Error in names(taxid) <- gid : 'names' attribute [2] must be the same length as the vector [1]

[AwesomePz]

Hello dear developer!
I've encountered some problems in the use of the program, never able to solve them, with you want to ask you for advice.
When I run the code, r reports error "Error in names(taxid) <- gid : 'names' attribute [2] must be the same length as the vector [1]". I don't quite understand how this can be solved, and I'm asking for your help.

Here is my exact code

registerDoMC(8)
chengji_rbcL = search_primer_pair(
forward = 'GGCAGCATTCCGAGTAACTCCTC',
reverse = 'CGTCCTTTGTAACGATCAAG',
name = 'chengji rbcL',
num_aligns = 500,
num_permutations = 25,
simplify = TRUE,
distance_options = list(model = 'raw'),
.parallel = TRUE,
total_primer_specificity_mismatch=3,
clustal_options = c(exec='clustalo path'),
.progress='none'
)

And when I simplified the code to

chengji_rbcL = search_primer_pair(
forward = 'GGCAGCATTCCGAGTAACTCCTC',
reverse = 'CGTCCTTTGTAACGATCAAG',
name = 'chengji rbcL',
clustal_options = c(exec='clustalo path'),
)

Still have the same problem
I would be honored if you could help me.