - - short diag_score; - if(DT==DataType::DNA){ - diag_score = final_prev_prev_H + ((longer_seq[(maxSize - i )] == myColumnChar)? matchScore : misMatchScore); - } else { - short mat_index_q = sh_aa_encoding[(int)longer_seq[maxSize-i]]; //encoding_matrix - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical - - diag_score = final_prev_prev_H + add_score; - } - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; - i++; - } - __syncthreads(); // why do I need this? commenting it out breaks it - } - __syncthreads(); - - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values - - if(thread_Id == 0) - { - if(newlengthSeqA < newlengthSeqB) - { - seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB - seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA + lengthSeqA = prefix_lengthA[0]; + lengthSeqB = prefix_lengthB[0]; } else { - seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA - seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB + lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; + lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; } + } else { + lengthSeqA = seqA_align_end[block_Id]; + lengthSeqB = seqB_align_end[block_Id]; } - __syncthreads(); -} - -template -inline __global__ void -sequence_kernel( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short startGap, - const short extendGap, - const short *const scoring_matrix, - const short *const encoding_matrix -){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; - - //Only used by DNA sequencing - const short matchScore = scoring_matrix[0]; - const short misMatchScore = scoring_matrix[1]; - - unsigned lengthSeqA; - unsigned lengthSeqB; - // local pointers - char* seqA; - char* seqB; - char* longer_seq; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - seqA = seqA_array; - seqB = seqB_array; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - // what is the max length and what is the min length unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; @@ -434,19 +204,26 @@ sequence_kernel( memset(is_valid, 1, minSize); is_valid += minSize; memset(is_valid, 0, minSize); + __syncthreads(); // this is required because shmem writes //TODO: May be unnecessary because shared memory isn't used for a while below and there's another synchronization point before it is. + // When moving forward, the shorter of the two strings is stored in thread registers. + + // When moving in reverse, check if the new length of A is larger than B, if so then + // place the B string in registers and A in myLocString, make sure we dont do redundant + // copy by checking which string is located in myLocString before char myColumnChar; - // the shorter of the two strings is stored in thread registers if(lengthSeqA < lengthSeqB) { + const auto pos = (DIR==Direction::FORWARD) ? thread_Id : (lengthSeqA - 1) - thread_Id; if(thread_Id < lengthSeqA) - myColumnChar = seqA[thread_Id]; // read only once + myColumnChar = seqA[pos]; // read only once longer_seq = seqB; } else { + const auto pos = (DIR==Direction::FORWARD) ? thread_Id : (lengthSeqB - 1) - thread_Id; if(thread_Id < lengthSeqB) - myColumnChar = seqB[thread_Id]; + myColumnChar = seqB[pos]; longer_seq = seqA; } @@ -572,19 +349,27 @@ sequence_kernel( if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; + const int diag_pos = (DIR==Direction::FORWARD) ? i-1 : maxSize-i; + short diag_score; if(DT==DataType::DNA){ - diag_score = final_prev_prev_H + ((longer_seq[i - 1] == myColumnChar) ? matchScore : misMatchScore); + diag_score = final_prev_prev_H + ((longer_seq[diag_pos] == myColumnChar) ? matchScore : misMatchScore); } else { - short mat_index_q = sh_aa_encoding[(int)longer_seq[i-1]]; //encoding_matrix + short mat_index_q = sh_aa_encoding[(int)longer_seq[diag_pos]]; //encoding_matrix short mat_index_r = sh_aa_encoding[(int)myColumnChar]; short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical diag_score = final_prev_prev_H + add_score; } + _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + if(DIR==Direction::FORWARD){ + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + } else { + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) + } thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; i++; } @@ -592,23 +377,37 @@ sequence_kernel( } __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values if(thread_Id == 0) { - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; + if(DIR==Direction::FORWARD){ + if(lengthSeqA < lengthSeqB) + { + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + else + { + seqA_align_end[block_Id] = thread_max_i; + seqB_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; + } + } else { + if(lengthSeqA < lengthSeqB) + { + seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB + seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA + } + else + { + seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA + seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB + } } } + __syncthreads(); //TODO: May be unnecessary } } From 19a3f07cdb8992045046bdc611ed82b67740c9ff Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 17 Jul 2020 14:46:57 -0600 Subject: [PATCH 30/47] Make liberal use of const in kernels --- include/gpu_bsw/kernel.hpp | 95 ++++++++++++++++++-------------------- 1 file changed, 46 insertions(+), 49 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index bb11058..2061fac 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -36,7 +36,7 @@ warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsig // unsigned newmask; for(int offset = warpSize / 2; offset > 0; offset /= 2) { - int tempVal = __shfl_down_sync(mask, val, offset); + const int tempVal = __shfl_down_sync(mask, val, offset); val = max(val,tempVal); newInd = __shfl_down_sync(mask, ind, offset); newInd2 = __shfl_down_sync(mask, ind2, offset); @@ -78,12 +78,11 @@ blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsi myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); __syncthreads(); - if(laneId == 0) - locTots[warpId] = myVal; - if(laneId == 0) - locInds[warpId] = myInd; - if(laneId == 0) + if(laneId == 0){ + locTots[warpId] = myVal; + locInds[warpId] = myInd; locInds2[warpId] = myInd2; + } __syncthreads(); unsigned check = ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats @@ -119,8 +118,8 @@ findMaxFour(const short first, const short second, const short third, const shor { short maxScore = 0; - maxScore = max(first,second); - maxScore = max(maxScore, third); + maxScore = max(first, second); + maxScore = max(maxScore, third ); maxScore = max(maxScore, fourth); return maxScore; @@ -131,24 +130,24 @@ findMaxFour(const short first, const short second, const short third, const shor template inline __global__ void sequence_process( - char *const seqA_array, - char *const seqB_array, - unsigned *const prefix_lengthA, - unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, - short *const top_scores, - const short startGap, - const short extendGap, - const short *const scoring_matrix, - const short *const encoding_matrix + const char *const seqA_array, + const char *const seqB_array, + const unsigned *const prefix_lengthA, + const unsigned *const prefix_lengthB, + short *const seqA_align_begin, + short *const seqA_align_end, + short *const seqB_align_begin, + short *const seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix ){ - int block_Id = blockIdx.x; - int thread_Id = threadIdx.x; - short laneId = threadIdx.x%32; - short warpId = threadIdx.x/32; + const int block_Id = blockIdx.x; + const int thread_Id = threadIdx.x; + const short laneId = threadIdx.x%32; + const short warpId = threadIdx.x/32; //Only used by DNA sequencing const short matchScore = scoring_matrix[0]; @@ -158,9 +157,9 @@ sequence_process( unsigned lengthSeqB; // local pointers - char* seqA; - char* seqB; - char* longer_seq; + const char* seqA; + const char* seqB; + const char* longer_seq; extern __shared__ char is_valid_array[]; char* is_valid = &is_valid_array[0]; @@ -168,13 +167,13 @@ sequence_process( // setting up block local sequences and their lengths. if(block_Id == 0) { - seqA = seqA_array; - seqB = seqB_array; + seqA = seqA_array; + seqB = seqB_array; } else { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; + seqA = seqA_array + prefix_lengthA[block_Id - 1]; + seqB = seqB_array + prefix_lengthB[block_Id - 1]; } if(DIR==Direction::FORWARD){ @@ -195,8 +194,8 @@ sequence_process( // what is the max length and what is the min length - unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; + const unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; + const unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; // shared memory space for storing longer of the two strings memset(is_valid, 0, minSize); @@ -232,7 +231,7 @@ sequence_process( int i = 1; short thread_max = 0; // to maintain the thread max score short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + short thread_max_j = 0; // to maintain the DP coordinate j for the shorter string //initializing registers for storing diagonal values for three recent most diagonals (separate tables for //H, E and F) @@ -245,7 +244,7 @@ sequence_process( __shared__ short sh_prev_H[32]; __shared__ short sh_prev_prev_H[32]; - __shared__ short local_spill_prev_E[1024];// each threads local spill, + __shared__ short local_spill_prev_E[1024]; // each threads local spill, __shared__ short local_spill_prev_H[1024]; __shared__ short local_spill_prev_prev_H[1024]; @@ -268,7 +267,6 @@ sequence_process( // iterate for the number of anti-diagonals for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) { - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true // value exchange happens here to setup registers for next iteration @@ -308,12 +306,12 @@ sequence_process( if(is_valid[thread_Id] && thread_Id < minSize) { - unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - short fVal = _prev_F + extendGap; - short hfVal = _prev_H + startGap; - short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); - short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); - short eVal=0; + const unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); + const short fVal = _prev_F + extendGap; + const short hfVal = _prev_H + startGap; + const short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + const short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + short eVal = 0; short heVal = 0; if(diag >= maxSize) // when the previous thread has phased out, get value from shmem @@ -335,7 +333,7 @@ sequence_process( _curr_F = (fVal > hfVal) ? fVal : hfVal; _curr_E = (eVal > heVal) ? eVal : heVal; - short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + const short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); short final_prev_prev_H = 0; if(diag >= maxSize) @@ -349,15 +347,14 @@ sequence_process( if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; - const int diag_pos = (DIR==Direction::FORWARD) ? i-1 : maxSize-i; - short diag_score; + const int diag_pos = (DIR==Direction::FORWARD) ? i-1 : maxSize-i; if(DT==DataType::DNA){ diag_score = final_prev_prev_H + ((longer_seq[diag_pos] == myColumnChar) ? matchScore : misMatchScore); } else { - short mat_index_q = sh_aa_encoding[(int)longer_seq[diag_pos]]; //encoding_matrix - short mat_index_r = sh_aa_encoding[(int)myColumnChar]; - short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical + const short mat_index_q = sh_aa_encoding[(int)longer_seq[diag_pos]]; //encoding_matrix + const short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + const short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical diag_score = final_prev_prev_H + add_score; } From 70c23d628a74ce060351093dffdf092c7d54b15c Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Mon, 20 Jul 2020 20:51:45 -0600 Subject: [PATCH 31/47] Unittests for findMaxFour --- unittest/test_find_max_four.cpp | 24 ++++++++++++++++++++++++ 1 file changed, 24 insertions(+) create mode 100644 unittest/test_find_max_four.cpp diff --git a/unittest/test_find_max_four.cpp b/unittest/test_find_max_four.cpp new file mode 100644 index 0000000..5ee0b82 --- /dev/null +++ b/unittest/test_find_max_four.cpp @@ -0,0 +1,24 @@ +#include "doctest.h" + +#include + +#include +#include +#include +#include + +TEST_MAIN("findMaxFour"){ + std::mt19937 gen; + std::uniform_int_distribution value_dist(std::numeric_limits::min(),std::numeric_limits::max()); + std::array dat; + + for(int i=0;i<100;i++){ + for(int i=0;i<4;i++){ + dat.at(i) = value_dist(gen); + } + + const auto fmf_max = findMaxFour(dat.at(0), dat.at(1), dat.at(2), dat.at(3)); + const auto correct_max = *std::max_element(dat.begin(),dat.end()); + CHECK(fmf_max==correct_max); + } +} From 318028c4c7ab9004f3fc945afe2895454c520e70 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Mon, 20 Jul 2020 18:17:09 -0600 Subject: [PATCH 32/47] Add unittests for warpReduceMax_with_index and fix a bug --- CMakeLists.txt | 4 +- include/gpu_bsw/kernel.hpp | 71 +++++--- unittest/test_warpReduceMax_with_index.cu | 205 ++++++++++++++++++++++ 3 files changed, 253 insertions(+), 27 deletions(-) create mode 100644 unittest/test_warpReduceMax_with_index.cu diff --git a/CMakeLists.txt b/CMakeLists.txt index 509449d..6757ec7 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -18,12 +18,14 @@ set(sources ) set(test_sources - unittest/test_page_locked_string.cpp unittest/test_main.cpp + unittest/test_page_locked_string.cpp unittest/test_read_fasta.cpp unittest/test_timer.cpp + unittest/test_warpReduceMax_with_index.cu ) + set_source_files_properties(${sources} ${test_sources} evaluation/main.cpp PROPERTIES LANGUAGE CUDA diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 2061fac..95b789d 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -1,6 +1,7 @@ #ifndef KERNEL_HPP #define KERNEL_HPP +#include #include #include #include @@ -22,44 +23,62 @@ enum class Direction { namespace gpu_bsw{ +///@brief Within a warp, find the maximum value and its associated indices +///@param val Value associated with this thread +///@param myIndex Index of that value along the i-axis +///@param myIndex2 Index of that value along the j-axis +///@param lengthSeqB Length of the sequence being aligned (<=1024) +///@return Lane 0 of the warp returns the maximum value found in the warp, +/// and Lane 0's myIndex and myIndex2 are set to correspond to the +// indices of this value. Other lanes' values and returns are garbage. template static __inline__ __device__ short -warpReduceMax_with_index(short val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) +warpReduceMax_with_index(const short my_initial_val, short& myIndex, short& myIndex2, const unsigned lengthSeqB) { + assert(lengthSeqB<=1024); + constexpr int warpSize = 32; - short myMax = val; - short newInd = 0; - short newInd2 = 0; - short ind = myIndex; - short ind2 = myIndex2; - unsigned mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); // blockDim.x - // unsigned newmask; + //We set the initial maximum value to INT16_MIN for threads which are out of + //range. Since all other allowed values are greater than this, we'll always + //get the right answer unless all of the threads have INT16_MIN as their + //value and we're moving in the reverse direction. + short maxval = (threadIdx.x < lengthSeqB) ? my_initial_val : INT16_MIN; + short maxi = myIndex; + short maxi2 = myIndex2; + + const auto mask = __ballot_sync(0xffffffff, threadIdx.x < lengthSeqB); + for(int offset = warpSize / 2; offset > 0; offset /= 2) { - const int tempVal = __shfl_down_sync(mask, val, offset); - val = max(val,tempVal); - newInd = __shfl_down_sync(mask, ind, offset); - newInd2 = __shfl_down_sync(mask, ind2, offset); - if(val != myMax) + //Get the value and indices corresponding to our shuffle buddy + const auto buddy_val = __shfl_down_sync(mask, maxval, offset); + const auto buddy_i = __shfl_down_sync(mask, maxi, offset); + const auto buddy_i2 = __shfl_down_sync(mask, maxi2, offset); + + //If our buddy's value is greater than our value, we take our buddy's + //information + if(buddy_val>maxval) { - ind = newInd; - ind2 = newInd2; - myMax = val; + maxi = buddy_i; + maxi2 = buddy_i2; + maxval = buddy_val; } - else if((val == tempVal) ) // this is kind of redundant and has been done purely to match the results - // with SSW to get the smallest alignment with highest score. Theoreticaly - // all the alignmnts with same score are same. + else if(buddy_val == maxval) { - if((DIR==Direction::REVERSE && newInd2 > ind2) || (DIR==Direction::FORWARD && newInd < ind)){ - ind = newInd; - ind2 = newInd2; + // We want to keep the first maximum value we find in the direction + // of travel. This is kind of redundant and has been done purely to + // match the results with SSW to get the smallest alignment with + // highest score. Theoreticaly all the alignmnts with same score are + // same. + if((DIR==Direction::REVERSE && buddy_i2 > maxi2) || (DIR==Direction::FORWARD && buddy_i < maxi)){ + maxi = buddy_i; + maxi2 = buddy_i2; } } } - myIndex = ind; - myIndex2 = ind2; - val = myMax; - return val; + myIndex = maxi; + myIndex2 = maxi2; + return maxval; } diff --git a/unittest/test_warpReduceMax_with_index.cu b/unittest/test_warpReduceMax_with_index.cu new file mode 100644 index 0000000..4e2e6bf --- /dev/null +++ b/unittest/test_warpReduceMax_with_index.cu @@ -0,0 +1,205 @@ +#include "doctest.h" + +#include + +#include + +#include +#include +#include +#include + +using namespace gpu_bsw; + +template +std::ostream& operator<<(std::ostream &out, thrust::device_vector &vec){ + for(size_t i=0;i +__global__ void test_warpReduceMax_with_index( + short *values, + short *indices1, + short *indices2, + const unsigned seq_length +){ + const int laneId = threadIdx.x % 32; + const auto maxval = warpReduceMax_with_index(values[laneId], indices1[laneId], indices2[laneId], seq_length); + values[laneId] = maxval; +} + + + +TEST_CASE("warpReduceMax_with_index forward general"){ + std::mt19937 gen; + std::uniform_int_distribution value_dist(std::numeric_limits::min(),std::numeric_limits::max()); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(32); + + std::vector h_index1(32); + std::vector h_index2(32); + for(int i=0;i<32;i++){ + h_index1[i] = i; + h_index2[i] = 32-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<32;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_warpReduceMax_with_index<<<1,32>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==32-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(-3,3); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(32); + + std::vector h_index1(32); + std::vector h_index2(32); + for(int i=0;i<32;i++){ + h_index1[i] = i; + h_index2[i] = 32-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<1000;i++){ + for(int i=0;i<32;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_warpReduceMax_with_index<<<1,32>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + //Note that max_element returns the first index if the same maximum value is found multiple times + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==32-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(std::numeric_limits::min(),std::numeric_limits::max()); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(32); + + std::vector h_index1(32); + std::vector h_index2(32); + for(int i=0;i<32;i++){ + h_index1[i] = i; + h_index2[i] = 32-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<32;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_warpReduceMax_with_index<<<1,32>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==maxiter-h_values.begin()); + CHECK(d_index2[0]==32-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(-3,3); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(32); + + std::vector h_index1(32); + std::vector h_index2(32); + for(int i=0;i<32;i++){ + h_index1[i] = i; + h_index2[i] = 32-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<1000;i++){ + for(int i=0;i<32;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_warpReduceMax_with_index<<<1,32>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + //Note that max_element returns the first index if the same maximum value is found multiple times + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==maxiter-h_values.begin()); + CHECK(d_index2[0]==32-(maxiter-h_values.begin())); + CHECK(d_index1[0] Date: Tue, 21 Jul 2020 15:03:30 -0600 Subject: [PATCH 33/47] Add unittests and simplify blockShuffleReduce_with_index --- CMakeLists.txt | 1 + include/gpu_bsw/kernel.hpp | 61 ++++-- .../test_blockShuffleReduce_with_index.cu | 202 ++++++++++++++++++ 3 files changed, 243 insertions(+), 21 deletions(-) create mode 100644 unittest/test_blockShuffleReduce_with_index.cu diff --git a/CMakeLists.txt b/CMakeLists.txt index 6757ec7..832b68c 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -18,6 +18,7 @@ set(sources ) set(test_sources + unittest/test_blockShuffleReduce_with_index.cu unittest/test_main.cpp unittest/test_page_locked_string.cpp unittest/test_read_fasta.cpp diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 95b789d..770bde2 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -87,46 +87,65 @@ template static __device__ short blockShuffleReduce_with_index(short myVal, short& myIndex, short& myIndex2, unsigned lengthSeqB) { - const int laneId = threadIdx.x % 32; - const int warpId = threadIdx.x / 32; - __shared__ short locTots[32]; - __shared__ short locInds[32]; - __shared__ short locInds2[32]; + assert(lengthSeqB<=1024); + + constexpr int WS = 32; //Warp size + const auto laneId = threadIdx.x % WS; + const auto warpId = threadIdx.x / WS; + + __shared__ short warp_lead_max [WS]; //Maximum value of each warp's lane 0 + __shared__ short warp_lead_inds [WS]; //Index1 associated with that max + __shared__ short warp_lead_inds2[WS]; //Index2 associated with that max + + //Get the maximum value information for each of the warps short myInd = myIndex; short myInd2 = myIndex2; myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); - __syncthreads(); + //Each warp calculates and writes its answer independently and all the + //threads in the warp move together, so we don't need a sync point here if(laneId == 0){ - locTots[warpId] = myVal; - locInds[warpId] = myInd; - locInds2[warpId] = myInd2; + warp_lead_max [warpId] = myVal; + warp_lead_inds [warpId] = myInd; + warp_lead_inds2[warpId] = myInd2; } + + //We need to gather each warp's maximum info into a single warp, so we need + //to sync here. __syncthreads(); - unsigned check = - ((32 + blockDim.x - 1) / 32); // mimicing the ceil function for floats - // float check = ((float)blockDim.x / 32); - if(threadIdx.x < check) /////******////// + + //We'll now set up the 0th warp of the block to finish the reduction. Each + //thread in that warp will take the maximum information retrieved from each + //of the block's warps above. + + //A standard block reduction would use `blockDim.x/WS` to determine which + //warps were active, but this assumes all the threads in a warp were active. + //In our case, only some of the threads might be activate, so we need to + //round up. Therefore, we use the integer ceiling function below. + const unsigned warp_was_active = (blockDim.x + (WS-1)) / WS; + + if(threadIdx.x < warp_was_active) { - myVal = locTots[threadIdx.x]; - myInd = locInds[threadIdx.x]; - myInd2 = locInds2[threadIdx.x]; + myVal = warp_lead_max [laneId]; + myInd = warp_lead_inds [laneId]; + myInd2 = warp_lead_inds2[laneId]; } else { - myVal = 0; - myInd = -1; - myInd2 = -1; + myVal = INT16_MIN; + myInd = INT16_MIN; + myInd2 = INT16_MIN; } - __syncthreads(); + //The zeroth warp now holds the maximums of each of the other warps. We now + //do a reduction on the zeroth warp to find the overall max. if(warpId == 0) { myVal = warpReduceMax_with_index(myVal, myInd, myInd2, lengthSeqB); myIndex = myInd; myIndex2 = myInd2; } - __syncthreads(); + return myVal; } diff --git a/unittest/test_blockShuffleReduce_with_index.cu b/unittest/test_blockShuffleReduce_with_index.cu new file mode 100644 index 0000000..5f4d5b8 --- /dev/null +++ b/unittest/test_blockShuffleReduce_with_index.cu @@ -0,0 +1,202 @@ +#include "doctest.h" + +#include + +#include + +#include +#include +#include +#include + +using namespace gpu_bsw; + +template +std::ostream& operator<<(std::ostream &out, thrust::device_vector &vec){ + for(size_t i=0;i +__global__ void test_blockShuffleReduce_with_index( + short *values, + short *indices1, + short *indices2, + const unsigned seq_length +){ + const auto maxval = blockShuffleReduce_with_index(values[threadIdx.x], indices1[threadIdx.x], indices2[threadIdx.x], seq_length); + values[threadIdx.x] = maxval; +} + + + +TEST_CASE("blockShuffleReduce_with_index forward general"){ + std::mt19937 gen; + std::uniform_int_distribution value_dist(std::numeric_limits::min(),std::numeric_limits::max()); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(1024); + + std::vector h_index1(1024); + std::vector h_index2(1024); + for(int i=0;i<1024;i++){ + h_index1[i] = i; + h_index2[i] = 1024-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<1024;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_blockShuffleReduce_with_index<<<1,1024>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==1024-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(-10,10); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(1024); + + std::vector h_index1(1024); + std::vector h_index2(1024); + for(int i=0;i<1024;i++){ + h_index1[i] = i; + h_index2[i] = 1024-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<1024;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_blockShuffleReduce_with_index<<<1,1024>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==1024-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(std::numeric_limits::min(),std::numeric_limits::max()); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(1024); + + std::vector h_index1(1024); + std::vector h_index2(1024); + for(int i=0;i<1024;i++){ + h_index1[i] = i; + h_index2[i] = 1024-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<1024;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_blockShuffleReduce_with_index<<<1,1024>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==1024-(maxiter-h_values.begin())); + CHECK(d_index1[0] value_dist(-10,10); + std::uniform_int_distribution len_dist(1,32); + + std::vector h_values(1024); + + std::vector h_index1(1024); + std::vector h_index2(1024); + for(int i=0;i<1024;i++){ + h_index1[i] = i; + h_index2[i] = 1024-i; + } + + thrust::device_vector d_values; + thrust::device_vector d_index1; + thrust::device_vector d_index2; + + for(int i=0;i<10000;i++){ + for(int i=0;i<1024;i++){ + h_values[i] = value_dist(gen); + } + + d_values = h_values; + d_index1 = h_index1; + d_index2 = h_index2; + + const int len = len_dist(gen); + + test_blockShuffleReduce_with_index<<<1,1024>>>(thrust::raw_pointer_cast(d_values.data()), thrust::raw_pointer_cast(d_index1.data()), thrust::raw_pointer_cast(d_index2.data()), len); + + cudaDeviceSynchronize(); + + const auto maxiter = std::max_element(h_values.begin(), h_values.begin()+len); + CHECK(d_values[0]==*maxiter); + CHECK(d_index1[0]==(maxiter-h_values.begin())); + CHECK(d_index2[0]==1024-(maxiter-h_values.begin())); + CHECK(d_index1[0] Date: Tue, 21 Jul 2020 13:27:55 -0600 Subject: [PATCH 34/47] Simplifying sequence_process --- CMakeLists.txt | 5 + include/gpu_bsw/kernel.hpp | 211 ++++++++++++------------------ unittest/test.cu | 105 +++++++++++++++ unittest/test_misc.cpp | 11 ++ unittest/test_sequence_process.cu | 3 + 5 files changed, 205 insertions(+), 130 deletions(-) create mode 100644 unittest/test.cu create mode 100644 unittest/test_misc.cpp create mode 100644 unittest/test_sequence_process.cu diff --git a/CMakeLists.txt b/CMakeLists.txt index 832b68c..17dbde3 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -22,6 +22,7 @@ set(test_sources unittest/test_main.cpp unittest/test_page_locked_string.cpp unittest/test_read_fasta.cpp + unittest/test_sequence_process.cu unittest/test_timer.cpp unittest/test_warpReduceMax_with_index.cu ) @@ -57,6 +58,10 @@ target_link_libraries(program_gpu PRIVATE gpu_bsw) add_executable(unittest ${test_sources}) target_link_libraries(unittest PRIVATE gpu_bsw) +add_executable(test unittest/test.cu) +target_link_libraries(test PRIVATE gpu_bsw) + + add_custom_target( regression_tests ALL COMMAND ${CMAKE_COMMAND} -E make_directory ${CMAKE_BINARY_DIR}/regression_test diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 770bde2..d4c1bc9 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -165,6 +165,16 @@ findMaxFour(const short first, const short second, const short third, const shor +template +__inline__ __device__ __host__ void +swap(T &a, T &b){ + T temp(a); + a = b; + b = temp; +} + + + template inline __global__ void sequence_process( @@ -172,10 +182,10 @@ sequence_process( const char *const seqB_array, const unsigned *const prefix_lengthA, const unsigned *const prefix_lengthB, - short *const seqA_align_begin, - short *const seqA_align_end, - short *const seqB_align_begin, - short *const seqB_align_end, + short * seqA_align_begin, + short * seqA_align_end, + short * seqB_align_begin, + short * seqB_align_end, short *const top_scores, const short startGap, const short extendGap, @@ -191,100 +201,42 @@ sequence_process( const short matchScore = scoring_matrix[0]; const short misMatchScore = scoring_matrix[1]; + //Determine sequence lengths unsigned lengthSeqA; unsigned lengthSeqB; - - // local pointers - const char* seqA; - const char* seqB; - const char* longer_seq; - - extern __shared__ char is_valid_array[]; - char* is_valid = &is_valid_array[0]; - - // setting up block local sequences and their lengths. - if(block_Id == 0) - { - seqA = seqA_array; - seqB = seqB_array; - } - else - { - seqA = seqA_array + prefix_lengthA[block_Id - 1]; - seqB = seqB_array + prefix_lengthB[block_Id - 1]; - } - if(DIR==Direction::FORWARD){ - if(block_Id == 0) - { - lengthSeqA = prefix_lengthA[0]; - lengthSeqB = prefix_lengthB[0]; - } - else - { - lengthSeqA = prefix_lengthA[block_Id] - prefix_lengthA[block_Id - 1]; - lengthSeqB = prefix_lengthB[block_Id] - prefix_lengthB[block_Id - 1]; - } + lengthSeqA = prefix_lengthA[block_Id] - ((block_Id==0) ? 0 : prefix_lengthA[block_Id - 1]); + lengthSeqB = prefix_lengthB[block_Id] - ((block_Id==0) ? 0 : prefix_lengthB[block_Id - 1]); } else { lengthSeqA = seqA_align_end[block_Id]; lengthSeqB = seqB_align_end[block_Id]; } - - // what is the max length and what is the min length - const unsigned maxSize = lengthSeqA > lengthSeqB ? lengthSeqA : lengthSeqB; - const unsigned minSize = lengthSeqA < lengthSeqB ? lengthSeqA : lengthSeqB; - - // shared memory space for storing longer of the two strings - memset(is_valid, 0, minSize); - is_valid += minSize; - memset(is_valid, 1, minSize); - is_valid += minSize; - memset(is_valid, 0, minSize); - __syncthreads(); // this is required because shmem writes //TODO: May be unnecessary because shared memory isn't used for a while below and there's another synchronization point before it is. - - // When moving forward, the shorter of the two strings is stored in thread registers. - - // When moving in reverse, check if the new length of A is larger than B, if so then - // place the B string in registers and A in myLocString, make sure we dont do redundant - // copy by checking which string is located in myLocString before - char myColumnChar; - if(lengthSeqA < lengthSeqB) - { - const auto pos = (DIR==Direction::FORWARD) ? thread_Id : (lengthSeqA - 1) - thread_Id; - if(thread_Id < lengthSeqA) - myColumnChar = seqA[pos]; // read only once - longer_seq = seqB; - } - else - { - const auto pos = (DIR==Direction::FORWARD) ? thread_Id : (lengthSeqB - 1) - thread_Id; - if(thread_Id < lengthSeqB) - myColumnChar = seqB[pos]; - longer_seq = seqA; + const char *seqA = &seqA_array[(block_Id==0) ? 0 : prefix_lengthA[block_Id - 1]]; + const char *seqB = &seqB_array[(block_Id==0) ? 0 : prefix_lengthB[block_Id - 1]]; + + // We arbitrarily decide that Sequence A will always be shorter (or equal to) + // Sequence B. If this isn't the case, we swap things around to make the code + // below simpler. + if(lengthSeqA>lengthSeqB){ + swap(lengthSeqA, lengthSeqB ); + swap(seqA_align_begin, seqB_align_begin); + swap(seqA_align_end, seqB_align_end ); + swap(seqA, seqB ); } - __syncthreads(); // this is required here so that complete sequence has been copied to shared memory - - int i = 1; - short thread_max = 0; // to maintain the thread max score - short thread_max_i = 0; // to maintain the DP coordinate i for the longer string - short thread_max_j = 0; // to maintain the DP coordinate j for the shorter string - - //initializing registers for storing diagonal values for three recent most diagonals (separate tables for - //H, E and F) - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; + extern __shared__ char is_valid_array[]; + char* is_valid = &is_valid_array[0]; - __shared__ short sh_prev_E[32]; // one such element is required per warp - __shared__ short sh_prev_H[32]; - __shared__ short sh_prev_prev_H[32]; + // shared memory space for storing longer of the two strings + memset(is_valid, 0, lengthSeqA); + is_valid += lengthSeqA; + memset(is_valid, 1, lengthSeqA); + is_valid += lengthSeqA; + memset(is_valid, 0, lengthSeqA); - __shared__ short local_spill_prev_E[1024]; // each threads local spill, - __shared__ short local_spill_prev_H[1024]; - __shared__ short local_spill_prev_prev_H[1024]; + const auto pos = (DIR==Direction::FORWARD) ? thread_Id : (lengthSeqA - 1) - thread_Id; + const char myColumnChar = (thread_Id < lengthSeqA) ? seqA[pos] : -1; // read only once //Used only by RNA. Has a length of 1 for DNA because length 0 is not allowed. __shared__ short sh_aa_encoding[(DT==DataType::RNA)?ENCOD_MAT_SIZE:1];// length = 91 @@ -300,12 +252,30 @@ sequence_process( } } + __shared__ short sh_prev_E[32]; // one such element is required per warp + __shared__ short sh_prev_H[32]; + __shared__ short sh_prev_prev_H[32]; + + __shared__ short local_spill_prev_E[1024]; // each threads local spill, + __shared__ short local_spill_prev_H[1024]; + __shared__ short local_spill_prev_prev_H[1024]; + + short _curr_H = 0, _curr_F = 0, _curr_E = 0; + short _prev_H = 0, _prev_F = 0, _prev_E = 0; + short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; + short _temp_Val = 0; + + int i = 1; + short thread_max = 0; // to maintain the thread max score + short thread_max_i = 0; // to maintain the DP coordinate i for the longer string + short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string + __syncthreads(); // to make sure all shmem allocations have been initialized // iterate for the number of anti-diagonals for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) { - is_valid = is_valid - (diag < minSize || diag >= maxSize); //move the pointer to left by 1 if cnd true + is_valid = is_valid - (diag < lengthSeqA || diag >= lengthSeqB); //move the pointer to left by 1 if cnd true // value exchange happens here to setup registers for next iteration _temp_Val = _prev_H; @@ -333,7 +303,7 @@ sequence_process( sh_prev_prev_H[warpId] = _prev_prev_H; } - if(diag >= maxSize) + if(diag >= lengthSeqB) { // if you are invalid in this iteration, spill your values to shmem local_spill_prev_E[thread_Id] = _prev_E; local_spill_prev_H[thread_Id] = _prev_H; @@ -342,25 +312,25 @@ sequence_process( __syncthreads(); // this is needed so that all the shmem writes are completed. - if(is_valid[thread_Id] && thread_Id < minSize) + if(is_valid[thread_Id] && thread_Id < lengthSeqA) { - const unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < minSize))); - const short fVal = _prev_F + extendGap; + const unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < lengthSeqA))); + const short fVal = _prev_F + extendGap; const short hfVal = _prev_H + startGap; - const short valeShfl = __shfl_sync(mask, _prev_E, laneId- 1, 32); + const short valeShfl = __shfl_sync(mask, _prev_E, laneId - 1, 32); const short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); short eVal = 0; short heVal = 0; - if(diag >= maxSize) // when the previous thread has phased out, get value from shmem + if(diag >= lengthSeqB) // when the previous thread has phased out, get value from shmem { - eVal = local_spill_prev_E[thread_Id - 1] + extendGap; - heVal = local_spill_prev_H[thread_Id - 1]+ startGap; + eVal = local_spill_prev_E[thread_Id - 1] + extendGap; + heVal = local_spill_prev_H[thread_Id - 1] + startGap; } else { - eVal =((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; - heVal =((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; + eVal = ((warpId !=0 && laneId == 0)?sh_prev_E[warpId-1]: valeShfl) + extendGap; + heVal = ((warpId !=0 && laneId == 0)?sh_prev_H[warpId-1]:valheShfl) + startGap; } if(warpId == 0 && laneId == 0) // make sure that values for lane 0 in warp 0 is not undefined @@ -368,13 +338,13 @@ sequence_process( eVal = 0; heVal = 0; } - _curr_F = (fVal > hfVal) ? fVal : hfVal; - _curr_E = (eVal > heVal) ? eVal : heVal; + _curr_F = max(fVal, hfVal); + _curr_E = max(eVal, heVal); const short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); short final_prev_prev_H = 0; - if(diag >= maxSize) + if(diag >= lengthSeqB) { final_prev_prev_H = local_spill_prev_prev_H[thread_Id - 1]; } @@ -386,11 +356,11 @@ sequence_process( if(warpId == 0 && laneId == 0) final_prev_prev_H = 0; short diag_score; - const int diag_pos = (DIR==Direction::FORWARD) ? i-1 : maxSize-i; + const int diag_pos = (DIR==Direction::FORWARD) ? i-1 : lengthSeqB-i; if(DT==DataType::DNA){ - diag_score = final_prev_prev_H + ((longer_seq[diag_pos] == myColumnChar) ? matchScore : misMatchScore); + diag_score = final_prev_prev_H + ((seqB[diag_pos] == myColumnChar) ? matchScore : misMatchScore); } else { - const short mat_index_q = sh_aa_encoding[(int)longer_seq[diag_pos]]; //encoding_matrix + const short mat_index_q = sh_aa_encoding[(int)seqB[diag_pos]]; //encoding_matrix const short mat_index_r = sh_aa_encoding[(int)myColumnChar]; const short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical @@ -402,47 +372,28 @@ sequence_process( thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; } else { - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : maxSize - i; // begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : minSize - thread_Id -1; // begin_B (shorter string) + thread_max_i = (thread_max >= _curr_H) ? thread_max_i : lengthSeqB - i; // begin_A (longer string) + thread_max_j = (thread_max >= _curr_H) ? thread_max_j : lengthSeqA - thread_Id -1; // begin_B (shorter string) } thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; i++; } __syncthreads(); // why do I need this? commenting it out breaks it } - __syncthreads(); - thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, minSize); // thread 0 will have the correct values + thread_max = blockShuffleReduce_with_index(thread_max, thread_max_i, thread_max_j, lengthSeqA); // thread 0 will have the correct values if(thread_Id == 0) { if(DIR==Direction::FORWARD){ - if(lengthSeqA < lengthSeqB) - { - seqB_align_end[block_Id] = thread_max_i; - seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } - else - { - seqA_align_end[block_Id] = thread_max_i; - seqB_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; - } + seqB_align_end[block_Id] = thread_max_i; + seqA_align_end[block_Id] = thread_max_j; + top_scores[block_Id] = thread_max; } else { - if(lengthSeqA < lengthSeqB) - { - seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB - seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA - } - else - { - seqA_align_begin[block_Id] = thread_max_i; //newlengthSeqA - seqB_align_begin[block_Id] = thread_max_j; //newlengthSeqB - } + seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB + seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA } } - __syncthreads(); //TODO: May be unnecessary } } diff --git a/unittest/test.cu b/unittest/test.cu new file mode 100644 index 0000000..0002048 --- /dev/null +++ b/unittest/test.cu @@ -0,0 +1,105 @@ +#include +#include + +#include + +#include +#include +#include + +using namespace gpu_bsw; + +std::mt19937 gen; +std::uniform_int_distribution dna_dist(0,3); +std::uniform_int_distribution len_dist(1,32); + +std::vector randomDNA(const int len){ + constexpr std::array bases = {'A','C','G','T'}; + std::vector temp; + temp.reserve(len); + for(int i=0;i +std::ostream& operator<<(std::ostream &out, thrust::device_vector &vec){ + for(size_t i=0;i seqA_array; + seqA_array = randomDNA( alen); + thrust::device_vector seqB_array; + seqB_array = randomDNA(blen); + thrust::device_vector prefix_lengthA(1); + thrust::device_vector prefix_lengthB(1); + + prefix_lengthA[0] = alen; + prefix_lengthB[0] = blen; + + thrust::device_vector seqA_align_begin(1); + thrust::device_vector seqA_align_end(1); + thrust::device_vector seqB_align_begin(1); + thrust::device_vector seqB_align_end(1); + + thrust::device_vector top_scores(1); + + thrust::device_vector scoring_matrix(2); + thrust::device_vector encoding_matrix(1); + + scoring_matrix[0] = 1; + scoring_matrix[1] = -4; + + encoding_matrix[0] = 0; + + const short startGap = 6; + const short extendGap = 1; + + // unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; + const unsigned minSize = alen; + const unsigned totShmem = 3 * (minSize + 1) * sizeof(short); + const unsigned alignmentPad = 4 + (4 - totShmem % 4); + const size_t ShmemBytes = totShmem + alignmentPad; + // if(ShmemBytes > 48000 && DT==DataType::DNA) + // cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + + cudaErrchk(cudaDeviceSynchronize()); + + sequence_process<<<1, minSize, ShmemBytes>>>( + thrust::raw_pointer_cast(seqA_array.data()), + thrust::raw_pointer_cast(seqB_array.data()), + thrust::raw_pointer_cast(prefix_lengthA.data()), + thrust::raw_pointer_cast(prefix_lengthB.data()), + thrust::raw_pointer_cast(seqA_align_begin.data()), + thrust::raw_pointer_cast(seqA_align_end.data()), + thrust::raw_pointer_cast(seqB_align_begin.data()), + thrust::raw_pointer_cast(seqB_align_end.data()), + thrust::raw_pointer_cast(top_scores.data()), + startGap, + extendGap, + thrust::raw_pointer_cast(scoring_matrix.data()), + thrust::raw_pointer_cast(encoding_matrix.data()) + ); + cudaErrchk(cudaGetLastError()); + + cudaErrchk(cudaDeviceSynchronize()); + + std::cout<<"seqA = "< + +TEST_CASE("swap"){ + int a = 3; + int b = 5; + gpu_bsw::swap(a,b); + CHECK(a==5); + CHECK(b==3); +} \ No newline at end of file diff --git a/unittest/test_sequence_process.cu b/unittest/test_sequence_process.cu new file mode 100644 index 0000000..2807467 --- /dev/null +++ b/unittest/test_sequence_process.cu @@ -0,0 +1,3 @@ +#include "doctest.h" + +#include From 6ea187c8a4b2cd9b7e2af9a859a0517fec394165 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Wed, 22 Jul 2020 12:15:01 -0600 Subject: [PATCH 35/47] Pack variables into cells and simplify value rotation --- include/gpu_bsw/kernel.hpp | 77 +++++++++++++++++--------------------- 1 file changed, 35 insertions(+), 42 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index d4c1bc9..2d05e91 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -175,6 +175,14 @@ swap(T &a, T &b){ +struct Cell { + short H = 0; + short F = 0; + short E = 0; +}; + + + template inline __global__ void sequence_process( @@ -260,10 +268,9 @@ sequence_process( __shared__ short local_spill_prev_H[1024]; __shared__ short local_spill_prev_prev_H[1024]; - short _curr_H = 0, _curr_F = 0, _curr_E = 0; - short _prev_H = 0, _prev_F = 0, _prev_E = 0; - short _prev_prev_H = 0, _prev_prev_F = 0, _prev_prev_E = 0; - short _temp_Val = 0; + Cell curr; + Cell prev; + Cell pprev; int i = 1; short thread_max = 0; // to maintain the thread max score @@ -277,37 +284,23 @@ sequence_process( { is_valid = is_valid - (diag < lengthSeqA || diag >= lengthSeqB); //move the pointer to left by 1 if cnd true - // value exchange happens here to setup registers for next iteration - _temp_Val = _prev_H; - _prev_H = _curr_H; - _curr_H = _prev_prev_H; - _prev_prev_H = _temp_Val; - _curr_H = 0; - - _temp_Val = _prev_E; - _prev_E = _curr_E; - _curr_E = _prev_prev_E; - _prev_prev_E = _temp_Val; - _curr_E = 0; - - _temp_Val = _prev_F; - _prev_F = _curr_F; - _curr_F = _prev_prev_F; - _prev_prev_F = _temp_Val; - _curr_F = 0; + // Value exchange happens here to setup registers for next iteration + pprev = prev; + prev = curr; + curr = {0,0,0}; if(laneId == 31) { // if you are the last thread in your warp then spill your values to shmem - sh_prev_E[warpId] = _prev_E; - sh_prev_H[warpId] = _prev_H; - sh_prev_prev_H[warpId] = _prev_prev_H; + sh_prev_E[warpId] = prev.E; + sh_prev_H[warpId] = prev.H; + sh_prev_prev_H[warpId] = pprev.H; } if(diag >= lengthSeqB) { // if you are invalid in this iteration, spill your values to shmem - local_spill_prev_E[thread_Id] = _prev_E; - local_spill_prev_H[thread_Id] = _prev_H; - local_spill_prev_prev_H[thread_Id] = _prev_prev_H; + local_spill_prev_E[thread_Id] = prev.E; + local_spill_prev_H[thread_Id] = prev.H; + local_spill_prev_prev_H[thread_Id] = pprev.H; } __syncthreads(); // this is needed so that all the shmem writes are completed. @@ -315,10 +308,10 @@ sequence_process( if(is_valid[thread_Id] && thread_Id < lengthSeqA) { const unsigned mask = __ballot_sync(__activemask(), (is_valid[thread_Id] &&( thread_Id < lengthSeqA))); - const short fVal = _prev_F + extendGap; - const short hfVal = _prev_H + startGap; - const short valeShfl = __shfl_sync(mask, _prev_E, laneId - 1, 32); - const short valheShfl = __shfl_sync(mask, _prev_H, laneId - 1, 32); + const short fVal = prev.F + extendGap; + const short hfVal = prev.H + startGap; + const short valeShfl = __shfl_sync(mask, prev.E, laneId - 1, 32); + const short valheShfl = __shfl_sync(mask, prev.H, laneId - 1, 32); short eVal = 0; short heVal = 0; @@ -338,10 +331,10 @@ sequence_process( eVal = 0; heVal = 0; } - _curr_F = max(fVal, hfVal); - _curr_E = max(eVal, heVal); + curr.F = max(fVal, hfVal); + curr.E = max(eVal, heVal); - const short testShufll = __shfl_sync(mask, _prev_prev_H, laneId - 1, 32); + const short testShufll = __shfl_sync(mask, pprev.H, laneId - 1, 32); short final_prev_prev_H = 0; if(diag >= lengthSeqB) @@ -367,15 +360,15 @@ sequence_process( diag_score = final_prev_prev_H + add_score; } - _curr_H = findMaxFour(diag_score, _curr_F, _curr_E, 0); + curr.H = findMaxFour(diag_score, curr.F, curr.E, 0); if(DIR==Direction::FORWARD){ - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : i; - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : thread_Id + 1; + thread_max_i = (thread_max >= curr.H) ? thread_max_i : i; + thread_max_j = (thread_max >= curr.H) ? thread_max_j : thread_Id + 1; } else { - thread_max_i = (thread_max >= _curr_H) ? thread_max_i : lengthSeqB - i; // begin_A (longer string) - thread_max_j = (thread_max >= _curr_H) ? thread_max_j : lengthSeqA - thread_Id -1; // begin_B (shorter string) + thread_max_i = (thread_max >= curr.H) ? thread_max_i : lengthSeqB - i; // begin_A (longer string) + thread_max_j = (thread_max >= curr.H) ? thread_max_j : lengthSeqA - thread_Id -1; // begin_B (shorter string) } - thread_max = (thread_max >= _curr_H) ? thread_max : _curr_H; + thread_max = (thread_max >= curr.H) ? thread_max : curr.H; i++; } __syncthreads(); // why do I need this? commenting it out breaks it @@ -388,7 +381,7 @@ sequence_process( if(DIR==Direction::FORWARD){ seqB_align_end[block_Id] = thread_max_i; seqA_align_end[block_Id] = thread_max_j; - top_scores[block_Id] = thread_max; + top_scores[block_Id] = thread_max; } else { seqB_align_begin[block_Id] = thread_max_i; //newlengthSeqB seqA_align_begin[block_Id] = thread_max_j; //newlengthSeqA From 3d7cfd861854ef94d2b7da6048b99f87ca53f7d3 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Wed, 22 Jul 2020 12:26:40 -0600 Subject: [PATCH 36/47] Remove another sync point --- include/gpu_bsw/kernel.hpp | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 2d05e91..56306b6 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -277,12 +277,14 @@ sequence_process( short thread_max_i = 0; // to maintain the DP coordinate i for the longer string short thread_max_j = 0;// to maintain the DP cooirdinate j for the shorter string - __syncthreads(); // to make sure all shmem allocations have been initialized + //We don't need to sync before the loop since none of the shared memory that + //is written above is used before the first sync point within the loop. // iterate for the number of anti-diagonals for(int diag = 0; diag < lengthSeqA + lengthSeqB - 1; diag++) { - is_valid = is_valid - (diag < lengthSeqA || diag >= lengthSeqB); //move the pointer to left by 1 if cnd true + // Move the pointer to left by 1 if the condition is true + is_valid -= (diag < lengthSeqA || diag >= lengthSeqB); // Value exchange happens here to setup registers for next iteration pprev = prev; From d92bccc9214640b4b99ea4af9d2a571366a50cc0 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Wed, 22 Jul 2020 12:31:07 -0600 Subject: [PATCH 37/47] Remove explicit int cast and fix some formatting --- include/gpu_bsw/kernel.hpp | 8 +++++--- 1 file changed, 5 insertions(+), 3 deletions(-) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 56306b6..ff9bc87 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -251,7 +251,7 @@ sequence_process( __shared__ short sh_aa_scoring [(DT==DataType::RNA)?SCORE_MAT_SIZE:1]; if(DT==DataType::RNA){ - int max_threads = blockDim.x; + const auto max_threads = blockDim.x; for(int p = thread_Id; p < SCORE_MAT_SIZE; p+=max_threads){ sh_aa_scoring[p] = scoring_matrix[p]; } @@ -355,14 +355,15 @@ sequence_process( if(DT==DataType::DNA){ diag_score = final_prev_prev_H + ((seqB[diag_pos] == myColumnChar) ? matchScore : misMatchScore); } else { - const short mat_index_q = sh_aa_encoding[(int)seqB[diag_pos]]; //encoding_matrix - const short mat_index_r = sh_aa_encoding[(int)myColumnChar]; + const short mat_index_q = sh_aa_encoding[seqB[diag_pos]]; //encoding_matrix + const short mat_index_r = sh_aa_encoding[myColumnChar]; const short add_score = sh_aa_scoring[mat_index_q*24 + mat_index_r]; // doesnt really matter in what order these indices are used, since the scoring table is symmetrical diag_score = final_prev_prev_H + add_score; } curr.H = findMaxFour(diag_score, curr.F, curr.E, 0); + if(DIR==Direction::FORWARD){ thread_max_i = (thread_max >= curr.H) ? thread_max_i : i; thread_max_j = (thread_max >= curr.H) ? thread_max_j : thread_Id + 1; @@ -371,6 +372,7 @@ sequence_process( thread_max_j = (thread_max >= curr.H) ? thread_max_j : lengthSeqA - thread_Id -1; // begin_B (shorter string) } thread_max = (thread_max >= curr.H) ? thread_max : curr.H; + i++; } __syncthreads(); // why do I need this? commenting it out breaks it From e42f6e6ad1fbca46dec2bce3c8b14b6c6e978ecc Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 24 Jul 2020 10:42:18 -0600 Subject: [PATCH 38/47] Simplify get_new_min_length --- CMakeLists.txt | 1 + include/gpu_bsw/utils.hpp | 2 +- src/utils.cpp | 22 ++++++++-------------- unittest/test_misc.cpp | 10 ++++++++++ 4 files changed, 20 insertions(+), 15 deletions(-) diff --git a/CMakeLists.txt b/CMakeLists.txt index 17dbde3..ee9c874 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -20,6 +20,7 @@ set(sources set(test_sources unittest/test_blockShuffleReduce_with_index.cu unittest/test_main.cpp + unittest/test_misc.cpp unittest/test_page_locked_string.cpp unittest/test_read_fasta.cpp unittest/test_sequence_process.cu diff --git a/include/gpu_bsw/utils.hpp b/include/gpu_bsw/utils.hpp index 72a70eb..1cb6b92 100644 --- a/include/gpu_bsw/utils.hpp +++ b/include/gpu_bsw/utils.hpp @@ -47,5 +47,5 @@ T* DeviceMalloc(const size_t count, const T *const host_data){ } size_t getMaxLength(const std::vector &v); -int get_new_min_length(short* alAend, short* alBend, int blocksLaunched); +int get_new_min_length(const short *const alAend, const short *const alBend, const int blocksLaunched); #endif \ No newline at end of file diff --git a/src/utils.cpp b/src/utils.cpp index 6bb44b6..6ea633b 100644 --- a/src/utils.cpp +++ b/src/utils.cpp @@ -10,18 +10,12 @@ size_t getMaxLength(const std::vector &v){ -int get_new_min_length(short* alAend, short* alBend, int blocksLaunched){ - int newMin = 1000; - int maxA = 0; - int maxB = 0; - for(int i = 0; i < blocksLaunched; i++){ - if(alBend[i] > maxB ){ - maxB = alBend[i]; - } - if(alAend[i] > maxA){ - maxA = alAend[i]; - } - } - newMin = (maxB > maxA)? maxA : maxB; - return newMin; +int get_new_min_length(const short *const alAend, const short *const alBend, const int blocksLaunched){ + short maxA = 0; + short maxB = 0; + for(int i = 0; i < blocksLaunched; i++){ + maxA = std::max(maxA, alAend[i]); + maxB = std::max(maxB, alBend[i]); + } + return std::min(maxA, maxB); } \ No newline at end of file diff --git a/unittest/test_misc.cpp b/unittest/test_misc.cpp index 9048a1c..7aa6139 100644 --- a/unittest/test_misc.cpp +++ b/unittest/test_misc.cpp @@ -1,6 +1,9 @@ #include "doctest.h" #include +#include + +#include TEST_CASE("swap"){ int a = 3; @@ -8,4 +11,11 @@ TEST_CASE("swap"){ gpu_bsw::swap(a,b); CHECK(a==5); CHECK(b==3); +} + +TEST_CASE("get_new_min_length"){ + const std::vector a = {{-29319, 5258, -8504, -29051, 21807, 10263, 9175, -5258, 30639, -29876}}; + const std::vector b = {{29449, -13061, -8505, -8933, -8052, 19742, -20964, -15165, 29682, -16370}}; + + CHECK(get_new_min_length(a.data(), b.data(), a.size())==29682); } \ No newline at end of file From f92bd386654e4bc1c1ea2aa5325aa7ea0352e060 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Fri, 24 Jul 2020 19:15:27 -0600 Subject: [PATCH 39/47] Add reordering --- CMakeLists.txt | 1 + evaluation/main.cpp | 6 +- include/gpu_bsw/read_fasta.hpp | 27 +++++- include/gpu_bsw/reordering.hpp | 148 +++++++++++++++++++++++++++++++++ src/read_fasta.cpp | 35 +++++++- unittest/test_read_fasta.cpp | 63 ++++++++++++++ unittest/test_reordering.cpp | 34 ++++++++ 7 files changed, 311 insertions(+), 3 deletions(-) create mode 100644 include/gpu_bsw/reordering.hpp create mode 100644 unittest/test_reordering.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index ee9c874..13bbf70 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -23,6 +23,7 @@ set(test_sources unittest/test_misc.cpp unittest/test_page_locked_string.cpp unittest/test_read_fasta.cpp + unittest/test_reordering.cpp unittest/test_sequence_process.cu unittest/test_timer.cpp unittest/test_warpReduceMax_with_index.cu diff --git a/evaluation/main.cpp b/evaluation/main.cpp index 6930b0b..2814555 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -86,7 +86,9 @@ int main(int argc, char* argv[]){ const std::string queFile = argv[3]; const std::string out_file = argv[4]; - const auto input_data = ReadFastaQueryTargetPair(refFile, queFile); + auto input_data = ReadFastaQueryTargetPair(refFile, queFile); + + SortUnsortFastaPair sufp(input_data); Timer timer_calc; timer_calc.start(); @@ -103,6 +105,8 @@ int main(int argc, char* argv[]){ timer_calc.stop(); + sufp.unsort(results.top_scores); + std::ofstream results_file(out_file); for(size_t k = 0; k < input_data.sequence_count(); k++){ results_file< + +#include +#include +#include +#include #include #include + struct FastaInput { std::vector sequences; std::vector headers; @@ -21,4 +28,22 @@ struct FastaPair { FastaInput ReadFasta(const std::string &filename); -FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target); \ No newline at end of file +FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target); + + + +class SortUnsortFastaPair { + public: + SortUnsortFastaPair(FastaPair &fp); + + template + void unsort(T *data) const { + backward_reorder(data, ordering, visited); + } + + void unsort(FastaPair &fp) const; + + private: + std::vector ordering; + mutable std::vector visited; +}; \ No newline at end of file diff --git a/include/gpu_bsw/reordering.hpp b/include/gpu_bsw/reordering.hpp new file mode 100644 index 0000000..35df4b5 --- /dev/null +++ b/include/gpu_bsw/reordering.hpp @@ -0,0 +1,148 @@ +#pragma once + +#include +#include +#include +#include +#include + +///@brief Reorder a vector by moving its elements to indices indicted by another +/// vector. Takes O(N) time and O(N) space. Allocations are amoritzed. +/// +///@param[in,out] values Vector to be reordered +///@param[in] ordering A permutation of the vector +///@param[in,out] visited A black-box vector to be reused between calls and +/// shared with with `backward_reorder()` +template +void forward_reorder( + std::vector &values, + const std::vector &ordering, + std::vector &visited +){ + if(ordering.size()!=values.size()){ + throw std::runtime_error("ordering and values must be the same size!"); + } + + //Size the visited vector appropriately. Since vectors don't shrink, this will + //shortly become large enough to handle most of the inputs. The vector is 1 + //larger than necessary because the first element is special. + if(visited.empty() || visited.size()-1::max()-1) + std::fill(visited.begin(), visited.end(), 0); + + //We increment the stored visited indicator and make a note of the result. Any + //value in the visited vector less than `visited_indicator` has not been + //visited. + const auto visited_indicator = ++visited.at(0); + + //For doing an early exit if we get everything in place + auto remaining = values.size(); + + //For all elements that need to be placed + for(size_t s=0;s0;s++){ + assert(visited[s+1]<=visited_indicator); + + //Ignore already-visited elements + if(visited[s+1]==visited_indicator) + continue; + + //Don't rearrange if we don't have to + if(s==visited[s]) + continue; + + //Follow this cycle, putting elements in their places until we get back + //around. Use move semantics for speed. + auto temp = std::move(values[s]); + auto i = s; + for(;s!=(size_t)ordering[i];i=ordering[i],--remaining){ + std::swap(temp, values[ordering[i]]); + visited[i+1] = visited_indicator; + } + std::swap(temp, values[s]); + visited[i+1] = visited_indicator; + } +} + + + +///@brief Reorder a vector by moving its elements to indices indicted by another +/// vector. Takes O(2N) time and O(2N) space. Allocations are amoritzed. +/// +///@param[in,out] values Vector to be reordered +///@param[in] ordering A permutation of the vector +///@param[in,out] visited A black-box vector to be reused between calls and +/// shared with with `forward_reorder()` +template +void backward_reorder( + ValueType *const values, + const std::vector &ordering, + std::vector &visited +){ + //The orderings form a linked list. We need O(N) memory to reverse a linked + //list. We use `thread_local` so that the function is reentrant. + thread_local std::stack stack; + + //Size the visited vector appropriately. Since vectors don't shrink, this will + //shortly become large enough to handle most of the inputs. The vector is 1 + //larger than necessary because the first element is special. + if(visited.empty() || visited.size()-1::max()-1) + std::fill(visited.begin(), visited.end(), 0); + + //We increment the stored visited indicator and make a note of the result. Any + //value in the visited vector less than `visited_indicator` has not been + //visited. + const auto visited_indicator = ++visited.at(0); + + //For doing an early exit if we get everything in place + auto remaining = ordering.size(); + + //For all elements that need to be placed + for(size_t s=0;s0;s++){ + assert(visited[s+1]<=visited_indicator); + + //Ignore already-visited elements + if(visited[s+1]==visited_indicator) + continue; + + //Don't rearrange if we don't have to + if(s==visited[s]) + continue; + + //The orderings form a linked list. We need to follow that list to its end + //in order to reverse it. + stack.emplace(s); + for(auto i=s;s!=(size_t)ordering[i];i=ordering[i]){ + stack.emplace(ordering[i]); + } + + //Now we follow the linked list in reverse to its beginning, putting + //elements in their places. Use move semantics for speed. + auto temp = std::move(values[s]); + while(!stack.empty()){ + std::swap(temp, values[stack.top()]); + visited[stack.top()+1] = visited_indicator; + stack.pop(); + --remaining; + } + visited[s+1] = visited_indicator; + } +} \ No newline at end of file diff --git a/src/read_fasta.cpp b/src/read_fasta.cpp index 4d5ce1f..b314ca9 100644 --- a/src/read_fasta.cpp +++ b/src/read_fasta.cpp @@ -105,4 +105,37 @@ uint64_t FastaPair::total_cells_1_to_1() const { size_t FastaPair::sequence_count() const { assert(a.sequence_count()==b.sequence_count()); return a.sequence_count(); -} \ No newline at end of file +} + + + +SortUnsortFastaPair::SortUnsortFastaPair(FastaPair &fp){ + //Load the ordering + ordering.reserve(fp.sequence_count()); + for(size_t i=0;i +#include #include +#include +#include +#include #include +template +std::ostream& operator<<(std::ostream &out, std::vector &vec){ + for(const auto &x: vec) + out< value_dist(0,std::numeric_limits::max()); + + auto input_data = ReadFastaQueryTargetPair("../test-data/dna-reference.fasta", "../test-data/dna-query.fasta"); + + const auto original = input_data; + + Timer timer_sort; + timer_sort.start(); + SortUnsortFastaPair sufp(input_data); + timer_sort.stop(); + std::cerr<<"t Sort time = "< value_dist(0,std::numeric_limits::max()); + + auto input_data = ReadFastaQueryTargetPair("../test-data/dna-reference.fasta", "../test-data/dna-query.fasta"); + + const auto original = input_data; + + Timer timer_sort; + timer_sort.start(); + SortUnsortFastaPair sufp(input_data); + timer_sort.stop(); + std::cerr<<"t Sort time = "< + +#include +#include +#include + +TEST_CASE("reorder"){ + std::mt19937 gen; + std::uniform_int_distribution value_dist(0,std::numeric_limits::max()); + std::vector data; + std::vector ordering; + std::vector progress; + + for(int i=0;i<3000;i++){ + const int len = value_dist(gen); + data.clear(); + ordering.clear(); + for(int i=0;i Date: Sat, 1 Aug 2020 14:21:31 -0600 Subject: [PATCH 40/47] Update to use alignment boilerplate library --- .gitmodules | 3 + CMakeLists.txt | 13 +- evaluation/main.cpp | 13 +- include/gpu_bsw/driver.hpp | 45 +++-- include/gpu_bsw/page_locked_string.hpp | 37 ---- include/gpu_bsw/read_fasta.hpp | 49 ----- include/gpu_bsw/reordering.hpp | 148 -------------- include/gpu_bsw/timer.hpp | 45 ----- include/gpu_bsw/utils.hpp | 42 ---- src/alignments.cpp | 28 +-- src/driver.cpp | 56 +++--- src/read_fasta.cpp | 141 -------------- src/utils.cpp | 9 - submodules/alignment_boilerplate | 1 + unittest/test.cu | 259 ++++++++++++++++++------- unittest/test_page_locked_string.cpp | 54 ------ unittest/test_read_fasta.cpp | 91 --------- unittest/test_reordering.cpp | 34 ---- unittest/test_timer.cpp | 14 -- 19 files changed, 272 insertions(+), 810 deletions(-) create mode 100644 .gitmodules delete mode 100644 include/gpu_bsw/page_locked_string.hpp delete mode 100644 include/gpu_bsw/read_fasta.hpp delete mode 100644 include/gpu_bsw/reordering.hpp delete mode 100644 include/gpu_bsw/timer.hpp delete mode 100644 src/read_fasta.cpp create mode 160000 submodules/alignment_boilerplate delete mode 100644 unittest/test_page_locked_string.cpp delete mode 100644 unittest/test_read_fasta.cpp delete mode 100644 unittest/test_reordering.cpp delete mode 100644 unittest/test_timer.cpp diff --git a/.gitmodules b/.gitmodules new file mode 100644 index 0000000..7498551 --- /dev/null +++ b/.gitmodules @@ -0,0 +1,3 @@ +[submodule "submodules/alignment_boilerplate"] + path = submodules/alignment_boilerplate + url = https://github.com/r-barnes/alignment_boilerplate.git diff --git a/CMakeLists.txt b/CMakeLists.txt index 13bbf70..bd6616d 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -10,22 +10,19 @@ set(CMAKE_CUDA_EXTENSIONS OFF CACHE BOOL "") #find_package(timemory REQUIRED COMPONENTS headers cuda cupti compile-options arch) find_package(OpenMP REQUIRED) +add_subdirectory(submodules/alignment_boilerplate EXCLUDE_FROM_ALL) + set(sources src/utils.cpp src/alignments.cpp src/driver.cpp - src/read_fasta.cpp ) set(test_sources unittest/test_blockShuffleReduce_with_index.cu unittest/test_main.cpp unittest/test_misc.cpp - unittest/test_page_locked_string.cpp - unittest/test_read_fasta.cpp - unittest/test_reordering.cpp unittest/test_sequence_process.cu - unittest/test_timer.cpp unittest/test_warpReduceMax_with_index.cu ) @@ -38,7 +35,7 @@ PROPERTIES add_library(gpu_bsw ${sources}) target_include_directories(gpu_bsw PUBLIC include) -target_link_libraries(gpu_bsw PUBLIC OpenMP::OpenMP_CXX) +target_link_libraries(gpu_bsw PUBLIC albp OpenMP::OpenMP_CXX) #target_link_libraries(program_gpu PUBLIC timemory OpenMP::OpenMP_CXX) target_compile_options(gpu_bsw PUBLIC $<$:-gencode=arch=compute_50,code=sm_50> @@ -60,8 +57,8 @@ target_link_libraries(program_gpu PRIVATE gpu_bsw) add_executable(unittest ${test_sources}) target_link_libraries(unittest PRIVATE gpu_bsw) -add_executable(test unittest/test.cu) -target_link_libraries(test PRIVATE gpu_bsw) +# add_executable(test unittest/test.cu) +# target_link_libraries(test PRIVATE gpu_bsw) add_custom_target( diff --git a/evaluation/main.cpp b/evaluation/main.cpp index 2814555..0aa564b 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -1,6 +1,7 @@ #include -#include -#include + +#include +#include #include #include @@ -86,11 +87,9 @@ int main(int argc, char* argv[]){ const std::string queFile = argv[3]; const std::string out_file = argv[4]; - auto input_data = ReadFastaQueryTargetPair(refFile, queFile); - - SortUnsortFastaPair sufp(input_data); + auto input_data = albp::ReadFastaQueryTargetPair(refFile, queFile); - Timer timer_calc; + albp::Timer timer_calc; timer_calc.start(); gpu_bsw_driver::alignment_results results; @@ -105,8 +104,6 @@ int main(int argc, char* argv[]){ timer_calc.stop(); - sufp.unsort(results.top_scores); - std::ofstream results_file(out_file); for(size_t k = 0; k < input_data.sequence_count(); k++){ results_file< #include #include -#include -#include #include +#include +#include +#include +#include + #include #include #include @@ -54,8 +57,8 @@ void kernel_driver( const short openGap, const short extendGap ){ - const auto maxContigSize = getMaxLength(contigs); - const auto maxReadSize = getMaxLength(reads); + const auto maxContigSize = albp::get_max_length(contigs); + const auto maxReadSize = albp::get_max_length(reads); unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length //This matrix is used only by the RNA kernel @@ -83,7 +86,7 @@ void kernel_driver( int its = (max_per_device>20000)?(ceil((float)max_per_device/20000)):1; initialize_alignments(alignments, totalAlignments); // pinned memory allocation - Timer timer_total; + albp::Timer timer_total; timer_total.start(); #pragma omp parallel @@ -92,7 +95,7 @@ void kernel_driver( cudaSetDevice(my_cpu_id); int myGPUid; cudaGetDevice(&myGPUid); - Timer timer_cpu; + albp::Timer timer_cpu; std::array streams_cuda; for(auto &stream: streams_cuda){ @@ -112,9 +115,9 @@ void kernel_driver( short *d_encoding_matrix; if(DT==DataType::RNA){ - d_encoding_matrix = DeviceMalloc(ENCOD_MAT_SIZE, encoding_matrix); + d_encoding_matrix = albp::DeviceMalloc(ENCOD_MAT_SIZE, encoding_matrix); } - d_scoring_matrix = DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); + d_scoring_matrix = albp::DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); short* alAbeg = alignments->ref_begin + my_cpu_id * alignmentsPerDevice; short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; @@ -122,16 +125,16 @@ void kernel_driver( short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - unsigned *const offsetA_h = PageLockedMalloc(stringsPerIt + leftOvers); - unsigned *const offsetB_h = PageLockedMalloc(stringsPerIt + leftOvers); + unsigned *const offsetA_h = albp::PageLockedMalloc(stringsPerIt + leftOvers); + unsigned *const offsetB_h = albp::PageLockedMalloc(stringsPerIt + leftOvers); - char *const strA_d = DeviceMalloc(maxContigSize * (stringsPerIt + leftOvers)); - char *const strB_d = DeviceMalloc(maxReadSize * (stringsPerIt + leftOvers)); + char *const strA_d = albp::DeviceMalloc(maxContigSize * (stringsPerIt + leftOvers)); + char *const strB_d = albp::DeviceMalloc(maxReadSize * (stringsPerIt + leftOvers)); - auto strA = PageLockedString(maxContigSize * (stringsPerIt + leftOvers)); - auto strB = PageLockedString(maxReadSize * (stringsPerIt + leftOvers)); + auto strA = albp::PageLockedString(maxContigSize * (stringsPerIt + leftOvers)); + auto strB = albp::PageLockedString(maxReadSize * (stringsPerIt + leftOvers)); - Timer timer_packing; + albp::Timer timer_packing; std::cout<<"loop begin\n"; for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) @@ -208,13 +211,13 @@ void kernel_driver( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); gpu_bsw::sequence_process<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); // copyin back end index so that we can find new min asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); @@ -229,13 +232,13 @@ void kernel_driver( gpu_bsw::sequence_process<<>>( strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); gpu_bsw::sequence_process<<>>( strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - cudaErrchk(cudaGetLastError()); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); @@ -247,8 +250,8 @@ void kernel_driver( } // for iterations end here - cudaErrchk(cudaFree(strA_d)); - cudaErrchk(cudaFree(strB_d)); + ALBP_CUDA_ERROR_CHECK(cudaFree(strA_d)); + ALBP_CUDA_ERROR_CHECK(cudaFree(strB_d)); cudaFreeHost(offsetA_h); cudaFreeHost(offsetB_h); diff --git a/include/gpu_bsw/page_locked_string.hpp b/include/gpu_bsw/page_locked_string.hpp deleted file mode 100644 index 66f0a7c..0000000 --- a/include/gpu_bsw/page_locked_string.hpp +++ /dev/null @@ -1,37 +0,0 @@ -#pragma once - -#include - -#include "utils.hpp" - -class PageLockedString { - public: - PageLockedString(size_t capacity) : _str(PageLockedMalloc(capacity)), _capacity(capacity) {} - - ~PageLockedString(){ - if(_str) - cudaErrchk(cudaFreeHost(_str)); - } - - PageLockedString& operator+=(const std::string &o){ - if(_size+o.size()>_capacity) - throw std::runtime_error("Appending to the PageLockedString would go above its capacity!"); - memcpy(&_str[_size], o.c_str(), o.size()); - _size += o.size(); - return *this; - } - - char* data() const { return _str; } - size_t size() const { return _size; } - size_t size_left()const { return _capacity-_size; } - bool empty() const { return _size==0; } - bool full() const { return _size==_capacity; } - std::string str() const { return std::string(_str, _str+_size); } - size_t capacity() const { return _capacity; } - void clear() { _size=0; } - - private: - char *const _str = nullptr; - const size_t _capacity = 0; - size_t _size = 0; -}; \ No newline at end of file diff --git a/include/gpu_bsw/read_fasta.hpp b/include/gpu_bsw/read_fasta.hpp deleted file mode 100644 index 45dac5a..0000000 --- a/include/gpu_bsw/read_fasta.hpp +++ /dev/null @@ -1,49 +0,0 @@ -#pragma once - -#include - -#include -#include -#include -#include -#include -#include - - -struct FastaInput { - std::vector sequences; - std::vector headers; - std::vector modifiers; - size_t maximum_sequence_length = 0; - size_t total_sequence_bytes = 0; - size_t sequence_count() const; -}; - -struct FastaPair { - FastaInput a; - FastaInput b; - uint64_t total_cells_1_to_1() const; - size_t sequence_count() const; -}; - -FastaInput ReadFasta(const std::string &filename); - -FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target); - - - -class SortUnsortFastaPair { - public: - SortUnsortFastaPair(FastaPair &fp); - - template - void unsort(T *data) const { - backward_reorder(data, ordering, visited); - } - - void unsort(FastaPair &fp) const; - - private: - std::vector ordering; - mutable std::vector visited; -}; \ No newline at end of file diff --git a/include/gpu_bsw/reordering.hpp b/include/gpu_bsw/reordering.hpp deleted file mode 100644 index 35df4b5..0000000 --- a/include/gpu_bsw/reordering.hpp +++ /dev/null @@ -1,148 +0,0 @@ -#pragma once - -#include -#include -#include -#include -#include - -///@brief Reorder a vector by moving its elements to indices indicted by another -/// vector. Takes O(N) time and O(N) space. Allocations are amoritzed. -/// -///@param[in,out] values Vector to be reordered -///@param[in] ordering A permutation of the vector -///@param[in,out] visited A black-box vector to be reused between calls and -/// shared with with `backward_reorder()` -template -void forward_reorder( - std::vector &values, - const std::vector &ordering, - std::vector &visited -){ - if(ordering.size()!=values.size()){ - throw std::runtime_error("ordering and values must be the same size!"); - } - - //Size the visited vector appropriately. Since vectors don't shrink, this will - //shortly become large enough to handle most of the inputs. The vector is 1 - //larger than necessary because the first element is special. - if(visited.empty() || visited.size()-1::max()-1) - std::fill(visited.begin(), visited.end(), 0); - - //We increment the stored visited indicator and make a note of the result. Any - //value in the visited vector less than `visited_indicator` has not been - //visited. - const auto visited_indicator = ++visited.at(0); - - //For doing an early exit if we get everything in place - auto remaining = values.size(); - - //For all elements that need to be placed - for(size_t s=0;s0;s++){ - assert(visited[s+1]<=visited_indicator); - - //Ignore already-visited elements - if(visited[s+1]==visited_indicator) - continue; - - //Don't rearrange if we don't have to - if(s==visited[s]) - continue; - - //Follow this cycle, putting elements in their places until we get back - //around. Use move semantics for speed. - auto temp = std::move(values[s]); - auto i = s; - for(;s!=(size_t)ordering[i];i=ordering[i],--remaining){ - std::swap(temp, values[ordering[i]]); - visited[i+1] = visited_indicator; - } - std::swap(temp, values[s]); - visited[i+1] = visited_indicator; - } -} - - - -///@brief Reorder a vector by moving its elements to indices indicted by another -/// vector. Takes O(2N) time and O(2N) space. Allocations are amoritzed. -/// -///@param[in,out] values Vector to be reordered -///@param[in] ordering A permutation of the vector -///@param[in,out] visited A black-box vector to be reused between calls and -/// shared with with `forward_reorder()` -template -void backward_reorder( - ValueType *const values, - const std::vector &ordering, - std::vector &visited -){ - //The orderings form a linked list. We need O(N) memory to reverse a linked - //list. We use `thread_local` so that the function is reentrant. - thread_local std::stack stack; - - //Size the visited vector appropriately. Since vectors don't shrink, this will - //shortly become large enough to handle most of the inputs. The vector is 1 - //larger than necessary because the first element is special. - if(visited.empty() || visited.size()-1::max()-1) - std::fill(visited.begin(), visited.end(), 0); - - //We increment the stored visited indicator and make a note of the result. Any - //value in the visited vector less than `visited_indicator` has not been - //visited. - const auto visited_indicator = ++visited.at(0); - - //For doing an early exit if we get everything in place - auto remaining = ordering.size(); - - //For all elements that need to be placed - for(size_t s=0;s0;s++){ - assert(visited[s+1]<=visited_indicator); - - //Ignore already-visited elements - if(visited[s+1]==visited_indicator) - continue; - - //Don't rearrange if we don't have to - if(s==visited[s]) - continue; - - //The orderings form a linked list. We need to follow that list to its end - //in order to reverse it. - stack.emplace(s); - for(auto i=s;s!=(size_t)ordering[i];i=ordering[i]){ - stack.emplace(ordering[i]); - } - - //Now we follow the linked list in reverse to its beginning, putting - //elements in their places. Use move semantics for speed. - auto temp = std::move(values[s]); - while(!stack.empty()){ - std::swap(temp, values[stack.top()]); - visited[stack.top()+1] = visited_indicator; - stack.pop(); - --remaining; - } - visited[s+1] = visited_indicator; - } -} \ No newline at end of file diff --git a/include/gpu_bsw/timer.hpp b/include/gpu_bsw/timer.hpp deleted file mode 100644 index 60b2e8c..0000000 --- a/include/gpu_bsw/timer.hpp +++ /dev/null @@ -1,45 +0,0 @@ -#pragma once - -#include -#include -#include -#include - -class Timer { - public: - Timer() = default; - Timer(const std::string &name) : name(name) {} - - void clear() {elapsed_time = std::chrono::microseconds(0);} - void start() { - if(started) - throw std::runtime_error("Timer was not stopped!"); - - start_time = std::chrono::high_resolution_clock::now(); - started = true; - } - void restart() { clear(); start(); } - - void stop() { - if(!started) - throw std::runtime_error("Timer was not started!"); - - const auto this_duration = std::chrono::high_resolution_clock::now() - start_time; - elapsed_time += std::chrono::duration_cast(this_duration); - started = false; - } - - void print() const { - std::cout << name << " = " << elapsed_time.count() << " msec" << std::endl; - } - - double getTime() const { return elapsed_time.count();} - - double getSeconds() const { return elapsed_time.count()/(1e6); } - - private: - std::chrono::time_point start_time; - const std::string name; - std::chrono::microseconds elapsed_time = std::chrono::microseconds(0); - bool started = false; -}; diff --git a/include/gpu_bsw/utils.hpp b/include/gpu_bsw/utils.hpp index 1cb6b92..f7ac352 100644 --- a/include/gpu_bsw/utils.hpp +++ b/include/gpu_bsw/utils.hpp @@ -5,47 +5,5 @@ #include #include -#define cudaErrchk(ans) \ - { \ - gpuAssert((ans), __FILE__, __LINE__); \ - } -inline void - -gpuAssert(cudaError_t code, const char* file, int line, bool abort = true) -{ - if(code != cudaSuccess) - { - fprintf(stderr, "GPUassert: %s %s %d cpu:%d\n", cudaGetErrorString(code), file, line,omp_get_thread_num()); - if(abort) - exit(code); - } -} - -//Allocate `count` items in page-locked memory -template -T* PageLockedMalloc(const size_t count){ - T *temp; - cudaErrchk(cudaMallocHost(&temp, count*sizeof(T))); - return temp; -} - -//Allocate `count` items on device memory -template -T* DeviceMalloc(const size_t count){ - T *temp; - cudaErrchk(cudaMalloc(&temp, count*sizeof(T))); - return temp; -} - -//Allocate `count` items on device memory -template -T* DeviceMalloc(const size_t count, const T *const host_data){ - T *temp; - cudaErrchk(cudaMalloc(&temp, count*sizeof(T))); - cudaErrchk(cudaMemcpy(temp, host_data, count*sizeof(T), cudaMemcpyHostToDevice)); - return temp; -} - -size_t getMaxLength(const std::vector &v); int get_new_min_length(const short *const alAend, const short *const alBend, const int blocksLaunched); #endif \ No newline at end of file diff --git a/src/alignments.cpp b/src/alignments.cpp index 0e05ee2..42d6b15 100644 --- a/src/alignments.cpp +++ b/src/alignments.cpp @@ -1,21 +1,23 @@ #include #include +#include + gpu_alignments::gpu_alignments(int max_alignments){ - offset_query_gpu = DeviceMalloc(max_alignments); - offset_ref_gpu = DeviceMalloc(max_alignments); - ref_start_gpu = DeviceMalloc(max_alignments); - ref_end_gpu = DeviceMalloc(max_alignments); - query_end_gpu = DeviceMalloc(max_alignments); - query_start_gpu = DeviceMalloc(max_alignments); - scores_gpu = DeviceMalloc(max_alignments); + offset_query_gpu = albp::DeviceMalloc(max_alignments); + offset_ref_gpu = albp::DeviceMalloc(max_alignments); + ref_start_gpu = albp::DeviceMalloc(max_alignments); + ref_end_gpu = albp::DeviceMalloc(max_alignments); + query_end_gpu = albp::DeviceMalloc(max_alignments); + query_start_gpu = albp::DeviceMalloc(max_alignments); + scores_gpu = albp::DeviceMalloc(max_alignments); } gpu_alignments::~gpu_alignments(){ - cudaErrchk(cudaFree(offset_ref_gpu)); - cudaErrchk(cudaFree(offset_query_gpu)); - cudaErrchk(cudaFree(ref_start_gpu)); - cudaErrchk(cudaFree(ref_end_gpu)); - cudaErrchk(cudaFree(query_start_gpu)); - cudaErrchk(cudaFree(query_end_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(offset_ref_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(offset_query_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(ref_start_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(ref_end_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(query_start_gpu)); + ALBP_CUDA_ERROR_CHECK(cudaFree(query_end_gpu)); } \ No newline at end of file diff --git a/src/driver.cpp b/src/driver.cpp index 1eeaa5b..b2df908 100644 --- a/src/driver.cpp +++ b/src/driver.cpp @@ -1,72 +1,72 @@ #include void initialize_alignments(gpu_bsw_driver::alignment_results *alignments, int max_alignments){ - alignments->ref_begin = PageLockedMalloc(max_alignments); - alignments->ref_end = PageLockedMalloc(max_alignments); - alignments->query_begin = PageLockedMalloc(max_alignments); - alignments->query_end = PageLockedMalloc(max_alignments); - alignments->top_scores = PageLockedMalloc(max_alignments); + alignments->ref_begin = albp::PageLockedMalloc(max_alignments); + alignments->ref_end = albp::PageLockedMalloc(max_alignments); + alignments->query_begin = albp::PageLockedMalloc(max_alignments); + alignments->query_end = albp::PageLockedMalloc(max_alignments); + alignments->top_scores = albp::PageLockedMalloc(max_alignments); } void free_alignments(gpu_bsw_driver::alignment_results *alignments){ - cudaErrchk(cudaFreeHost(alignments->ref_begin)); - cudaErrchk(cudaFreeHost(alignments->ref_end)); - cudaErrchk(cudaFreeHost(alignments->query_begin)); - cudaErrchk(cudaFreeHost(alignments->query_end)); - cudaErrchk(cudaFreeHost(alignments->top_scores)); + ALBP_CUDA_ERROR_CHECK(cudaFreeHost(alignments->ref_begin)); + ALBP_CUDA_ERROR_CHECK(cudaFreeHost(alignments->ref_end)); + ALBP_CUDA_ERROR_CHECK(cudaFreeHost(alignments->query_begin)); + ALBP_CUDA_ERROR_CHECK(cudaFreeHost(alignments->query_end)); + ALBP_CUDA_ERROR_CHECK(cudaFreeHost(alignments->top_scores)); } void asynch_mem_copies_htd(gpu_alignments* gpu_data, unsigned* offsetA_h, unsigned* offsetB_h, char* strA, char* strA_d, char* strB, char* strB_d, unsigned half_length_A, unsigned half_length_B, unsigned totalLengthA, unsigned totalLengthB, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu, offsetA_h, (sequences_per_stream) * sizeof(int), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(gpu_data->offset_ref_gpu, offsetA_h, (sequences_per_stream) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_ref_gpu + sequences_per_stream, offsetA_h + sequences_per_stream, + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(gpu_data->offset_ref_gpu + sequences_per_stream, offsetA_h + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu, offsetB_h, (sequences_per_stream) * sizeof(int), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(gpu_data->offset_query_gpu, offsetB_h, (sequences_per_stream) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(gpu_data->offset_query_gpu + sequences_per_stream, offsetB_h + sequences_per_stream, + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(gpu_data->offset_query_gpu + sequences_per_stream, offsetB_h + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(int), cudaMemcpyHostToDevice,streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(strA_d, strA, half_length_A * sizeof(char), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(strA_d, strA, half_length_A * sizeof(char), cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(strA_d + half_length_A, strA + half_length_A, (totalLengthA - half_length_A) * sizeof(char), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(strA_d + half_length_A, strA + half_length_A, (totalLengthA - half_length_A) * sizeof(char), cudaMemcpyHostToDevice,streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(strB_d, strB, half_length_B * sizeof(char), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(strB_d, strB, half_length_B * sizeof(char), cudaMemcpyHostToDevice,streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(strB_d + half_length_B, strB + half_length_B, (totalLengthB - half_length_B) * sizeof(char), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(strB_d + half_length_B, strB + half_length_B, (totalLengthB - half_length_B) * sizeof(char), cudaMemcpyHostToDevice,streams_cuda[1])); } void asynch_mem_copies_dth_mid(gpu_alignments* gpu_data, short* alAend, short* alBend, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ - cudaErrchk(cudaMemcpyAsync(alAend, gpu_data->ref_end_gpu, sequences_per_stream * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alAend, gpu_data->ref_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alAend + sequences_per_stream, gpu_data->ref_end_gpu + sequences_per_stream, + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alAend + sequences_per_stream, gpu_data->ref_end_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(alBend, gpu_data->query_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alBend + sequences_per_stream, gpu_data->query_end_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alBend, gpu_data->query_end_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alBend + sequences_per_stream, gpu_data->query_end_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); } void asynch_mem_copies_dth(gpu_alignments* gpu_data, short* alAbeg, short* alBbeg, short* top_scores_cpu, int sequences_per_stream, int sequences_stream_leftover, const std::array &streams_cuda){ - cudaErrchk(cudaMemcpyAsync(alAbeg, gpu_data->ref_start_gpu, sequences_per_stream * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alAbeg, gpu_data->ref_start_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alAbeg + sequences_per_stream, gpu_data->ref_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alAbeg + sequences_per_stream, gpu_data->ref_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(alBbeg, gpu_data->query_start_gpu, sequences_per_stream * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alBbeg, gpu_data->query_start_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(alBbeg + sequences_per_stream, gpu_data->query_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(alBbeg + sequences_per_stream, gpu_data->query_start_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); - cudaErrchk(cudaMemcpyAsync(top_scores_cpu, gpu_data->scores_gpu, sequences_per_stream * sizeof(short), + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(top_scores_cpu, gpu_data->scores_gpu, sequences_per_stream * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[0])); - cudaErrchk(cudaMemcpyAsync(top_scores_cpu + sequences_per_stream, gpu_data->scores_gpu + sequences_per_stream, + ALBP_CUDA_ERROR_CHECK(cudaMemcpyAsync(top_scores_cpu + sequences_per_stream, gpu_data->scores_gpu + sequences_per_stream, (sequences_per_stream + sequences_stream_leftover) * sizeof(short), cudaMemcpyDeviceToHost, streams_cuda[1])); } diff --git a/src/read_fasta.cpp b/src/read_fasta.cpp deleted file mode 100644 index b314ca9..0000000 --- a/src/read_fasta.cpp +++ /dev/null @@ -1,141 +0,0 @@ -#include - -#include -#include -#include -#include -#include -#include -#include - -/* - Reads FASTA files and fills the corresponding buffers. - FASTA files contain sequences that are usually on separate lines. - The file reader detects a '>' then concatenates all the following lines into one sequence, until the next '>' or EOF. - See more about FASTA format : https://en.wikipedia.org/wiki/FASTA_format -*/ -FastaInput ReadFasta(const std::string &filename){ - std::ifstream fin(filename); - if(!fin.good()){ - throw std::runtime_error("Failed to open file '"+filename+"'!"); - } - - FastaInput fasta; - - bool reading_sequence = false; //Whether we are presently reading a sequence - - const std::string line_starts = ">' translates to 0b00 (0) = Forward, natural - * - '<' translates to 0b01 (1) = Reverse, natural - * - '/' translates to 0b10 (2) = Forward, complemented - * - '+' translates to 0b11 (3) = Reverse, complemented - * No protection is done, so any other number will only have its two first bytes counted as above. - */ - - //Load sequences from the files - std::string input_line; - while (std::getline(fin, input_line)){ - //Skip empty lines - if(input_line.empty()) - continue; - //Skip lines entirely made of whitespace - if(std::all_of(input_line.begin(), input_line.end(), [](const auto &x) {return std::isspace(x);})) - continue; - - //Determine if the line starts with a special character - const auto q = std::find(line_starts.begin(), line_starts.end(), input_line.front()); - - if(q!=line_starts.end()){ //Line begins with a special character. It's the start of a new sequence! - fasta.modifiers.push_back(*q); //Make a note of which special modifying character was used - fasta.headers.push_back(input_line.substr(1)); //Copy the header text, dropping the start/mod character - - if (reading_sequence) { - // a sequence was already being read. Now it's done, so we should find its length. - fasta.total_sequence_bytes += fasta.sequences.back().length(); - fasta.maximum_sequence_length = std::max(fasta.sequences.back().length(), fasta.maximum_sequence_length); - } - reading_sequence = false; - - } else if (!reading_sequence) { - //If we're here then the line didn't begin with a special character and - //we're not currently appending to a sequence, so we start a new sequence. - fasta.sequences.push_back(input_line); - reading_sequence = true; - } else if (reading_sequence) { - fasta.sequences.back() += input_line; - } - } - - //We've reached the end of the file, so we need one last update of the sequence lengths - fasta.total_sequence_bytes += fasta.sequences.back().length(); - fasta.maximum_sequence_length = std::max(fasta.sequences.back().length(), fasta.maximum_sequence_length); - - return fasta; -} - - - -FastaPair ReadFastaQueryTargetPair(const std::string &query, const std::string &target){ - FastaPair ret; - ret.a = ReadFasta(query); - ret.b = ReadFasta(target); - - if(ret.a.sequences.size()!=ret.b.sequences.size()) - throw std::runtime_error("Query and Target files were not the same length!"); - - return ret; -} - - -size_t FastaInput::sequence_count() const { - return sequences.size(); -} - -uint64_t FastaPair::total_cells_1_to_1() const { - uint64_t count = 0; - for(size_t i=0;i #include -size_t getMaxLength(const std::vector &v){ - const auto maxi = std::max_element(v.begin(), v.end(), - [](const auto &a, const auto &b) { return a.size()size(); -} - - - int get_new_min_length(const short *const alAend, const short *const alBend, const int blocksLaunched){ short maxA = 0; short maxB = 0; diff --git a/submodules/alignment_boilerplate b/submodules/alignment_boilerplate new file mode 160000 index 0000000..a01ef22 --- /dev/null +++ b/submodules/alignment_boilerplate @@ -0,0 +1 @@ +Subproject commit a01ef2218dae1b10550ddd3d35c85497ef7a5b43 diff --git a/unittest/test.cu b/unittest/test.cu index 0002048..1e38c5a 100644 --- a/unittest/test.cu +++ b/unittest/test.cu @@ -3,6 +3,8 @@ #include +#include +#include #include #include #include @@ -34,72 +36,193 @@ std::ostream& operator<<(std::ostream &out, thrust::device_vector &vec){ +int SimpleSmithWaterman( + const std::string &seqa, + const std::string &seqb, + const int gap_open, + const int gap_extend, + const int match_score, + const int mismatch_score +){ + const auto size = seqa.size()*seqb.size(); + std::vector E(size,0); + std::vector F(size,0); + std::vector H(size,0); + const auto width = seqb.size(); + + const auto c2d = [&](const size_t i, const size_t j){ return i*width+j; }; + const auto mm = [&](const char a, const char b){ return (a==b)?match_score:mismatch_score; }; + + for(size_t i=0;i0) ? E[c2d(i,j-1)] + gap_extend : 0, + (j>0) ? H[c2d(i,j-1)] + gap_open : 0 + ); + + F[c2d(i,j)] = std::max( + (i>0) ? F[c2d(i-1,j)] + gap_extend : 0, + (i>0) ? H[c2d(i-1,j)] + gap_open : 0 + ); + + H[c2d(i,j)] = std::max( + std::max(0, E[c2d(i,j)]), + std::max( + -1000, //F[c2d(i,j)], + (i>0 && j>0) ? H[c2d(i-1,j-1)]+mm(seqa[i], seqb[j]) : 0 + ) + ); + } + + std::cout<<"F:\n"; + for(size_t i=0;iH[c2d(i,j)]+gap_open) + std::cout<<"\033[91m"; + std::cout< E(size,0); + std::vector F(size,0); + std::vector H(size,0); + const auto width = seqb.size(); + + const auto c2d = [&](const size_t i, const size_t j){ return i*width+j; }; + const auto mm = [&](const char a, const char b){ return (a==b)?match_score:mismatch_score; }; + + for(size_t i=0;i0) ? E[c2d(i,j-1)] + gap_extend : 0, + (j>0) ? H[c2d(i,j-1)] + gap_open : 0 + ); + + F[c2d(i,j)] = std::max( + (i>0) ? F[c2d(i-1,j)] + gap_extend : 0, + (i>0) ? H[c2d(i-1,j)] + gap_open : 0 + ); + + H[c2d(i,j)] = std::max( + std::max(0, E[c2d(i,j)]), + std::max( + -1000, //F[c2d(i,j)], + (i>0 && j>0) ? H[c2d(i-1,j-1)]+mm(seqa[i], seqb[j]) : 0 + ) + ); + } + + std::cout<<"F:\n"; + for(size_t i=0;iH[c2d(i,j)]+gap_open) + std::cout<<"\033[91m"; + std::cout< seqA_array; - seqA_array = randomDNA( alen); - thrust::device_vector seqB_array; - seqB_array = randomDNA(blen); - thrust::device_vector prefix_lengthA(1); - thrust::device_vector prefix_lengthB(1); - - prefix_lengthA[0] = alen; - prefix_lengthB[0] = blen; - - thrust::device_vector seqA_align_begin(1); - thrust::device_vector seqA_align_end(1); - thrust::device_vector seqB_align_begin(1); - thrust::device_vector seqB_align_end(1); - - thrust::device_vector top_scores(1); - - thrust::device_vector scoring_matrix(2); - thrust::device_vector encoding_matrix(1); - - scoring_matrix[0] = 1; - scoring_matrix[1] = -4; - - encoding_matrix[0] = 0; - - const short startGap = 6; - const short extendGap = 1; - - // unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; - const unsigned minSize = alen; - const unsigned totShmem = 3 * (minSize + 1) * sizeof(short); - const unsigned alignmentPad = 4 + (4 - totShmem % 4); - const size_t ShmemBytes = totShmem + alignmentPad; - // if(ShmemBytes > 48000 && DT==DataType::DNA) - // cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - cudaErrchk(cudaDeviceSynchronize()); - - sequence_process<<<1, minSize, ShmemBytes>>>( - thrust::raw_pointer_cast(seqA_array.data()), - thrust::raw_pointer_cast(seqB_array.data()), - thrust::raw_pointer_cast(prefix_lengthA.data()), - thrust::raw_pointer_cast(prefix_lengthB.data()), - thrust::raw_pointer_cast(seqA_align_begin.data()), - thrust::raw_pointer_cast(seqA_align_end.data()), - thrust::raw_pointer_cast(seqB_align_begin.data()), - thrust::raw_pointer_cast(seqB_align_end.data()), - thrust::raw_pointer_cast(top_scores.data()), - startGap, - extendGap, - thrust::raw_pointer_cast(scoring_matrix.data()), - thrust::raw_pointer_cast(encoding_matrix.data()) - ); - cudaErrchk(cudaGetLastError()); - - cudaErrchk(cudaDeviceSynchronize()); - - std::cout<<"seqA = "< seqA_array; +// seqA_array = randomDNA( alen); +// thrust::device_vector seqB_array; +// seqB_array = randomDNA(blen); +// thrust::device_vector prefix_lengthA(1); +// thrust::device_vector prefix_lengthB(1); + +// prefix_lengthA[0] = alen; +// prefix_lengthB[0] = blen; + +// thrust::device_vector seqA_align_begin(1); +// thrust::device_vector seqA_align_end(1); +// thrust::device_vector seqB_align_begin(1); +// thrust::device_vector seqB_align_end(1); + +// thrust::device_vector top_scores(1); + +// thrust::device_vector scoring_matrix(2); +// thrust::device_vector encoding_matrix(1); + +// scoring_matrix[0] = 1; +// scoring_matrix[1] = -4; + +// encoding_matrix[0] = 0; + +// const short startGap = 6; +// const short extendGap = 1; + +// // unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; +// const unsigned minSize = alen; +// const unsigned totShmem = 3 * (minSize + 1) * sizeof(short); +// const unsigned alignmentPad = 4 + (4 - totShmem % 4); +// const size_t ShmemBytes = totShmem + alignmentPad; +// // if(ShmemBytes > 48000 && DT==DataType::DNA) +// // cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + +// cudaErrchk(cudaDeviceSynchronize()); + +// sequence_process<<<1, minSize, ShmemBytes>>>( +// thrust::raw_pointer_cast(seqA_array.data()), +// thrust::raw_pointer_cast(seqB_array.data()), +// thrust::raw_pointer_cast(prefix_lengthA.data()), +// thrust::raw_pointer_cast(prefix_lengthB.data()), +// thrust::raw_pointer_cast(seqA_align_begin.data()), +// thrust::raw_pointer_cast(seqA_align_end.data()), +// thrust::raw_pointer_cast(seqB_align_begin.data()), +// thrust::raw_pointer_cast(seqB_align_end.data()), +// thrust::raw_pointer_cast(top_scores.data()), +// startGap, +// extendGap, +// thrust::raw_pointer_cast(scoring_matrix.data()), +// thrust::raw_pointer_cast(encoding_matrix.data()) +// ); +// cudaErrchk(cudaGetLastError()); + +// cudaErrchk(cudaDeviceSynchronize()); + +// std::cout<<"seqA = "< - -#include - -TEST_CASE("PageLockedString"){ - PageLockedString pls(20); - CHECK(pls.capacity()==20); - CHECK(pls.empty()); - CHECK(!pls.full()); - CHECK(pls.size()==0); - CHECK(pls.size_left()==20); - CHECK(pls.str()==""); - - pls += "testing"; - CHECK(pls.capacity()==20); - CHECK(!pls.empty()); - CHECK(!pls.full()); - CHECK(pls.size()==7); - CHECK(pls.size_left()==13); - CHECK(pls.str()=="testing"); - - pls += "andagain"; - CHECK(pls.capacity()==20); - CHECK(!pls.empty()); - CHECK(!pls.full()); - CHECK(pls.size()==15); - CHECK(pls.size_left()==5); - CHECK(pls.str()=="testingandagain"); - - CHECK_THROWS_AS(pls += "toolong", std::runtime_error); - CHECK(pls.capacity()==20); - CHECK(!pls.empty()); - CHECK(!pls.full()); - CHECK(pls.size()==15); - CHECK(pls.size_left()==5); - CHECK(pls.str()=="testingandagain"); - - pls += "done."; - CHECK(pls.capacity()==20); - CHECK(!pls.empty()); - CHECK(pls.full()); - CHECK(pls.size()==20); - CHECK(pls.size_left()==0); - CHECK(pls.str()=="testingandagaindone."); - - pls.clear(); - CHECK(pls.capacity()==20); - CHECK(pls.empty()); - CHECK(!pls.full()); - CHECK(pls.size()==0); - CHECK(pls.size_left()==20); - CHECK(pls.str()==""); -} \ No newline at end of file diff --git a/unittest/test_read_fasta.cpp b/unittest/test_read_fasta.cpp deleted file mode 100644 index a53adc8..0000000 --- a/unittest/test_read_fasta.cpp +++ /dev/null @@ -1,91 +0,0 @@ -#include "doctest.h" -#include -#include -#include - -#include -#include -#include -#include - -template -std::ostream& operator<<(std::ostream &out, std::vector &vec){ - for(const auto &x: vec) - out< value_dist(0,std::numeric_limits::max()); - - auto input_data = ReadFastaQueryTargetPair("../test-data/dna-reference.fasta", "../test-data/dna-query.fasta"); - - const auto original = input_data; - - Timer timer_sort; - timer_sort.start(); - SortUnsortFastaPair sufp(input_data); - timer_sort.stop(); - std::cerr<<"t Sort time = "< value_dist(0,std::numeric_limits::max()); - - auto input_data = ReadFastaQueryTargetPair("../test-data/dna-reference.fasta", "../test-data/dna-query.fasta"); - - const auto original = input_data; - - Timer timer_sort; - timer_sort.start(); - SortUnsortFastaPair sufp(input_data); - timer_sort.stop(); - std::cerr<<"t Sort time = "< - -#include -#include -#include - -TEST_CASE("reorder"){ - std::mt19937 gen; - std::uniform_int_distribution value_dist(0,std::numeric_limits::max()); - std::vector data; - std::vector ordering; - std::vector progress; - - for(int i=0;i<3000;i++){ - const int len = value_dist(gen); - data.clear(); - ordering.clear(); - for(int i=0;i - -#include -#include - -TEST_CASE("Timer Start Stop"){ - Timer timer; - timer.start(); - std::this_thread::sleep_for(std::chrono::milliseconds(200)); - timer.stop(); - - CHECK(std::abs(timer.getSeconds()-0.2)<0.01); -} From 246a74136ee18acf844c63af79f909d7983a9d2c Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Sat, 1 Aug 2020 20:33:09 -0600 Subject: [PATCH 41/47] Switch to using albp's stream manager --- CMakeLists.txt | 3 +- evaluation/main.cpp | 8 +- include/gpu_bsw/alignments.hpp | 19 -- include/gpu_bsw/driver.hpp | 394 ++++++++++++++----------------- include/gpu_bsw/kernel.hpp | 28 ++- include/gpu_bsw/utils.hpp | 9 - src/alignments.cpp | 23 -- src/driver.cpp | 81 ++----- src/utils.cpp | 12 - submodules/alignment_boilerplate | 2 +- unittest/test_misc.cpp | 6 +- 11 files changed, 225 insertions(+), 360 deletions(-) delete mode 100644 include/gpu_bsw/alignments.hpp delete mode 100644 include/gpu_bsw/utils.hpp delete mode 100644 src/alignments.cpp delete mode 100644 src/utils.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index bd6616d..b28aa3b 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -13,8 +13,6 @@ find_package(OpenMP REQUIRED) add_subdirectory(submodules/alignment_boilerplate EXCLUDE_FROM_ALL) set(sources - src/utils.cpp - src/alignments.cpp src/driver.cpp ) @@ -44,6 +42,7 @@ target_compile_options(gpu_bsw PUBLIC $<$:-gencode=arch=compute_61,code=sm_61> $<$:-gencode=arch=compute_70,code=sm_70> $<$:-Xcompiler=-Wall,-Wextra> + # $<$:-G> ) get_property(LANGUAGES GLOBAL PROPERTY ENABLED_LANGUAGES) diff --git a/evaluation/main.cpp b/evaluation/main.cpp index 0aa564b..193806d 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -92,11 +92,11 @@ int main(int argc, char* argv[]){ albp::Timer timer_calc; timer_calc.start(); - gpu_bsw_driver::alignment_results results; + AlignmentResults results; if(in_arg == "aa"){ - gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, blosum62.data(), -6, -1); + results = gpu_bsw_driver::kernel_driver(input_data, blosum62.data(), -6, -1); } else if(in_arg == "dna") { - gpu_bsw_driver::kernel_driver(input_data.a.sequences, input_data.b.sequences, &results, match_mismatch_scores.data(), -3, -1); + results = gpu_bsw_driver::kernel_driver(input_data, match_mismatch_scores.data(), -3, -1); } else { std::cerr<<"Data type must be 'aa' or 'dna'!"< 48000 && DT==DataType::DNA) + cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + + assert(minSize>0); + assert(ShmemBytes>0); + gpu_bsw::sequence_process<<>>( + seq_a_gpu.get(), + seq_b_gpu.get(), + starts_a_gpu.get(), + starts_b_gpu.get(), + seq_a_start_gpu.get(), + seq_a_end_gpu.get(), + seq_b_start_gpu.get(), + seq_b_end_gpu.get(), + scores_gpu.get(), + scoring->gap_open, + scoring->gap_extend, + scoring->d_scoring_matrix.get(), + scoring->d_encoding_matrix.get() + ); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); + + copy_to_host_async(alignments.a_end.get(), seq_a_end_gpu.get(), range, stream); + copy_to_host_async(alignments.b_end.get(), seq_b_end_gpu.get(), range, stream); + + ALBP_CUDA_ERROR_CHECK(cudaStreamSynchronize(stream)); + + // Find the new largest of smaller lengths + const auto newMin = get_new_min_length(alignments.a_end.get(), alignments.b_end.get(), range); + + assert(newMin>0); + assert(ShmemBytes>0); + gpu_bsw::sequence_process<<>>( + seq_a_gpu.get(), + seq_b_gpu.get(), + starts_a_gpu.get(), + starts_b_gpu.get(), + seq_a_start_gpu.get(), + seq_a_end_gpu.get(), + seq_b_start_gpu.get(), + seq_b_end_gpu.get(), + scores_gpu.get(), + scoring->gap_open, + scoring->gap_extend, + scoring->d_scoring_matrix.get(), + scoring->d_encoding_matrix.get() + ); + ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); + + copy_to_host_async(alignments.a_begin.get(), seq_a_start_gpu.get(), range, stream); + copy_to_host_async(alignments.a_end.get(), seq_a_end_gpu.get(), range, stream); + copy_to_host_async(alignments.top_scores.get(), scores_gpu.get(), range, stream); + } + + private: + const int device_id; + const cudaStream_t stream; + const std::shared_ptr scoring; + const albp::PageLockedFastaPair &data; + albp::cuda_unique_dptr seq_b_gpu; + albp::cuda_unique_dptr seq_a_gpu; + albp::cuda_unique_dptr starts_b_gpu; + albp::cuda_unique_dptr starts_a_gpu; + albp::cuda_unique_dptr seq_a_start_gpu; + albp::cuda_unique_dptr seq_a_end_gpu; + albp::cuda_unique_dptr seq_b_start_gpu; + albp::cuda_unique_dptr seq_b_end_gpu; + albp::cuda_unique_dptr scores_gpu; + AlignmentResults &alignments; +}; namespace gpu_bsw_driver{ template -void kernel_driver( - const std::vector &reads, - const std::vector &contigs, - gpu_bsw_driver::alignment_results *const alignments, +AlignmentResults kernel_driver( + const albp::FastaPair &input_data, const short scoring_matrix[], const short openGap, const short extendGap ){ - const auto maxContigSize = albp::get_max_length(contigs); - const auto maxReadSize = albp::get_max_length(reads); - unsigned totalAlignments = contigs.size(); // assuming that read and contig vectors are same length + albp::Timer timer_total; + timer_total.start(); + + constexpr size_t chunk_size = 4000; + + // Assuming that read and contig vectors are same length + const auto totalAlignments = input_data.sequence_count(); //This matrix is used only by the RNA kernel constexpr short encoding_matrix[] = {0,0,0,0,0,0,0,0,0,0,0,0,0,0, @@ -70,204 +193,45 @@ void kernel_driver( 13,7,8,9,0,11,10,12,2,0,14,5, 1,15,16,0,19,17,22,18,21}; - int deviceCount; - cudaGetDeviceCount(&deviceCount); - omp_set_num_threads(deviceCount); //one OMP thread per GPU - std::cout<<"Number of available GPUs:"<20000)?(ceil((float)max_per_device/20000)):1; - initialize_alignments(alignments, totalAlignments); // pinned memory allocation + auto pl_fasta = albp::page_lock(input_data); - albp::Timer timer_total; - timer_total.start(); + //We use a list for streams since a vector would move the StreamConsumers + //around on allocation, breaking the pointers in stream_function. + std::list> streams; + std::vector stream_functions; + + for(int device_id=0;device_id streams_cuda; - for(auto &stream: streams_cuda){ - cudaStreamCreate(&stream); - } - - int BLOCKS_l = alignmentsPerDevice; - if(my_cpu_id == deviceCount - 1) - BLOCKS_l += leftOver_device; - if(my_cpu_id == 0)std::cout<<"Number of GPUs being used:"<(ENCOD_MAT_SIZE, encoding_matrix); - } - d_scoring_matrix = albp::DeviceMalloc(SCORE_MAT_SIZE, scoring_matrix); - - short* alAbeg = alignments->ref_begin + my_cpu_id * alignmentsPerDevice; - short* alBbeg = alignments->query_begin + my_cpu_id * alignmentsPerDevice; - short* alAend = alignments->ref_end + my_cpu_id * alignmentsPerDevice; - short* alBend = alignments->query_begin + my_cpu_id * alignmentsPerDevice; // memory on CPU for copying the results - short* top_scores_cpu = alignments->top_scores + my_cpu_id * alignmentsPerDevice; - - unsigned *const offsetA_h = albp::PageLockedMalloc(stringsPerIt + leftOvers); - unsigned *const offsetB_h = albp::PageLockedMalloc(stringsPerIt + leftOvers); - - char *const strA_d = albp::DeviceMalloc(maxContigSize * (stringsPerIt + leftOvers)); - char *const strB_d = albp::DeviceMalloc(maxReadSize * (stringsPerIt + leftOvers)); - - auto strA = albp::PageLockedString(maxContigSize * (stringsPerIt + leftOvers)); - auto strB = albp::PageLockedString(maxReadSize * (stringsPerIt + leftOvers)); - - albp::Timer timer_packing; - - std::cout<<"loop begin\n"; - for(int perGPUIts = 0; perGPUIts < its; perGPUIts++) - { - timer_packing.start(); - size_t blocksLaunched = stringsPerIt; - - // so that each openmp thread has a copy of strings it needs to align - auto beginAVec = contigs.cbegin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - auto endAVec = contigs.cbegin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; - auto beginBVec = reads.cbegin() + alignmentsPerDevice * my_cpu_id + perGPUIts * stringsPerIt; - auto endBVec = reads.cbegin() + alignmentsPerDevice * my_cpu_id + (perGPUIts + 1) * stringsPerIt; - if(perGPUIts == its - 1) - { - blocksLaunched += leftOvers; - endAVec += leftOvers; - endBVec += leftOvers; - } - - std::vector sequencesA(beginAVec, endAVec); - std::vector sequencesB(beginBVec, endBVec); - unsigned running_sum = 0; - const auto sequences_per_stream = (blocksLaunched) / NSTREAMS; - const auto sequences_stream_leftover = (blocksLaunched) % NSTREAMS; - unsigned half_length_A = 0; - unsigned half_length_B = 0; - - timer_cpu.start(); - - for(size_t i = 0; i < sequencesA.size(); i++) - { - running_sum +=sequencesA[i].size(); - offsetA_h[i] = running_sum;//sequencesA[i].size(); - if(i == sequences_per_stream - 1){ - half_length_A = running_sum; - running_sum = 0; - } - } - unsigned totalLengthA = half_length_A + offsetA_h[sequencesA.size() - 1]; - - running_sum = 0; - for(size_t i = 0; i < sequencesB.size(); i++) - { - running_sum +=sequencesB[i].size(); - offsetB_h[i] = running_sum; //sequencesB[i].size(); - if(i == sequences_per_stream - 1){ - half_length_B = running_sum; - running_sum = 0; - } - } - unsigned totalLengthB = half_length_B + offsetB_h[sequencesB.size() - 1]; - - timer_cpu.stop(); - - strA.clear(); - strB.clear(); - for(size_t i = 0; i < sequencesA.size(); i++) - { - strA += sequencesA.at(i); - strB += sequencesB.at(i); - } - - timer_packing.stop(); - - asynch_mem_copies_htd(&gpu_data, offsetA_h, offsetB_h, strA.data(), strA_d, strB.data(), strB_d, half_length_A, half_length_B, totalLengthA, totalLengthB, sequences_per_stream, sequences_stream_leftover, streams_cuda); - unsigned minSize = (maxReadSize < maxContigSize) ? maxReadSize : maxContigSize; - unsigned totShmem = 3 * (minSize + 1) * sizeof(short); - unsigned alignmentPad = 4 + (4 - totShmem % 4); - size_t ShmemBytes = totShmem + alignmentPad; - if(ShmemBytes > 48000 && DT==DataType::DNA) - cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); - - gpu_bsw::sequence_process<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, - openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); - - gpu_bsw::sequence_process<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream, - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); - - // copyin back end index so that we can find new min - asynch_mem_copies_dth_mid(&gpu_data, alAend, alBend, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - cudaStreamSynchronize (streams_cuda[0]); - cudaStreamSynchronize (streams_cuda[1]); - - timer_cpu.start(); - int newMin = get_new_min_length(alAend, alBend, blocksLaunched); // find the new largest of smaller lengths - timer_cpu.stop(); - - gpu_bsw::sequence_process<<>>( - strA_d, strB_d, gpu_data.offset_ref_gpu, gpu_data.offset_query_gpu, gpu_data.ref_start_gpu, - gpu_data.ref_end_gpu, gpu_data.query_start_gpu, gpu_data.query_end_gpu, gpu_data.scores_gpu, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); - - gpu_bsw::sequence_process<<>>( - strA_d + half_length_A, strB_d + half_length_B, gpu_data.offset_ref_gpu + sequences_per_stream, gpu_data.offset_query_gpu + sequences_per_stream , - gpu_data.ref_start_gpu + sequences_per_stream, gpu_data.ref_end_gpu + sequences_per_stream, gpu_data.query_start_gpu + sequences_per_stream, gpu_data.query_end_gpu + sequences_per_stream, - gpu_data.scores_gpu + sequences_per_stream, openGap, extendGap, d_scoring_matrix, d_encoding_matrix); - ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); - - asynch_mem_copies_dth(&gpu_data, alAbeg, alBbeg, top_scores_cpu, sequences_per_stream, sequences_stream_leftover, streams_cuda); - - alAbeg += stringsPerIt; - alBbeg += stringsPerIt; - alAend += stringsPerIt; - alBend += stringsPerIt; - top_scores_cpu += stringsPerIt; - - } // for iterations end here - - ALBP_CUDA_ERROR_CHECK(cudaFree(strA_d)); - ALBP_CUDA_ERROR_CHECK(cudaFree(strB_d)); - cudaFreeHost(offsetA_h); - cudaFreeHost(offsetB_h); - - for(int i = 0; i < NSTREAMS; i++) - cudaStreamDestroy(streams_cuda[i]); - - std::cout <<"CPU time = "< #include -#include + +#include #include @@ -17,5 +19,5 @@ TEST_CASE("get_new_min_length"){ const std::vector a = {{-29319, 5258, -8504, -29051, 21807, 10263, 9175, -5258, 30639, -29876}}; const std::vector b = {{29449, -13061, -8505, -8933, -8052, 19742, -20964, -15165, 29682, -16370}}; - CHECK(get_new_min_length(a.data(), b.data(), a.size())==29682); + CHECK(get_new_min_length(a.data(), b.data(), albp::RangePair(0,a.size()))==29682); } \ No newline at end of file From 3f0cb92de04a7597fcf2f77d5ab87c0753fd1194 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Mon, 3 Aug 2020 13:18:39 -0600 Subject: [PATCH 42/47] Remove progress indicators and adjust chunk size --- include/gpu_bsw/driver.hpp | 4 +--- 1 file changed, 1 insertion(+), 3 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 9ac65e5..4cdaa27 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -76,8 +76,6 @@ class StreamConsumer { void operator()(const albp::RangePair range){ ALBP_CUDA_ERROR_CHECK(cudaSetDevice(device_id)); - std::cerr<<"Processing range "< Date: Mon, 3 Aug 2020 13:25:23 -0600 Subject: [PATCH 43/47] Merge forward and backward kernel calls to reduce host synchronization costs. Drop get_new_min_length() --- include/gpu_bsw/driver.hpp | 31 ++----------------------------- include/gpu_bsw/kernel.hpp | 25 ++++++++++++++++++++++++- src/driver.cpp | 16 ---------------- unittest/test_misc.cpp | 7 ------- 4 files changed, 26 insertions(+), 53 deletions(-) diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 4cdaa27..4a4d041 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -93,38 +93,11 @@ class StreamConsumer { const auto alignmentPad = 4 + (4 - totShmem % 4); const auto ShmemBytes = totShmem + alignmentPad; if(ShmemBytes > 48000 && DT==DataType::DNA) - cudaFuncSetAttribute(gpu_bsw::sequence_process, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); + cudaFuncSetAttribute(gpu_bsw::sequence_process_forward_and_reverse, cudaFuncAttributeMaxDynamicSharedMemorySize, ShmemBytes); assert(minSize>0); assert(ShmemBytes>0); - gpu_bsw::sequence_process<<>>( - seq_a_gpu.get(), - seq_b_gpu.get(), - starts_a_gpu.get(), - starts_b_gpu.get(), - seq_a_start_gpu.get(), - seq_a_end_gpu.get(), - seq_b_start_gpu.get(), - seq_b_end_gpu.get(), - scores_gpu.get(), - scoring->gap_open, - scoring->gap_extend, - scoring->d_scoring_matrix.get(), - scoring->d_encoding_matrix.get() - ); - ALBP_CUDA_ERROR_CHECK(cudaGetLastError()); - - copy_to_host_async(alignments.a_end.get(), seq_a_end_gpu.get(), range, stream); - copy_to_host_async(alignments.b_end.get(), seq_b_end_gpu.get(), range, stream); - - ALBP_CUDA_ERROR_CHECK(cudaStreamSynchronize(stream)); - - // Find the new largest of smaller lengths - const auto newMin = get_new_min_length(alignments.a_end.get(), alignments.b_end.get(), range); - - assert(newMin>0); - assert(ShmemBytes>0); - gpu_bsw::sequence_process<<>>( + gpu_bsw::sequence_process_forward_and_reverse
<<>>( seq_a_gpu.get(), seq_b_gpu.get(), starts_a_gpu.get(), diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 93aba28..5e001d0 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -184,7 +184,7 @@ struct Cell { template -inline __global__ void +inline __device__ void sequence_process( const char *const seqA_array, const char *const seqB_array, @@ -405,5 +405,28 @@ sequence_process( } } + + +template +inline __global__ void +sequence_process_forward_and_reverse( + const char *const seqA_array, + const char *const seqB_array, + const size_t *const startsA, + const size_t *const startsB, + short * seqA_align_begin, + short * seqA_align_end, + short * seqB_align_begin, + short * seqB_align_end, + short *const top_scores, + const short startGap, + const short extendGap, + const short *const scoring_matrix, + const short *const encoding_matrix +){ + sequence_process(seqA_array,seqB_array,startsA,startsB,seqA_align_begin,seqA_align_end,seqB_align_begin,seqB_align_end,top_scores,startGap,extendGap,scoring_matrix,encoding_matrix); + sequence_process(seqA_array,seqB_array,startsA,startsB,seqA_align_begin,seqA_align_end,seqB_align_begin,seqB_align_end,top_scores,startGap,extendGap,scoring_matrix,encoding_matrix); +} + } #endif diff --git a/src/driver.cpp b/src/driver.cpp index 15640dc..fbbd21c 100644 --- a/src/driver.cpp +++ b/src/driver.cpp @@ -1,9 +1,5 @@ #include -#include - -#include - AlignmentResults::AlignmentResults(const size_t size){ a_begin = albp::PageLockedMallocUnique(size); a_end = albp::PageLockedMallocUnique(size); @@ -11,15 +7,3 @@ AlignmentResults::AlignmentResults(const size_t size){ b_end = albp::PageLockedMallocUnique(size); top_scores = albp::PageLockedMallocUnique(size); } - - - -int get_new_min_length(const short *const alAend, const short *const alBend, const albp::RangePair &rp){ - short maxA = 0; - short maxB = 0; - for(auto i = rp.begin; i < rp.end; i++){ - maxA = std::max(maxA, alAend[i]); - maxB = std::max(maxB, alBend[i]); - } - return std::min(maxA, maxB); -} \ No newline at end of file diff --git a/unittest/test_misc.cpp b/unittest/test_misc.cpp index b43e018..57553c4 100644 --- a/unittest/test_misc.cpp +++ b/unittest/test_misc.cpp @@ -13,11 +13,4 @@ TEST_CASE("swap"){ gpu_bsw::swap(a,b); CHECK(a==5); CHECK(b==3); -} - -TEST_CASE("get_new_min_length"){ - const std::vector a = {{-29319, 5258, -8504, -29051, 21807, 10263, 9175, -5258, 30639, -29876}}; - const std::vector b = {{29449, -13061, -8505, -8933, -8052, 19742, -20964, -15165, 29682, -16370}}; - - CHECK(get_new_min_length(a.data(), b.data(), albp::RangePair(0,a.size()))==29682); } \ No newline at end of file From 128f99899f9e8b9fd6f743c35e0145b15cca112d Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Mon, 3 Aug 2020 13:29:58 -0600 Subject: [PATCH 44/47] Drop extraneous headers --- evaluation/main.cpp | 2 -- include/gpu_bsw/driver.hpp | 11 +---------- include/gpu_bsw/kernel.hpp | 4 +--- 3 files changed, 2 insertions(+), 15 deletions(-) diff --git a/evaluation/main.cpp b/evaluation/main.cpp index 193806d..51bf0f8 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -6,9 +6,7 @@ #include #include #include -#include #include -#include constexpr std::array blosum62 = { // A R N D C Q E G H I L K M F P S T W Y V B Z X * diff --git a/include/gpu_bsw/driver.hpp b/include/gpu_bsw/driver.hpp index 4a4d041..10dc780 100644 --- a/include/gpu_bsw/driver.hpp +++ b/include/gpu_bsw/driver.hpp @@ -11,17 +11,8 @@ #include #include -#include -#include -#include - -#include -#include -#include -#include #include #include -#include #include #include @@ -166,7 +157,7 @@ AlignmentResults kernel_driver( int device_count; cudaGetDeviceCount(&device_count); - omp_set_num_threads(device_count); //one OMP thread per GPU + std::cout<<"Number of available GPUs:"< +#include #include -#include -#include -#include #define NUM_OF_AA 21 #define ENCOD_MAT_SIZE 91 From 2f0f98f8303f9a4d2227a700c3769415eba973d2 Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Mon, 3 Aug 2020 13:37:54 -0600 Subject: [PATCH 45/47] Eliminate stream/chunk globals --- evaluation/main.cpp | 7 +++++-- include/gpu_bsw/driver.hpp | 14 +++++--------- 2 files changed, 10 insertions(+), 11 deletions(-) diff --git a/evaluation/main.cpp b/evaluation/main.cpp index 51bf0f8..fe92f5c 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -87,14 +87,17 @@ int main(int argc, char* argv[]){ auto input_data = albp::ReadFastaQueryTargetPair(refFile, queFile); + constexpr size_t chunk_size = 10000; + constexpr int streams_per_gpu = 2; + albp::Timer timer_calc; timer_calc.start(); AlignmentResults results; if(in_arg == "aa"){ - results = gpu_bsw_driver::kernel_driver(input_data, blosum62.data(), -6, -1); + results = gpu_bsw_driver::kernel_driver(input_data, blosum62.data(), -6, -1, streams_per_gpu, chunk_size); } else if(in_arg == "dna") { - results = gpu_bsw_driver::kernel_driver(input_data, match_mismatch_scores.data(), -3, -1); + results = gpu_bsw_driver::kernel_driver(input_data, match_mismatch_scores.data(), -3, -1, streams_per_gpu, chunk_size); } else { std::cerr<<"Data type must be 'aa' or 'dna'!"< #include -constexpr int STREAMS_PER_GPU = 2; - -int get_new_min_length(const short *const alAend, const short *const alBend, const albp::RangePair &rp); - - // for storing the alignment results +// for storing the alignment results struct AlignmentResults{ AlignmentResults() = default; AlignmentResults(const size_t size); @@ -136,13 +132,13 @@ AlignmentResults kernel_driver( const albp::FastaPair &input_data, const short scoring_matrix[], const short openGap, - const short extendGap + const short extendGap, + const int streams_per_gpu, + const size_t chunk_size ){ albp::Timer timer_total; timer_total.start(); - constexpr size_t chunk_size = 10000; - // Assuming that read and contig vectors are same length const auto totalAlignments = input_data.sequence_count(); @@ -179,7 +175,7 @@ AlignmentResults kernel_driver( albp::DeviceMallocUnique(ENCOD_MAT_SIZE, encoding_matrix) //Only used by RNA kernel }); - for(int s=0;s Date: Mon, 3 Aug 2020 13:38:24 -0600 Subject: [PATCH 46/47] Drop GPU swap in favour of thrust --- CMakeLists.txt | 1 - include/gpu_bsw/kernel.hpp | 20 ++++++-------------- unittest/test_misc.cpp | 16 ---------------- 3 files changed, 6 insertions(+), 31 deletions(-) delete mode 100644 unittest/test_misc.cpp diff --git a/CMakeLists.txt b/CMakeLists.txt index b28aa3b..c783b97 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -19,7 +19,6 @@ set(sources set(test_sources unittest/test_blockShuffleReduce_with_index.cu unittest/test_main.cpp - unittest/test_misc.cpp unittest/test_sequence_process.cu unittest/test_warpReduceMax_with_index.cu ) diff --git a/include/gpu_bsw/kernel.hpp b/include/gpu_bsw/kernel.hpp index 0c3ceff..5f83012 100644 --- a/include/gpu_bsw/kernel.hpp +++ b/include/gpu_bsw/kernel.hpp @@ -1,6 +1,8 @@ #ifndef KERNEL_HPP #define KERNEL_HPP +#include + #include #include #include @@ -163,16 +165,6 @@ findMaxFour(const short first, const short second, const short third, const shor -template -__inline__ __device__ __host__ void -swap(T &a, T &b){ - T temp(a); - a = b; - b = temp; -} - - - struct Cell { short H = 0; short F = 0; @@ -237,10 +229,10 @@ sequence_process( // Sequence B. If this isn't the case, we swap things around to make the code // below simpler. if(lengthSeqA>lengthSeqB){ - swap(lengthSeqA, lengthSeqB ); - swap(seqA_align_begin, seqB_align_begin); - swap(seqA_align_end, seqB_align_end ); - swap(seqA, seqB ); + thrust::swap(lengthSeqA, lengthSeqB ); + thrust::swap(seqA_align_begin, seqB_align_begin); + thrust::swap(seqA_align_end, seqB_align_end ); + thrust::swap(seqA, seqB ); } extern __shared__ char is_valid_array[]; diff --git a/unittest/test_misc.cpp b/unittest/test_misc.cpp deleted file mode 100644 index 57553c4..0000000 --- a/unittest/test_misc.cpp +++ /dev/null @@ -1,16 +0,0 @@ -#include "doctest.h" - -#include -#include - -#include - -#include - -TEST_CASE("swap"){ - int a = 3; - int b = 5; - gpu_bsw::swap(a,b); - CHECK(a==5); - CHECK(b==3); -} \ No newline at end of file From ee0caa7b86f93120eef730afd159d143119b61ff Mon Sep 17 00:00:00 2001 From: Richard Barnes Date: Tue, 11 Aug 2020 14:49:47 -0600 Subject: [PATCH 47/47] Don't proceed if sequences are too long Update ALBP --- evaluation/main.cpp | 7 +++++++ submodules/alignment_boilerplate | 2 +- 2 files changed, 8 insertions(+), 1 deletion(-) diff --git a/evaluation/main.cpp b/evaluation/main.cpp index fe92f5c..e81f26c 100644 --- a/evaluation/main.cpp +++ b/evaluation/main.cpp @@ -87,6 +87,13 @@ int main(int argc, char* argv[]){ auto input_data = albp::ReadFastaQueryTargetPair(refFile, queFile); + for(size_t i=0;i1024 && input_data.b.sequences[i].size()>1024){ + std::cerr<<"The input contains a pair of sequences which are each longer than 1024 bases. Cannot proceed."<